Mitochondrial DNA content varies with pathological characteristics of breast cancer.

Changes in mitochondrial DNA (mtDNA) content in cancers have been reported with controversial results, probably due to small sample size and variable pathological conditions. In this study, mtDNA content in 302 breast tumor/surrounding normal tissue pairs were evaluated and correlated with the clinico-pathological characteristics of tumors. Overall, mtDNA content in tumor tissues is significantly lower than that in the surrounding normal tissues, P < 0.00001. MtDNA content in tumor tissues decreased with increasing tumor size. However, when the tumor is very large (>50 cm(3)), mtDNA content started to increase. Similarly, mtDNA content decreased from grades 0 and I to grade II tumors, but increased from grade II to grade III tumors. Tumors with somatic mtDNA alterations in coding region have significantly higher mtDNA content than tumors without somatic mtDNA alterations (P < 0.001). Tumors with somatic mtDNA alterations in the D-Loop region have significantly lower mtDNA content (P < 0.001). Patients with both low and high mtDNA content in tumor tissue have significantly higher hazard of death than patients with median levels of mtDNA content. mtDNA content in tumor tissues change with tumor size, grade, and ER/PR status; significant deviation from the median level of mtDNA content is associated with poor survival.

A common mitochondrial polymorphism 10398A>G is associated metabolic syndrome in a Chinese population.

We conducted a two-step case-control study to investigate the association between mtDNA variants and metabolic syndrome (MS) in Chinese. We initially screened 79 mitochondrial single nucleotide polymorphisms (mtSNPs) in 141 cases and 506 controls, and five mtSNPs had a p<0.05. We replicated results for the most significant mtSNP 10398A>G in additional 396 case and 424 controls (p=0.047, OR=1.26). The G allele frequency in the screening and follow up data was 66% and 55.2% in the cases, and 52.3% and 50.2% in the controls, respectively. Our results suggest the G allele of 10398A>G increases a risk for MS.

Mitochondrial dysfunction in human breast cancer cells and their transmitochondrial cybrids.

Somatic mitochondrial DNA alterations have been found in all types of cancer. To better understand the role of mitochondria and their involvement in the pathogenic mechanisms of cancer development, the effects of cancer mitochondria were investigated in a defined nuclear background using a transmitochondrial cybrid system. Our results demonstrated that cancer mitochondria confer a significant reduction in cell growth when cells are metabolically stressed in a galactose medium. Activities of the respiratory chain complexes, cellular oxygen consumption, and ATP synthesis rates were found to be much lower in breast cancer cells, than those in normal breast epithelial cells of MCF-10A (10A). These results suggest that there is reduced mitochondrial function in the studied breast cancer cell lines. Similarly reduced mitochondrial function was observed in cybrids containing cancer mitochondria. Novel tRNA mutations were also identified in two breast cancer cell lines, possibly responsible for the observed mitochondrial dysfunction. We conclude that altered mitochondria in cancer cells may play a crucial role in tumor development.

Mitochondrial DNA variant interactions modify breast cancer risk.

Interactions between mitochondrial deoxyribonucleic acid (mtDNA) variants and the risk of developing breast cancer were investigated using DNA samples collected from non-Jewish European American breast cancer patients and ethnically age-matched female controls. Logistic regression was used to evaluate two-way interactions between 17 mtDNA variants. To control for multiple testing, empirical P values were calculated using permutation. Odds ratios (ORs) and corresponding 95% confidence intervals (CIs) were calculated to measure the contribution of variants in modifying the risk of developing breast cancer. A highly significant interaction was identified between variants 12308G and 10398G (empirical P value = 0.0028), with results suggesting these variants increase the risk of a woman developing breast cancer (OR = 3.03; 95% CI 1.53-6.11). Nominal significant P values were also observed for interactions between mtDNA variants 709A and 16189C; 4216C and 10398G; 4216C and 16189C; 10398G and 16159C; 13368A and 16189C; and 14766T and 16519C. However, after adjusting for multiple testing, the P values did not remain significant. Although it is important to elucidate the main effect of mtDNA variants on the risk of developing breast cancer, understanding gene x gene interactions will give a greater knowledge of disease etiology and aid in interpreting a woman's risk of developing breast cancer.

Mitochondrial genetic background modifies breast cancer risk.

Inefficient mitochondrial electron transport chain (ETC) function has been implicated in the vicious cycle of reactive oxygen species (ROS) production that may predispose an individual to late onset diseases, such as diabetes, hypertension, and cancer. Mitochondrial DNA (mtDNA) variations may affect the efficiency of ETC and ROS production, thus contributing to cancer risk. To test this hypothesis, we genotyped 69 mtDNA variations in 156 unrelated European-American females with familial breast cancer and 260 age-matched European-American female controls. Fisher's exact test was done for each single-nucleotide polymorphism (SNP)/haplogroup and the P values were adjusted for multiple testing using permutation. Odds ratio (OR) and its 95% confidence interval (95% CI) were calculated using the Sheehe correction. Among the 69 variations, 29 were detected in the study subjects. Three SNPs, G9055A (OR, 3.03; 95% CI, 1.63-5.63; P = 0.0004, adjusted P = 0.0057), A10398G (OR, 1.79; 95% CI, 1.14-2.81; P = 0.01, adjusted P = 0.19), and T16519C (OR, 1.98; 95% CI, 1.25-3.12; P = 0.0030, adjusted P = 0.0366), were found to increase breast cancer risk; whereas T3197C (OR, 0.31; 95% CI, 0.13-0.75; P = 0.0043, adjusted P = 0.0526) and G13708A (OR, 0.47; 95% CI, 0.24-0.92; P = 0.022, adjusted P = 0.267) were found to decrease breast cancer risk. Overall, individuals classified as haplogroup K show a significant increase in the risk of developing breast cancer (OR, 3.03; 95% CI, 1.63-5.63; P = 0.0004, adjusted P = 0.0057), whereas individuals bearing haplogroup U have a significant decrease in breast cancer risk (OR, 0.37; 95% CI, 0.19-0.73; P = 0.0023, adjusted P = 0.03). Our results suggest that mitochondrial genetic background plays a role in modifying an individual's risk to breast cancer.

Molecular bases of hearing loss in multi-systemic mitochondrial cytopathy.

PURPOSE: Hearing loss is a common clinical feature in classic mitochondrial syndromes. The purpose of this study was to evaluate the diverse molecular etiologies and natural history of hearing loss in multi-systemic mitochondrial cytopathies and the possible correlation between degree of hearing loss and neurological phenotype. METHODS: In this retrospective study we evaluated the clinical features and molecular bases of hearing loss associated with multi-systemic mitochondrial cytopathy. Forty-five patients with sensorineural hearing loss and definite diagnosis of mitochondrial cytopathy according to the published diagnostic criteria were studied. RESULTS: The sensorineural hearing loss was progressive and for the most part symmetrical with involvement of the higher frequencies. Both cochlear and retrocochlear involvement were found in this cohort. No correlation was found between the degree of hearing loss and the number and severity of neurological manifestations. Deleterious mtDNA point mutations of undisputed pathogenicity were identified in 18 patients. The A3243G mutation was the most frequently encountered among this group. MtDNA depletion, over-replication, and multiple deletions were found in further 11 cases. CONCLUSION: This study reveals an expanding spectrum of mtDNA abnormalities associated with hearing loss. No correlation was found between the degrees of hearing loss and the severity of neurological manifestations.

Novel mitochondrial DNA mutations associated with myopathy, cardiomyopathy, renal failure, and deafness.

Patients with mitochondrial disease usually manifest multisystemic dysfunction with a broad clinical spectrum. When the tests for common mitochondrial DNA (mtDNA) point mutations are negative and the mtDNA defects are still hypothesized, it is necessary to screen the entire mitochondrial genome for unknown mutations in order to confirm the diagnosis. We report an 8-year-old girl who had a long history of ragged-red fiber myopathy, short stature, and deafness, who ultimately developed renal failure and fatal cardiac dysfunction. Respiratory chain enzyme analysis on muscle biopsy revealed deficiency in complexes I, II/III, and IV. Whole mitochondrial genome sequencing analysis was performed. Three novel changes: homoplasmic 15458T > C and 15519T > C in cytochrome b, and a near homoplasmic 5783G > A in tRNA(cys), were found in the proband in various tissues. Her mother and asymptomatic sibling also carry the two homoplasmic mutations and the heteroplasmic 5783G > A mutation in blood, hair follicles, and buccal cells, at lower percentage. The 5783G > A mutation occurs at the T arm of tRNA(cys), resulting in the disruption of the stem structure, which may reduce the stability of the tRNA. 15458T > C changes an amino acid serine to proline at a conserved alpha-helix, which may force the helix to bend. These two mutations may have pathogenic significance. This case emphasizes the importance of pursuing more extensive mutational analysis of mtDNA in the absence of common mtDNA point mutations or large deletions, when there is a high suspicion of a mitochondrial disorder.

Exercise intolerance associated with a novel 8300T > C mutation in mitochondrial transfer RNAlys.

Mutations in the mitochondrial genome contribute to the pathophysiology of many neuromuscular diseases. Recently there has been an increased appreciation of the role of mitochondrial DNA (mtDNA) mutations in the etiology of exercise intolerance. Using TTGE (temporal temperature-gradient gel electrophoresis) and sequence analyses of the entire mitochondrial genome, we identified a novel heteroplasmic mutation (8300T > C) in the tRNAlys gene (MTTK) from a patient with unexplained exercise intolerance. The mutation was present in blood, hair, and muscle, with the highest percentage of heteroplasmy found in muscle. The results of muscle respiratory chain enzyme analysis are consistent with tRNA mutation. These data suggest that this novel mutation is yet another mtDNA mutation associated with muscle disease and should be considered in patients with similar symptoms.

Real-time quantitative polymerase chain reaction analysis of mitochondrial DNA point mutation.

Mitochondrial respiratory chain disorders are a group of clinically and genetically heterogeneous diseases. Several mitochondrial (mt)DNA point mutations are responsible for common mitochondrial diseases. These pathogenic mtDNA point mutations are usually heteroplasmic. Molecular diagnosis of the disease requires both qualitative detection of the mutation and quantitative analysis of the mutant heteroplasmy. In this report, two methods based on real-time quantitative polymerase chain reaction (PCR) analysis are used. The first method utilizes wild-type or mutant sequence-specific TaqMan probe, which is labeled with a fluorescent reporter molecule at the 5'-end of the oligonucleotide probe and a quencher at the 3'-end of the probe. The second method utilizes sequence-specific primers to amplify the wild-type or mutant sequence followed by SYBR green detection of PCR products. Both methods allow simultaneous detection and quantification of the mutant mtDNA. In this chapter, we describe the detailed procedures regarding the application of fluorescent probes, and real time quantitative PCR in the molecular diagnosis of mitochondrial DNA disorders.

Significance of somatic mutations and content alteration of mitochondrial DNA in esophageal cancer.

BACKGROUND: The roles of mitochondria in energy metabolism, the generation of ROS, aging, and the initiation of apoptosis have implicated their importance in tumorigenesis. In this study we aim to establish the mutation spectrum and to understand the role of somatic mtDNA mutations in esophageal cancer. METHODS: The entire mitochondrial genome was screened for somatic mutations in 20 pairs (18 esophageal squamous cell carcinomas, one adenosquamous carcinoma and one adenocarcinoma) of tumor/surrounding normal tissue of esophageal cancers, using temporal temperature gradient gel electrophoresis (TTGE), followed by direct DNA sequencing to identify the mutations. RESULTS: Fourteen somatic mtDNA mutations were identified in 55% (11/20) of tumors analyzed, including 2 novel missense mutations and a frameshift mutation in ND4L, ATP6 subunit, and ND4 genes respectively. Nine mutations (64%) were in the D-loop region. Numerous germline variations were found, at least 10 of them were novel and five were missense mutations, some of them occurred in evolutionarily conserved domains. Using real-time quantitative PCR analysis, the mtDNA content was found to increase in some tumors and decrease in others. Analysis of molecular and other clinicopathological findings does not reveal significant correlation between somatic mtDNA mutations and mtDNA content, or between mtDNA content and metastatic status. CONCLUSION: Our results demonstrate that somatic mtDNA mutations in esophageal cancers are frequent. Some missense and frameshift mutations may play an important role in the tumorigenesis of esophageal carcinoma. More extensive biochemical and molecular studies will be necessary to determine the pathological significance of these somatic mutations.

Molecular-clinical correlations in a family with variable tissue mitochondrial DNA T8993G mutant load.

Unlike many pathogenic mitochondrial DNA mutations, the T8993G mutation associated with Leigh syndrome (LS) and neurogenic muscle weakness, ataxia, retinitis pigmentosa (NARP) typically shows little variation in mutant load between different tissue types. We describe the molecular and clinical findings in a family with variable disease severity and tissue T8993G mutant loads. Real-time ARMS qPCR testing showed that two brothers with features of NARP and LS had high mutant loads (>90%) in all tissues tested, similar to previously reported cases. Their sister, who has mild speech delay but attends normal school, was found to have a relatively high mutant load (mean 93%) in tissues derived from endoderm (buccal mucosa) and mesoderm (blood and skin fibroblasts). However, in tissue derived from ectoderm (hair bulbs), she carried a considerably lower proportion of mutant mtDNA. Because both surface ectoderm, which gives rise to outer epithelia and hair, and neuroectoderm, which gives rise to the central nervous system, are derived from ectoderm, it is tempting to speculate that the mutant load detected in the oligosymptomatic sister's hair bulbs is a reflection of the brain mutant load. We conclude that significant variation in tissue mutant load may occur in at least some individuals that harbor the T8993G mutation. This adds additional complexity to genetic counseling and prenatal diagnosis in such instances. Given the shared embryonic origin of hair bulbs and brain, we recommend performing hair bulb mtDNA analysis in asymptomatic or oligosymptomatic individuals that have high blood mutant loads in order to understand better the genotype-phenotype correlations related to the T8993G mutation.

Simultaneous detection and quantification of mitochondrial DNA deletion(s), depletion, and over-replication in patients with mitochondrial disease.

Heterogeneous clinical expression of mitochondrial DNA (mtDNA) disorders depends on both qualitative and quantitative changes in mtDNA. We developed a sensitive and effective method that simultaneously detects mtDNA deletion(s) and quantifies total mtDNA content. The percentage of deletions and mtDNA content of 19 patients with single or multiple deletions were analyzed by real-time quantitative polymerase chain reaction (real-time qPCR) using TaqMan probes specific for mtDNA (tRNA leu(UUR), ND4, ATPase8, and D-loop regions) and nuclear DNA (AIB1, beta-2-microglobulin, and beta-actin). The proportion of deletion mutants determined by real-time qPCR was consistent with that determined by Southern analysis. Most patients with mtDNA deletions also demonstrated compensatory mtDNA over-replication. Multiple mtDNA deletions that were not detectable by Southern analysis due to low percentage of each deletion molecule were readily detected and quantified by real-time qPCR. Furthermore, 12 patients with clinical features and abnormal biochemical/histopathological results consistent with mitochondrial respiratory chain disorders without identified mtDNA mutations had either substantially depleted or significantly over-replicated mtDNA content, supporting the diagnosis of mitochondrial disease. Our results demonstrate that both qualitative and quantitative analyses are important in molecular diagnosis of mitochondrial diseases. The presence of deletion(s) and mtDNA depletion or compensatory over-replication can be determined simultaneously by real-time qPCR.

Hearing loss in mitochondrial disorders.

Hearing loss is a common clinical feature in mitochondria-syndrome disorders. The underlining molecular etiology of hearing loss has not been fully investigated. In this study, 83 patients with mitochondrial syndromic hearing loss were evaluated clinically and their blood and tissue samples were examined molecularly. Using modified Walker's criteria, 31, 31, 14, and 7 patients had been classified as having definite, probable, possible, and unlikely diagnosis of mitochondrial disease, respectively. Deleterious mtDNA point mutations and/or abnormal mtDNA content or multiple deletions were identified in 20 patients with definite diagnosis and 2 patients with probable diagnosis. In addition to known, undisputed pathogenic mutations, several novel mutations believed to be clinically significant were found. Furthermore, abnormal mtDNA content and mtDNA deletions were found in some of the cases. Evaluation of clinical and diagnostic features associated with hearing loss revealed that cardiomyopathy, lactic acidosis, deficient respiratory chain enzyme complex activities, histochemical and ultrastructural abnormalities in mitochondria, and abnormal brain imaging results occurred significantly more frequently in patients with mtDNA alterations than in those without. This study revealed that the majority of the mtDNA defects in patients with mitochondrial syndromic hearing loss affect the overall mitochondrial gene expression.

Extensive investigations of mitochondrial DNA genome in treated HIV-infected subjects: beyond mitochondrial DNA depletion.

BACKGROUND: Therapy with nucleoside reverse transcriptase inhibitor (NRTI) agents has been associated with lipoatrophy and lactic acidosis, presumably through inhibition of DNA polymerase-gamma and resultant mitochondrial DNA (mtDNA) depletion. In past investigations, studies have looked at mtDNA depletion and a few specific mutations but not at the entire mtDNA genome to correlate with clinical toxicity. METHODS: This is the largest prospective longitudinal study to date that has performed a complete analysis of the entire mtDNA genome in addition to mtDNA depletion. The study population included 54 HIV-infected NRTI-treated patients with or without clinical mitochondrial toxicities, 33 HIV-infected NRTI-naive patients, and 48 age-matched healthy volunteers. Data on demographics, treatment, and clinical characteristics were collected, and blood was drawn for mtDNA analysis, serum fasting lipids, and lactate. RESULTS: No depletion was found in blood mtDNA levels of subjects with clinical mitochondrial toxicities; duration of NRTI therapy was the only predictor of mtDNA levels. After complete analysis of the mtDNA genome, only 2 subjects showed development of mutations during the study period, after 14 and 52 months of antiretroviral therapy. CONCLUSION: Blood mtDNA content is not associated with the use of specific NRTIs, nor does it predict clinical symptoms such as lipoatrophy. The only factor associated with mtDNA depletion was duration of NRTI use. Complete mutational analysis of the mitochondrial genome revealed mtDNA mutations in 2 patients. More extensive studies of mtDNA mutation at the single molecule level are required to correlate mitochondrial dysfunction with NRTI-caused molecular defects in mtDNA.

D5 dopamine receptor regulation of phospholipase D.

D(1)-like receptors have been reported to decrease oxidative stress in vascular smooth muscle cells by decreasing phospholipase D (PLD) activity. However, the PLD isoform regulated by D(1)-like receptors (D(1) or D(5)) and whether abnormal regulation of PLD by D(1)-like receptors plays a role in the pathogenesis of hypertension are unknown. The hypothesis that the D(5) receptor is the D(1)-like receptor that inhibits PLD activity and serves to regulate blood pressure was tested using D(5) receptor mutant mice (D(5)(-/-)). We found that in the mouse kidney, PLD2, like the D(5) receptor, is mainly expressed in renal brush-border membranes, whereas PLD1 is mainly expressed in renal vessels with faint staining in brush-border membranes and collecting ducts. Total renal PLD activity is increased in D(5)(-/-) mice relative to congenic D(5) wild-type (D(5)(+/+)) mice. PLD2, but not PLD1, expression is greater in D(5)(-/-) than in D(5)(+/+) mice. The D(5) receptor agonist fenoldopam decreases PLD2, but not PLD1, expression and activity in human embryonic kidney-293 cells heterologously expressing the human D(5) receptor, effects that are blocked by the D(5) receptor antagonist SCH-23390. These studies show that the D(5) receptor regulates PLD2 activity and expression. The hypertension in the D(5)(-/-) mice is associated with increased PLD expression and activity. Impaired D(5) receptor regulation of PLD2 may play a role in the pathogenesis of hypertension.

Quantitative PCR analysis of mitochondrial DNA content in patients with mitochondrial disease.

Molecular diagnosis of mitochondrial DNA disorder is usually focused on point mutations and large deletions. In the absence of detectable mtDNA mutations, abnormal amounts of mtDNA, either depletion or elevation, can be indicative of mitochondrial dysfunction. The amount of mitochondrial DNA (mtDNA), however, varies among individuals of different ages and among different tissues within the same individual. To establish a range of mtDNA levels, we analyzed 300 muscle and 200 blood specimens from patients suspected of having a mitochondrial disorder by real-time quantitative polymerase chain reaction (PCR) method. Copy numbers were calculated from the standard curve and threshold cycle number using TaqMan probes; 6FAM 5'TTACCGGGCTCTGCCATCT3'-TAMRA and VIC-5'AGCAATAACAGGTCTGTGATG3'-TAMRA for mtDNA and 18S rRNA gene (nDNA), respectively. The copy number ratio of mtDNA to nDNA was used as a measure of mtDNA content in each specimen. The mtDNA content in muscle increases steadily from birth to about 5 years of age; thereafter, it stays about the same. On the contrary, the mtDNA content in blood decreases with age. The amount of mtDNA in skeletal muscle is about 5-20 times higher than that in blood. About 7% of patients had mtDNA levels in muscle below 20% of the mean of the age-matched group, and about 10% of patients had muscle mtDNA levels 2- to 16-fold higher than the mean of the age-matched group. Patients with abnormal levels of mtDNA, either depletion or proliferation, had significant clinical manifestations characteristic of mitochondrial disease in addition to abnormal respiratory enzymes and mitochondrial cytopathies. Cardiomyopathy, lactic acidosis, abnormal brain MRI findings, hypotonia, developmental delay, seizures, and failure to thrive are general clinical pictures of patients with mtDNA depletion. The average age of patients with mtDNA depletion is 4.1 years, compared to 23.6 years in patients with mtDNA proliferation. Mutations in nuclear genes involved in mtDNA synthesis and deoxynucleotide pools are probably the cause of mtDNA depletion. Our results demonstrate that real time quantitative PCR is a valuable tool for molecular screening of mitochondrial diseases.

Enhanced detection of deleterious mutations by TTGE analysis of mother and child's DNA side by side.

Mitochondrial DNA (mtDNA) disorders represent a group of heterogeneous diseases that are caused by mutations in mtDNA. We examined 45 pairs of mother and the affected child, by screening the entire mitochondrial genome with temporal temperature gradient gel electrophoresis (TTGE), using 32 pairs of overlapping primers. TTGE is an effective method of mutation detection. It detects and distinguishes heteroplasmic mutations from homoplasmic mutations. By running the mother and child's DNA samples side by side and sequencing only the DNA fragments showing different TTGE patterns, excessive sequencing can be avoided, particularly because most sequence variations represent benign polymorphisms. Mutations identified by sequencing were further confirmed by PCR/ASO (allele-specific oligonucleotide) dot blot analysis or PCR/RFLP (restriction fragment length polymorphism). A total of seven differences in sequence between mother and child pairs were identified: A189G, T5580C, G5821A, C5840T, A8326G, G12207A, and G15995A. All but two mutations were novel. The most significant are the A8326G, G12207A, and G15595A mutations. The A8326G is located at the anticodon region of tRNA(Lys), right next to the first nucleotide of the triplet codon, and it is highly conserved throughout evolution. The G12207A mutation is located at the first base of tRNA(ser) (AGY). The G15995A mutation occurs at a stem region that results in the disruption of the first base pair at the anticodon loop of tRNA(Pro) and is highly conserved throughout evolution from sea urchins to mammals. Running TTGE side by side with DNAs from mother and the affected child is a novel method to detect deleterious mutations.

Detection and quantification of heteroplasmic mutant mitochondrial DNA by real-time amplification refractory mutation system quantitative PCR analysis: a single-step approach.

BACKGROUND: The A3243G mitochondrial tRNA leu(UUR) point mutation causes mitochondrial myopathy, encephalopathy, lactic acidosis, and stroke-like episodes (MELAS) syndrome, the most common mitochondrial DNA (mtDNA) disorder, and is also found in patients with maternally inherited diabetes and deafness syndrome (MIDD). To correlate disease manifestation with mutation loads, it is necessary to measure the percentage of the A3243G mtDNA mutation. METHODS: To reliably quantify low proportions of the mutant mtDNA, we developed a real-time amplification refractory mutation system quantitative PCR (ARMS-qPCR) assay. We validated the method with experimental samples containing known proportions of mutant A3243G mtDNA generated by mixing known amounts of cloned plasmid DNA containing either the wild-type or the mutant sequences. RESULTS: A correlation coefficient of 0.9995 between the expected and observed values for the proportions of mutant A3243G in the experimental samples was found. Evaluation of a total of 36 patient DNA samples demonstrated consistent results between PCR-restriction fragment length polymorphism (RFLP) analysis and real-time ARMS-qPCR. However, the latter method was much more sensitive for detecting low percentages of mutant heteroplasmy. Three samples contained allele-specific oligonucleotide-detectable but RFLP-undetectable mutations. CONCLUSIONS: The real-time ARMS-qPCR method provides rapid, reliable, one-step quantitative detection of heteroplasmic mutant mtDNA.

[Restoring beta1 integrin activation function in K562 cells transfected with antisense VEGF121 cDNA].

To investigate the effect of vascular endothelial growth factor (VEGF) on beta1 integrin (VLA-4 and VLA-5) activation ability in K562 cells transfected with antisense VEGF121 cDNA, K562 cells were transfected with antisense (As), sense (S) and vector (V, pcDNA(3)). Flow cytometry was used to evaluate the expression rate of VLA-4 (CD49d/CD29) and VLA-5 (CD49e/CD29) and beta1 integrin activation ability in the transfected K562 cells. The results showed that the expression rates of VLA-4 and VLA-5 were more than 92% in the transfected K562 cells and there was no difference among the K562/V, K562/S and K562/As cells. However, beta1 integrin activated 9EG7 expression rate in K562/As cells was higher than that in K562/V cells [(75.6 +/- 10.5)% vs (41.2 +/- 2.1)%, P < 0.01)] after activation with beta1 integrin activator 8A2. It is concluded that function of beta1 integrin to be activated is restored in K562 cells transfected with antisense VEGF121 cDNA.