RESUMO
Fusarium wilt of banana (FWB), caused by Fusarium oxysporum f. sp. cubense (Foc), is the most important constraint of the banana industry globally. In Nepal, epidemics resembling FWB have been increasingly observed on the Malbhog cultivar in the past several years. However, the disease has not been officially reported yet, and consequently, little is known about the pathogen present across the country. In this study, we characterized 13 fungal strains isolated from banana plants of the Malbhog cultivar (Silk, AAB) showing symptoms similar to FWB in banana plantations in Nepal. All of the strains were typed as belonging to the F. oxysporum and caused FWB symptoms when inoculated in the Malbhog and Cachaco (Bluggoe, ABB) cultivars. No symptoms were observed in the Williams cultivar (Cavendish, AAA). Vegetative compatibility group (VCG) analysis classified the strains as VCG 0124 or VCG 0125. PCR analyses conducted with primers specific for Foc race 1 (Foc R1) or Foc tropical race 4 (TR4) revealed that all the strains reacted positively for Foc R1 and none for TR4. Altogether, our results demonstrated that the pathogen populations causing FWB of the Malbhog cultivar in Nepal were Foc R1. This work reported, for the first time, the occurrence of FWB in Nepal. Further studies with larger Foc populations are needed to better understand disease epidemiology to design sustainable disease management strategies.
RESUMO
Strawberry (Fragaria x ananassa Duch.) was introduced to Nepal from Japan in the 1990s, and thus, is a relatively new crop in the country. After the initial introduction of cultivar 'Nyoho' in Kakani, Nuwakot, different agencies and growers have introduced a number of cultivars in large numbers from Japan, Europe, America and India to expand the cultivation of strawberry in Nepal. Such practice has increased the risk of introducing new pathogens in the country. During a field visit at Kakani in October 2018, virus-like symptoms were observed in 5-10% of the plants in a polyhouse (~200 m2). Three strawberry leaf samples showing vein banding, vein clearing or tip necrosis with leaf puckering were collected. Total RNA was extracted from leaves using the RNeasy Plant Mini Kit (Qiagen, Germany) and subjected to high-throughput sequencing (HTS). After ribosomal RNA depletion using the Ribo-Zero rRNA kit, a cDNA library was prepared using an Illumina TruSeq Stranded Total RNA Kit and sequenced on an Illumina NovaSeq 6000 system (Macrogen Inc. Korea). De novo transcriptome assembly of the 67,748,658 reads with Trinity software (r20140717) yielded 116,854 contigs of 201-17,773 nucleotides (nt). BLASTn and BLASTx analysis of the contigs against the NCBI viral reference database showed that one contig with the nearly full genome sequence (5,968 nt, deposited under GenBank accssion number MZ355624) was identified as strawberry polerovirus 1 (SPV-1). A total of 10,401 reads was mapped to the reference SPV-1 nucleotide genome (GenBank accession number NC_025435) with a 263.2 sequence depth. The contig shared 99% nt sequence identity with SPV-1 isolate AB5301 (GenBank accession number KM233705) from Canada and 97% identity with the Argentine SPV-1 isolate 15CA (GenBank accession number MK142237). To confirm the presence of SPV-1, reverse transcription-PCR (RT-PCR) was performed using previously reported specific primers, SPV-1F (AGAGATCGCCGGATTCCGCAA) and SPV-1R (TGACACGCTCGGTATTCACAAACAG), amplifying 281 nt of the P1-P2 fusion protein gene (Thekke-Veetil and Tzanetakis 2016). Of the three samples, only one showing vein banding symptoms (Figure S1) was positive for SPV-1. Sanger sequencing of the RT-PCR products showed 100% nt identity with the HTS-derived sequence. SPV-1, a member of the genus Polerovirus in the family Solemoviridae, was first reported in strawberry showing decline symptom in Canada (Xiang et al. 2015), and was subsequently detected in the USA (Thekke-Veetil and Tzanetakis 2016) and in Argentina (Luciani et al. 2016; 2018). To our knowledge, this is the first report of SPV-1 infection in strawberry in Nepal and Asia.
RESUMO
The western Himalayan region in Pakistan has been shown to be the center of diversity of Puccinia striiformis; however, little is known about its genetic relations with the eastern part of the Himalayas. We studied the genetic structure of P. striiformis from Nepal (35 isolates) and Bhutan (31 isolates) in comparison with 81 Pakistani samples collected during 2015 and 2016, through microsatellite genotyping. Genetic analyses revealed a recombinant and highly diverse population structure in Pakistan, Bhutan, and Nepal. A high level of genotypic diversity (>0.90) was observed for the three countries of Pakistan (0.96), Bhutan (0.96), and Nepal (0.91) with the detection of 108 distinct multilocus genotypes (MLGs) in the overall population; 59 for Pakistan, 27 for Bhutan, and 26 for Nepal. Mean number of alleles per locus and gene diversity were higher in Nepal (3.19 and 0.458, respectively) than Bhutan (3.12 and 0.458, respectively). A nonsignificant difference between the observed and the expected heterozygosity in all populations further confirmed the recombinant structure. A clear population subdivision between the Himalayan region of Nepal, Bhutan, and Pakistan was evident, as revealed by FST values (ranging between 0.111 to 0.198), discriminant analysis of principal components, and resampling of MLGs. Limited gene flow could be present between Nepal and Bhutan, while the population from Pakistan was clearly distinct, and no divergence was present between two populations from Pakistan (Bajaur and Malakand). The overall high diversity and recombination signature suggested the potential role of recombination in the eastern Himalayan region (Nepal and Bhutan), which needs to be considered during host resistance deployment and in the context of aerial dispersal of the pathogen. Further surveillance should be made in the Himalayan region for disease management in the region and in the context of worldwide invasions.
