RESUMO
Inhaled medicines are designed mainly to provide safe and efficacious treatment of respiratory diseases, offering the potential advantages of targeted drug delivery such as reduced onset time and increased therapeutic ratio. However, as a flipside of targeted drug delivery, drug levels in the relevant effect compartment cannot be easily assessed. In combination with technical challenges associated with aerosolizing and administering an inhaled medicine, this renders inhalation product development demanding in the regulatory aspect as well. Emerging technologies that could address some of these challenges include (i) mechanistic pharmacokinetic/pharmacodynamic (PK/PD) modeling, which in combination with experimental techniques such as positron emission tomography could provide information on local target engagement; (ii) patient-feedback features in combination with electronic monitoring, which may improve patient adherence as well as patient handling; and (iii) controlled-release formulations and nanotechnology-based formulations with high drug load, which may expand the scope of development of compounds and targets suitable for inhalation product development.
Assuntos
Sistemas de Liberação de Medicamentos , Desenho de Fármacos , Modelos Biológicos , Administração por Inalação , Aerossóis , Preparações de Ação Retardada , Humanos , Adesão à Medicação , Nanotecnologia , Preparações Farmacêuticas/administração & dosagem , Tomografia por Emissão de Pósitrons , Doenças Respiratórias/tratamento farmacológico , Distribuição TecidualRESUMO
Typically, inhaled drugs are rapidly absorbed into the bloodstream, which results in systemic side effects and a brief residence time in the lungs. PEGylation was evaluated as a novel strategy for prolonging the retention of small inhaled molecules in the pulmonary tissue. Hydrolysable ester conjugates of PEG1000, PEG2000, 2000, PEG3400 and prednisolone, a model drug cleared from the lungs within a few minutes, were synthesised and thoroughly characterised. The conjugates were stable in buffers with hydrolysis half-lives ranging from 1h to 70 h, depending on the pH and level of substitution. With the exception of PEG3400-prednisolone, conjugates did not induce a significant lactate dehydrogenase (LDH) release from Calu-3 cells after a 20 h exposure. Following nebulisation to isolated perfused rat lungs (IPRL), the PEG2000 and mPEG2000 conjugates reduced the maximum prednisolone concentration in the perfusate (Cmax) by 3.0 and 2.2 fold, respectively. Moreover, while prednisolone was undetectable in the perfusion solution beyond 20 min when the free drug was administered, prednisolone concentrations were still quantifiable after 40 min following delivery of the conjugates. This study is the first to demonstrate hydrolysable PEG drug ester conjugates are a promising approach for optimising the pharmacokinetic profile of small drugs delivered by inhalation.
Assuntos
Pulmão/metabolismo , Polietilenoglicóis/farmacocinética , Prednisolona/farmacocinética , Administração por Inalação , Animais , Linhagem Celular Tumoral , Preparações de Ação Retardada/administração & dosagem , Preparações de Ação Retardada/química , Preparações de Ação Retardada/farmacocinética , Ésteres , Humanos , Masculino , Modelos Biológicos , Peso Molecular , Polietilenoglicóis/administração & dosagem , Polietilenoglicóis/química , Prednisolona/administração & dosagem , Prednisolona/química , Ratos , Ratos WistarRESUMO
The Andean seed crop quinoa, Chenopodium quinoa Willd., is an important export of Bolivia, Ecuador, and Peru. Key foliar diseases of quinoa include quinoa downy mildew (caused by Peronospora variabilis Gäum) (1), Ascochyta leaf spot (caused by Ascochyta sp.) (1), and a Cercospora-like leaf spot, the latter of which has been observed on cultivated quinoa (Jose B. Ochoa, unpublished) and native Chenopodium species. Passalora dubia (Riess) U. Braun (syn. Cercospora dubia) was tested in Europe as a biological control agent for Chenopodium album (3) and has been reported on C. album in the United States (U.S. National Fungus Collections). Quinoa field plots were established in Pennsylvania during summer 2011 and Cercospora-like leaf spot symptoms were first observed on quinoa in Centre Co. and Lancaster Co. in August 2011, after an extended rainy period. Foliar symptoms were round to oval, brown to grey-black lesions, less than 1 cm in diameter, with darker brown, reddish margins. Similar symptoms were observed on C. album weeds within both fields. Using a hand lens, conidia were observed within sporulating lesions. Conidia were hyaline and septate, 25 to 98 µm × 5 to 10 µm, and had an average of six cells per conidium. The fungus was isolated by picking single conidia from sporulating lesions (under a dissecting scope) and incubated on V8 agar in the dark at 20°C to induce sporulation. For DNA extraction, cultures were grown in potato dextrose broth amended with yeast extract. The internal transcribed spacer (ITS) region was amplified using primers ITS4 and ITS5 (2), and the resulting sequence shared 99% maximum identity with a vouchered isolate of P. dubia (GenBank EF535655). To test the pathogenicity of our P. dubia isolate, 5.9 × 103 conidia/ml (suspended in sterile water with 0.1% Tween 20) or the control solution with no conidia were sprayed, using an atomizer, onto 2-month-old quinoa plants, with 18 replications per treatment. Plants were covered with a humidity dome and maintained at >99% RH for 48 h. Plants were grown in the greenhouse at approximately 65% RH. After 1 month, circular to oval light brown lesions (<1 cm diameter) with darker margins were observed on approximately 10% of the leaves of inoculated plants, whereas no symptoms were observed on the control plants. Infected leaves were collected, incubated in a humidity chamber, and conidia were picked from sporulating lesions and inoculated onto V8 agar amended with 3% (w/v) fresh, ground quinoa plant tissue (4). Cultures were maintained at 20°C with 16-h photoperiod to induce sporulation. The identity of the reisolated fungus was confirmed morphologically and by DNA sequencing to be identical to the isolate used to test Koch's postulates. P. dubia was also isolated from C. album lesions and infected C. album may have served as a source of inoculum for quinoa. To our knowledge, this is the first report of Passalora leaf spot of quinoa in the United States. References: (1) S. Danielsen. Food Rev. Int. 19:43, 2003. (2) S. Goodwin et al. Phytopathology 91:648, 2001. (3) P. Scheepens et al. Integ. Pest. Man. Rev. 2:71, 1997. (4) M. Vathakos. Phytopathology 69:832, 1979.
RESUMO
The Andean crop quinoa (Chenopodium quinoa Willd.), an amaranthaceous pseudograin, is an important food and export crop for this region. Quinoa is susceptible to Ascochyta leaf spot reportedly caused by Ascochyta hyalospora and/or A. caulina (1,2), and quinoa seeds can be infested by A. hyalospora (3). Quinoa fields were established in Pennsylvania during summer 2011. Widespread leafspot symptoms were observed on quinoa in mid-August 2011 in Centre County, PA. Tan to reddish-brown, irregularly shaped lesions were observed with numerous black pycnidia randomly distributed within each lesion. Crushed pycnidia revealed sub-hyaline to light brown, 1 to 2, or less often 3 septate, cylindrical to ovoid spores, 13 to 25 µm long by 5 to 10 µm wide. Pure cultures of Ascochyta were obtained by plating pycnidia from surface disinfested leaves onto half strength acidified potato dextrose agar (APDA). To obtain conidia for pathogenicity trials, cultures were transferred to oatmeal agar and placed in a 20°C incubator with a 12-h photoperiod. Conidia were harvested by scraping 2-week-old cultures. The conidial suspension was filtered through cheesecloth and adjusted to 1.8 × 105 conidia/mL. Tween 20 (0.1%) was added to the final inoculum and sprayed (with a Crown Spra-tool) onto ten 1-month old quinoa plants. Six plants sprayed with sterile water with 0.1% Tween 20 served as controls. Plants were placed in a growth chamber and bagged for 48 h to maintain >95% humidity. After 48 h, tan, irregularly shaped lesions were observed on inoculated plants, but no symptoms were observed on control plants. Plants were grown for 2 more weeks to observe symptom development, and then leaves with characteristic lesions were collected for isolation. Symptomatic leaves were surface disinfested in 10% bleach for 1 min and tissue from the lesion periphery was plated onto APDA. Obtained cultures were morphologically and molecularly identical to those obtained from quinoa fields. For molecular identification of the pathogen, DNA was extracted from cultures of Ascochyta and amplified using ITS4 (TCCTCCGCTTATTGATATGC) and ITS5 (GGAAGTAAAAGTCGTAACAAGG) primers. Sequences obtained shared 99% maximum identity with a GenBank accession of A. obiones (GU230752.1), a species closely related to A. hyalospora and A. caulina (4). However, the obtained pathogen is morphologically more similar to A. hyalospora and A. chenopodii, but not to A. caulina or A. obiones. At this time, final species identification is impossible because no GenBank sequence data is available for A. hyalospora or A. chenopodii. To our knowledge, this is the first report of Ascochyta leaf spot of quinoa in the United States. The impact of Ascochyta leaf spot on domestic and global quinoa production is unknown, but management of foliar diseases of quinoa, including Ascochyta leaf spot, is a critical component of any disease management program for quinoa. References: (1) S. Danielsen. Food Rev. Int. 19:43, 2003. (2) M. Drimalkova. Plant Protect. Sci. 39:146, 2003. (3) G. Boerema. Neth. J. Plant. Pathol. 83:153, 1977. (4) J. de Gruyter. Stud. Mycol. 75:1, 2012.
RESUMO
AIMS: The aim of this study was to determine whether endophytic Bacillus cereus isolates from agronomic crops possessed genes for the nonhaemolytic enterotoxin (Nhe) and haemolysin BL (HBL) and, therefore, have the potential to cause diarrhoeal illness in humans. METHODS AND RESULTS: PCR followed by sequencing confirmed the presence of enterotoxin genes nheA, nheB, nheC, hblA, hblC, hblD in endophytic B. cereus. All nhe genes were detected in 59% of endophytic B. cereus, while all hbl genes were detected in 44%. All six genes were detected in 41% of isolates. Enterotoxin genes were not detected in 15% of B. cereus isolates. Reverse transcriptase real-time PCR confirmed that endophytic B. cereus could express enterotoxin genes in pure culture. CONCLUSIONS: This study showed that endophytic B. cereus isolates that possess genes for enterotoxin production are present in agronomic crops. Other endophytic B. cereus isolates lacked specific genes or lacked all nhe and hbl genes. Additionally, host, country of origin and tissue of origin had no impact on the enterotoxin genes detected. SIGNIFICANCE AND IMPACT OF THE STUDY: Bacillus cereus with the potential of causing diarrhoeal illness in humans is a cosmopolitan endophytic inhabitant of plants, not incidental surface inhabitants or contaminants, as often suggested by previous research.
Assuntos
Bacillus cereus/genética , Enterotoxinas/genética , Bacillus cereus/isolamento & purificação , Bacillus cereus/metabolismo , Sequência de Bases , Produtos Agrícolas/microbiologia , Enterotoxinas/análise , Enterotoxinas/biossíntese , Microbiologia de Alimentos , Proteínas Hemolisinas/genética , Proteínas Hemolisinas/metabolismo , Humanos , Dados de Sequência Molecular , Reação em Cadeia da Polimerase em Tempo RealRESUMO
Quinoa, Chenopodium quinoa Willd., is an Andean crop prized for its high nutritional value and adaptability to harsh environments. Quinoa is plagued by downy mildew caused by Peronospora variabilis Gäum (formerly Peronospora farinosa f. sp. chenopodii Byford) (1). Quinoa production has spread beyond native Andean ranges and quinoa downy mildew has been reported in India, Canada, and Denmark (1). During the summer of 2011, quinoa trials were established to determine the ability of quinoa to grow under Mid-Atlantic conditions and monitor for regional disease problems. In July, after cool, rainy conditions, downy mildew-like symptoms were observed on quinoa at research plots in Centre and Lancaster counties of Pennsylvania. Symptoms and signs consisted of irregularly shaped areas of foliar chlorosis or pink discoloration accompanied by dense, gray sporulation on both leaf surfaces. Sporangia were tan to gray-brown, semi-ovoid, often with a pedicel, mean length of 31 µm, and mean width of 23 µm. Sporangiophores branched dichotomously, and the terminal branchlets curved and tapered to a point. Orange oospores were present in field samples of leaf tissue. DNA was extracted from infected foliar tissue and sporangial suspensions. A seminested PCR protocol (2) was used to obtain partial internal transcribed spacer (ITS) sequences of six Peronospora isolates. The sequences shared 99% maximum identity to a known P. variabilis accession (FM863721.2) in GenBank. A voucher specimen was deposited into the U.S. National Fungus Collections (BPI 882064). Pathogenicity of each of two strains of P. variabilis was confirmed by inoculating quinoa with sporangia (4). Sporangia were shaken from leaves in sterile distilled water and the suspension was filtered through cheesecloth. A 0.01% Tween solution was added and the suspension diluted to 103 sporangia/ml. With an atomizer, a 10-ml sporangial suspension (or sterile water for noninoculated control plants) was sprayed onto one flat of 18 2-week-old quinoa plants, and relative humidity was increased to saturation using a humidity dome for 24 h. After 1 week, chlorosis and pink discoloration were noted on leaves of inoculated quinoa, and after 18 h of subsequent increased humidity (>95% relative humidity), dense gray sporulation was observed. No symptoms were noted on noninoculated control plants. Sporangia and sporangiophores were examined morphologically and confirmed to be P. variabilis, confirming Koch's postulates. For culture maintenance, 2-week-old quinoa leaves were placed onto a sporangial suspension on top of 1% water agar and maintained in a growth chamber at 20°C with 16 h of light per day. Quinoa downy mildew is seedborne (3) and initial infections may have occurred from oospores in the pericarp, despite intensive processing of consumable quinoa seeds to remove saponins. To our knowledge, this is the first report of quinoa downy mildew in the United States and also the first report of P. variabilis in the United States. References: (1) Y. Choi et al. Mycopathologia 169:403, 2010. (2) D. Cooke et al. Fungal Genet. Biol. 30:17, 2000. (3) S. Danielson et al. Seed Sci. Technol. 32:91, 2004. (4) J. Ochoa et al. Plant Pathol. 48:425, 1999.
RESUMO
Cotton and snap bean were selected for a multi-year, multi-state regional (south-eastern USA) research project to evaluate the efficacy of both commercial and experimental bacterial and fungal biological control agents for the management of damping-off diseases. The goal for this portion of the project was to determine the viability and stability of biological agents after application to seed. The biological seed treatments used included: (1) Bacillaceae bacteria, (2) non-Bacillaceae bacteria, (3) the fungus Trichoderma and (4) the fungus Beauveria bassiana. Seed assays were conducted to evaluate the following application factors: short-term (< or = 3 months) stability after seed treatment; quality (i.e. isolate purity); compatibility with chemical pesticides and other biocontrol agents; application uniformity between years and plant species. For the bacterial treatments, the Bacillaceae genera (Bacillus and Paenibacillus) maintained the greatest population of bacteria per seed, the best viability over time and the best application uniformity across years and seed type. The non-Bacillaceae genera Burkholderia and Pseudomonas had the least viability and uniformity. Although Beauveria bassiana was only evaluated one year, the seed fungal populations were high and uniform. The seed fungal populations and uniformity for the Trichoderma isolates were more variable, except for the commercial product T-22. However, this product was contaminated with a Streptomyces isolate in both the years that it was evaluated. The study demonstrated that Bacillaceae can be mixed with Trichoderma isolates or with numerous pesticides to provide an integrated pest control/growth enhancement package.
Assuntos
Fabaceae/microbiologia , Gossypium/microbiologia , Controle Biológico de Vetores/métodos , Doenças das Plantas/microbiologia , Sementes/efeitos dos fármacos , Bacillaceae/fisiologia , Burkholderia/fisiologia , Estabilidade de Medicamentos , Fungos Mitospóricos/fisiologia , Pseudomonas/fisiologia , Sementes/microbiologiaRESUMO
Exocrine pancreatic cancer is significantly more common in younger men than in younger women. The male-to-female sex ratio is, in most countries, between 1.25 and 1.75 to 1, but decreases with increasing age. Moreover, prior oophorectomy appeared in one study to be significantly more common in women with pancreatic cancer than in controls. This has raised interest in sex hormones in the development in pancreatic cancer. It has been questioned if there are estrogen receptors in ductal pancreatic cancer, but there are no doubt estrogen receptors and estrogen-binding protein in human healthy pancreas. It is also well proven that it is possible to influence experimental pancreatic cancer with estrogens. However, in clinical studies tamoxifen has repeatedly been shown to be without significant effects. On the other hand, there are also androgen receptors in pancreatic cancer and testosterone has been shown to strongly promote growth in experimental pancreatic cancers. It is therefore of considerable interest that an antiandrogen recently was shown to significantly prolong life in patients with unresectable pancreatic carcinoma. However, in patients with advanced pancreatic carcinoma the S-testosterone is low, far lower than what could be expected due to weight-loss and malnourishment alone. Pancreatic cancer has etiologically been connected to diet, for example the intake of fat. Cholecystokinin receptors have been found on human pancreatic cancer, possible to stimulate in vitro by cholecystokinin (CCK). Studies with CCK-receptor binding, hybridization with radiolabeled complementary DNA (cDNA) probes, or reverse-transcription polymerase chain reaction have shown that CCK-A receptors also are present in rat pancreatic putative preneoplastic lesions and cancer tissue, rat pancreatic-cancer cell lines, pancreatic carcinomas in transgenic mice, hamster pancreatic cancer, and human pancreatic cancer cell lines and tumors. Also, CCK-B receptors have been found in some human pancreatic cancers. There are a vast number of experiments done on CCK-stimulation of pancreatic cancer. They indicate that CCK may have a promotional effect on exocrine pancreatic cancer, but it is not probable that hyperstimulation with CCK alone induce pancreatic cancer. At present, however, despite a lot of evidence for a hormone-dependence of pancreatic cancer there are no data confirming a role for estrogens, androgens, CCK or their antagonists in clinical treatment of exocrine pancreatic cancer.
Assuntos
Neoplasias Pancreáticas/etiologia , Animais , Cricetinae , Estrogênios/farmacologia , Feminino , Humanos , Masculino , Camundongos , Pâncreas/efeitos dos fármacos , Neoplasias Pancreáticas/tratamento farmacológico , Ratos , Receptores da Colecistocinina/análise , Receptores de Estrogênio/análise , Fatores de Risco , Tamoxifeno/uso terapêuticoRESUMO
After an apparently curative resection, most patients develop local recurrence within the resection bed. In addition, almost all develop liver metastases. This implies that the surgical resection, even if extended, seldom is enough, and that an adjuvant treatment must be effective not only against systemic spread, but also against local recurrence. However, the time schedule may be different for different types of recurrence, resulting in different time frames for the adjuvant treatment. Although extended radical operations may increase the proportion of patients who can undergo resections, the incidence of local recurrences seems unchanged. There are, however, no randomized studies yet comparing the "Standard Whipple" with more extended resection. Intraoperative radiation (IORT) has failed to demonstrate a difference in long-term survival, but there have been reports of a decreased frequency of local progression at the site of the primary tumor. Therefore, it is encouraging that IORT seems to diminish the local recurrences after radical resections. However, randomized studies are also missing for this procedure. These are today only three published studies of adjuvant chemotherapy after radical pancreaticoduodenectomy, but a few more will be finished shortly. Still, the results have not convincingly shown that modern chemotherapy with or without radiotherapy prolongs the life of the patients, and there is little evidence for improving the quality of life. However, since the results are far from satisfactory after resection, more efforts should be made to find better treatment modalities, including adjuvant protocols.
Assuntos
Neoplasias Pancreáticas/terapia , Quimioterapia Adjuvante , Humanos , Recidiva Local de NeoplasiaRESUMO
The relationship between cytogenetic findings and clinicohistopathological parameters was assessed in 29 patients with pancreatic adenocarcinoma. Karyotypic analysis revealed normal karyotypes (N) in 8 carcinomas and abnormal karyotypes (A) in 21. Within the A group, 8 cases had simple chromosome abnormalities (As), i.e., only one numerical or structural aberration, whereas 13 had complex changes with multiple numerical and structural abnormalities (Ac). No significant differences between the N and A groups were detected in terms of tumour grade, clinical stage, type of surgery performed, tumour site or size or the patient's age and survival. A correlation analysis between groups As and Ac revealed a significant difference with regard to grade, poorly differentiated carcinomas being more frequent in the Ac group. Patients in the Ac group had also a significantly shorter survival time than those in the As group. None of the other potentially prognostic parameters, i.e., grade, tumour site, stage and type of surgery performed, correlated significantly with clinical outcome.
Assuntos
Adenocarcinoma/genética , Adenocarcinoma/patologia , Neoplasias Pancreáticas/genética , Neoplasias Pancreáticas/patologia , Adenocarcinoma/mortalidade , Idoso , Feminino , Humanos , Cariotipagem , Masculino , Pessoa de Meia-Idade , Neoplasias Pancreáticas/mortalidadeRESUMO
Seven heat conduction calorimeters have been evaluated in terms of sensitivity and thermal response time. The use of a dynamic method to correct for the thermal inertia of the calorimeter is shown to reduce by one order of magnitude the time required to conduct a stepwise titration experiment involving a fast reaction. The ability to determine association constants of strong 1:1 complexes has been evaluated in terms of the precision of determining thermal energy.
Assuntos
Calorimetria/instrumentação , Simulação por Computador , Método de Monte Carlo , Sensibilidade e Especificidade , Condutividade Térmica , Fatores de Tempo , TitulometriaRESUMO
A 4.0-kb BamHI-HindIII fragment encoding the cryIIA operon from the NRD-12 isolate of Bacillus thuringiensis subsp. kurstaki was cloned into Escherichia coli. The nucleotide sequence of the 2.2-kb AccI-HindIII fragment containing the NRD-12 cryIIA gene was identical to the HD-1 and HD-263 cryIIA gene sequences. Expression of cryIIA and subsequent purification of CryIIA inclusion bodies resulted in a protein with insecticidal activity against Heliothis virescens, Trichoplusia ni, and Culex quinquefasciatus but not Spodoptera exigua. The 4.0-kb BamII-HindIII fragment encoding the cryIIA operon was inserted into the B. thuringiensis-E. coli shuttle vector pHT3101 (pMAU1). pMAU1 was used to transform an acrystalliferous HD-1 strain of B. thuringiensis subsp. kurstaki and a leaf-colonizing strain of B. cereus (BT-8) by using electroporation. Spore-crystal mixtures from both transformed strains were toxic to H. virescens and T. ni but not Helicoverpa zea or S. exigua.
Assuntos
Bacillus cereus/genética , Bacillus thuringiensis/genética , Proteínas de Bactérias/genética , Toxinas Bacterianas , Endotoxinas/genética , Escherichia coli/genética , Genes Bacterianos , Controle Biológico de Vetores , Sequência de Aminoácidos , Animais , Bacillus cereus/metabolismo , Bacillus thuringiensis/metabolismo , Toxinas de Bacillus thuringiensis , Proteínas de Bactérias/biossíntese , Sequência de Bases , Clonagem Molecular , Conjugação Genética , Culex , Endotoxinas/biossíntese , Escherichia coli/metabolismo , Regulação Bacteriana da Expressão Gênica , Proteínas Hemolisinas , Dados de Sequência Molecular , Homologia de SequênciaRESUMO
Isothermal microcalorimetry was used in order to continuously monitor and quantitatively assess the action of two antineoplastic drugs, methotrexate (MTX) and 6-thioguanine (6-TG), on a human T-lymphoma cell line, CCRF-CEM. The results with MTX were compared with data from experiments with a MTX-resistant subline, CEM/MTX. The slope of the power-time curve after drug injection relative to that obtained during unperturbed growth, was used to construct dose-response curves. The normal cell line was characterized by a D50 value (i.e., the dose producing half the maximal response) of 0.05 microM for MTX and 0.38 microM for 6-TG. For the MTX-resistant subline the D50 value was 8 microM of MTX. Comparisons of the continuous power-time curves showed the inhibitory effect of 6-TG to be faster than that of MTX.
Assuntos
Linfoma de Células T/patologia , Metotrexato/farmacologia , Tioguanina/farmacologia , Calorimetria , Contagem de Células , Relação Dose-Resposta a Droga , Resistência a Medicamentos , Humanos , Linfoma de Células T/tratamento farmacológico , Metotrexato/uso terapêutico , Microquímica , Tioguanina/uso terapêutico , Fatores de Tempo , Células Tumorais CultivadasRESUMO
The progression of T-lymphoma cells (CCRF-CEM) growing in suspension has been monitored during long term (12-28 h) batch experiments using microcalorimetry. In parallel with the calorimetric measurements, changes in cell concentration, pH, p(O2) and concentrations of the main energy sources (glucose and glutamine) were determined. The overall metabolic rate per cell (as reflected by the heat production rate per cell, Pcell) and the growth rate decreased with time. These changes could be attributed solely to the decrease in pH of the medium until the total heat production, Q, exceeded 1.2 J per ml (corresponding to an incubation time of 20 h of a batch having an initial cell concentration of 1 x 10(6) cells per ml). The lowering of p(O2) to a level of 0.02 mmol/l or the decrease in concentrations of glucose and glutamine to 7.7 and 1.3 mmol/l, respectively, did not influence Pcell or the growth pattern. No "crowding effect" was observed for the cells in the investigated concentration range (0.6-1.3) x 10(6) cells per ml.
Assuntos
Divisão Celular , Metabolismo Energético , Linfócitos T/metabolismo , Células Tumorais Cultivadas/metabolismo , Calorimetria , Concentração de Íons de Hidrogênio , Cinética , Linfoma de Células T , Linfócitos T/citologia , Células Tumorais Cultivadas/citologiaRESUMO
A method is described for simultaneous measurements of heat production rate, oxygen activity and pH, using a 3-ml stirred microcalorimetric titration/perfusion vessel fitted with a polarographic oxygen sensor and a combination pH-electrode. Heat production rate (+/- 0.3 microW), pH (+/- 0.01) and oxygen concentration (+/- 4 mumol/l) could be measured without any cross interference between the three signals. Results from measurements on suspensions of T-lymphoma cells and E. coli are presented.
Assuntos
Calorimetria , Divisão Celular , Oxigênio/metabolismo , Calorimetria/instrumentação , Calorimetria/métodos , Eletrodos , Escherichia coli/crescimento & desenvolvimento , Humanos , Concentração de Íons de Hidrogênio , Ligantes , Linfoma de Células T/patologia , Polarografia/instrumentação , Células Tumorais CultivadasAssuntos
Hormônios Esteroides Gonadais/metabolismo , Neoplasias Pancreáticas/metabolismo , Androgênios/metabolismo , Colecistocinina/metabolismo , Avaliação de Medicamentos , Estrogênios/metabolismo , Humanos , Neoplasias Pancreáticas/tratamento farmacológico , Ligação Proteica , Receptores de Estrogênio/metabolismo , Globulina de Ligação a Hormônio Sexual/metabolismo , Tamoxifeno/uso terapêuticoAssuntos
Indicadores Básicos de Saúde , Inquéritos Epidemiológicos , Laboratórios/normas , Doenças Profissionais/prevenção & controle , Promoção da Saúde , Humanos , Cidade de Nova Iorque , Administração em Saúde Pública , Fatores de Risco , Estados Unidos , United States Occupational Safety and Health AdministrationRESUMO
Rotating soybean (Glycine max cv. Kirby) with peanut (Arachis hypogaea cv. Florunner) for managing Meloidogyne arenaria race 1 was studied for 3 years (1985-87) in a field near Headland, Alabama. Each year soybean plots had lower soil numbers of M. arenaria second-stage juveniles (J2) at peanut harvest than did plots in peanut monocnlture. Peanut following either 1 or 2 years of soybean resulted in approximately 50% reduction in J2 soil population densities and a 14% (1-year soybean) or 20% (2-year soybean) increase in yields compared with continuous peanut. The soybean-peanut rotation increased peanut yield equal to or higher than the yield obtained with continuous peanut treated with aldicarb at 0.34 g a.i./mL.
RESUMO
The efficacy of 'Deltapine 90' cotton (Gossypium hirsutum) in rotation with 'Florunner' peanut (Arachis hypogaea) for the management of Meloidogyne arenaria was studied for 2 years in a field in southeastern Alabama. In 1985, M. arenaria juvenile populations in plots with cotton were 98% lower than in plots with peanut. Peanut and cotton yields were increased by treatment with aldicarb (3.3 kg a.i./ha in a 20-cm-band) in 1985 but not in 1986. In 1986, peanut yields were highest and M. arenaria juvenile populations in soil were lowest in plots that had cotton the previous year. In 1986, numbers of M. arenaria juveniles in plots with peanut both years were reduced by treatment with aldicarb to levels found in plots with cotton-peanut rotation. The use of aldicarb in peanut following cotton similarly treated reduced the incidence of southern blight (Sclerotium rolfsii). Cotton-peanut is a good rotation for the management of M. arenaria and to increase peanut yields without the use of nematicides.
RESUMO
The effects of aldicarb on soybean cyst (Heterodera glycines) and root-knot (Meloidogyne incognita and M. arenaria) nematode populations, early season insect pests and soybean (Glycine max) yield were evaluated in five field experiments in northern and southern Alabama. Aldicarb significantly (P = 0.05) reduced nematode populations in only two cases: M. arenaria in Centennial soybean in the Wiregrass site and M. incognita in Bedford soybean in a Tennessee Valley site. No significant difference (P = 0.05) in mean percentage main stem or petiole girdling by threecornered alfalfa hopper (Spissistilus festinus) or in mean number of plants damaged by lesser cornstalk borer (Elasmopalpus lignosellus) occurred among treatments in any experiment. Soybean yields were significantly (P = 0.05) increased in only two cases: in the nematode susceptible Essex and Cobb cultivars planted in the Tennessee Valley and Gulf Coast sites, respectively. Unusually dry 1986 weather conditions may have reduced the activity of aldicarb.