Active bone marrow segmentation based on computed tomography imaging in anal cancer patients: A machine-learning-based proof of concept.

PURPOSE: Different methods are available to identify haematopoietically active bone marrow (ActBM). However, their use can be challenging for radiotherapy routine treatments, since they require specific equipment and dedicated time. A machine learning (ML) approach, based on radiomic features as inputs to three different classifiers, was applied to computed tomography (CT) images to identify haematopoietically active bone marrow in anal cancer patients. METHODS: A total of 40 patients was assigned to the construction set (training set + test set). Fluorine-18-Fluorodeoxyglucose Positron Emission Tomography (18FDG-PET) images were used to detect the active part of the pelvic bone marrow (ActPBM) and stored as ground-truth for three subregions: iliac, lower pelvis and lumbosacral bone marrow (ActIBM, ActLPBM, ActLSBM). Three parameters were used for the correspondence analyses between 18FDG-PET and ML classifiers: DICE index, Precision and Recall. RESULTS: For the 40-patient cohort, median values [min; max] of the Dice index were 0.69 [0.20; 0.84], 0.76 [0.25; 0.89], and 0.36 [0.15; 0.67] for ActIBM, ActLSBM, and ActLPBM, respectively. The Precision/Recall (P/R) ratio median value for the ActLPBM structure was 0.59 [0.20; 1.84] (over segmentation), while for the other two subregions the P/R ratio median has values of 1.249 [0.43; 4.15] for ActIBM and 1.093 [0.24; 1.91] for ActLSBM (under segmentation). CONCLUSION: A satisfactory degree of overlap compared to 18FDG-PET was found for 2 out of the 3 subregions within pelvic bones. Further optimization and generalization of the process is required before clinical implementation.

The Effect of Number of Gait Cycles on Principal Activation Extraction.

To cope with the high intra-subject variability of muscle activation intervals, a large amount of gait cycles is necessary to clearly document physiological or pathological muscle activity patterns during human locomotion. The Clustering for Identification of Muscle Activation Pattern (CIMAP) algorithm has been proposed to help clinicians obtaining a synthetic and clear description of normal and pathological muscle functions in human walking. Moreover, this algorithm allows the extraction of Principal Activations (PAs), defined as those muscle activations that are strictly necessary to perform a specific task and occur in every gait cycle. This contribution aims at assessing the impact of the number of gait cycles on the extraction of the PAs. Results demonstrated no statistically significant differences between PAs extracted considering different numbers of gait cycles, revealing, on average, similarity values higher than 0.88.Clinical Relevance-This contribution demonstrates the potential applicability of the CIMAP algorithm to the analysis of subjects affected by neurological disorders, for whom the assessment of motor functions may be of the uttermost importance and only a reduced number of gait cycles can be acquired.

Role of methyl jasmonate and salicylic acid in kiwifruit plants further subjected to Psa infection: biochemical and genetic responses.

The use of plant elicitors for controlling Pseudomonas syringae pv. actinidiae (Psa), the etiological agent of the kiwifruit bacterial canker (KBC), has been analysed in the past and, while salicylic acid (SA) seems to decrease disease susceptibility, methyl jasmonate (MJ) shows an opposite effect. However, the metabolic and genomic responses of Psa-infected plants following elicitation with these two compounds, as compared with non-elicited Psa-inoculated plants, are poorly understood, being the focus of this study. Micropropagated A. chinensis 'Hayward' plants were elicited with MJ or SA, and further inoculated with Psa. Fifteen days post-inoculation, Psa population in MJ-treated plants was increased by 7.4-fold, whereas SA elicitation led to decreased Psa colonization (0.5-fold), as compared with non-elicited inoculated plants. Additionally, elicitation with MJ or SA generally decreased polyphenols and lignin concentrations (by at least 20%) and increased total proteins (by at least 50%). MJ led to the upregulation of SOD, involved in plant antioxidant system, and reporter genes for the jasmonic acid (JA) (JIH and LOX1), abscisic acid (SnRK), SA (ICS1), and ethylene (ACAS1, ETR1 and SAM) pathways. Moreover, it increased ABA (40%) and decreased carotenoids (30%) concentrations. Contrastingly, comparing with non-elicited Psa-inoculated plants, SA application resulted in the downregulation of antioxidant system-related genes (SOD and APX) and of reporter genes for ethylene (ETR1) and JA (JIH and ETR1). This study contributes to the understanding of potential mechanisms involved in kiwifruit plant defences against Psa, highlighting the role of the JA, ABA and ethylene in plant susceptibility to the pathogen.

Early Pathogen Recognition and Antioxidant System Activation Contributes to Actinidia arguta Tolerance Against Pseudomonas syringae Pathovars actinidiae and actinidifoliorum.

Actinidia chinensis and A. arguta have distinct tolerances to Pseudomonas syringae pv. actinidiae (Psa), but the reasons underlying the inter-specific variation remain unclear. This study aimed to integrate the metabolic and molecular responses of these two kiwifruit species against the highly pathogenic Psa and the less pathogenic P. syringae pv. actinidifoliorum (Pfm) bacterial strains. Disease development was monitored weekly till 21 days post inoculation (dpi), analysing a broad number and variety of parameters including: colony forming units (CFU), foliar symptoms, total chlorophylls, lipid peroxidation, soluble polyphenols, lignin and defense-related gene expression. At the end of the experimental period A. chinensis inoculated with Psa presented the highest endophytic bacterial population, whereas A. arguta inoculated with Pfm showed the lowest values, also resulting in a lower extent of leaf symptoms. Metabolic responses to infection were also more pronounced in A. chinensis with decreased total chlorophylls (up to 55%) and increased lipid peroxidation (up to 53%), compared with non-inoculated plants. Moreover, at 14 dpi soluble polyphenols and lignin concentrations were significantly higher (112 and 26%, respectively) in Psa-inoculated plants than in controls, while in A. arguta no significant changes were observed in those metabolic responses, except for lignin concentration which was, in general, significantly higher in Psa-inoculated plants (by at least 22%), comparing with control and Pfm-inoculated plants. Genes encoding antioxidant enzymes (SOD, APX and CAT) were upregulated at an earlier stage in Psa-inoculated A. arguta than in A. chinensis. In contrast, genes related with phenylpropanoids (LOX1) and ethylene (SAM) pathways were downregulated in A. arguta, but upregulated in A. chinensis in the later phases of infection. Expression of Pto3, responsible for pathogen recognition, occurred 2 dpi in A. arguta, but only 14 dpi in A. chinensis. In conclusion, we found that A. arguta is more tolerant to Psa and Pfm infection than A. chinensis and its primary and secondary metabolism is less impacted. A. arguta higher tolerance seems to be related with early pathogen recognition, the activation of plant antioxidant system, and to the suppression of ET and JA pathways from an earlier moment after infection.

Asymmetry Index in Muscle Activations.

Gait asymmetry is typically evaluated using spatio-temporal or joint kinematics parameters. Only a few studies addressed the problem of defining an asymmetry index directly based on muscle activity, extracting parameters from surface electromyography (sEMG) signals. Moreover, no studies used the extraction of the muscle principal activations (activations that are necessary for accomplishing a specific motor task) as the base to construct an asymmetry index, less affected by the variability of sEMG patterns. The aim of this paper is to define a robust index to quantitatively assess the asymmetry of muscle activations during locomotion, based on the extraction of the principal activations. SEMG signals were analyzed combining statistical gait analysis (SGA) and a clustering algorithm that allows for obtaining the muscle principal activations. We evaluated the asymmetry levels of four lower limb muscles in: (1) healthy subjects of different ages (children, adults, and elderly); (2) different populations of orthopedic patients (adults with megaprosthesis of the knee after bone tumor resection, elderly subjects after total knee arthroplasty, and elderly subjects after total hip arthroplasty); and (3) neurological patients (children with hemiplegic cerebral palsy and elderly subjects affected by idiopathic normal pressure hydrocephalus). The asymmetry index obtained for each pathological population was then compared to that of age-matched controls. We found asymmetry levels consistent with the expected impact of the different pathologies on muscle activation during gait. This suggests that the proposed index can be successfully used in clinics for an objective assessment of the muscle activation asymmetry during locomotion.

Characterization of Physicians Workload in a Reference Center for the Treatment of Thrombotic and Bleeding Disorders.

Heavy workloads in healthcare have been often associated to adverse clinical outcomes. To reduce workloads, an optimal scheduling of clinical staff resources is not enough, but particular attention must be payed to work organization and task characteristics. Moreover, interruptions during the clinical practice contribute to increase perceived workloads. In this study we analyzed and characterized the physicians' workload in an Italian center for the treatment of thrombotic and bleeding disorders. First, all clinical and administrative processes performed in the center were analyzed by means of two process modelling tools. Then, the quantification of the physicians' workload and the characterization of interruptions during practice were conducted. From our results it emerged that the task that mainly impacts on the workload is ambulatory care (42% of total workload) while interruptions produce a delay of almost 15 minutes per day and mainly occur during visits. Including all activities, the total daily workload per physician was 8 hours on average. In this time breaks were not taken into account. Concluding, from our analysis it is evident that the physicians' workload in the analyzed center is heavy and interruptions represent a source of delay in the workflow, that impact the physicians' workload.

Pediatric Brain Tissue Segmentation from MRI using Clustering: a Preliminary Study.

Brain Tissue Segmentation (BTS) in young children and neonates is not a trivial task due to peculiar characteristics of the developing brain. The aim of this study is to present the preliminary results of new atlas-free BTS (afBTS) algorithm of MR images for pediatric applications, based on clustering. The algorithm works on axial T1, T2 and FLAIR sequences. First, the Cerebrospinal Fluid (CSF) is identified using the Region Growing algorithm. The remaining voxels are processed with the k-means algorithm in order to separate White Matter (WM) and Grey Matter (GM). The afBTS algorithm was applied to a population of 13 neonates; the segmentations were evaluated by two expert pediatric neuroradiologists and compared with an atlas-based algorithm. The results were promising: afBTS allowed reconstruction of WM and CSF with an image quality comparable to the reference of standard while lower segmentation quality was obtained for the GM segmentation.

Influence of pre-processing in the extraction of muscle synergies during human locomotion.

The extraction of muscle synergies in human locomotion may be biased by the kind of pre-processing applied to electromyographic (EMG) data. The aim of this contribution is to analyze the differences in the muscle synergies extracted using a standard pre-processing procedure and a new procedure. The new procedure is based on the selection of the muscle's principal activations (necessary actuations of the muscle to accomplish its specific biomechanical task during gait), discarding secondary activations (with an auxiliary function in motor control). EMG signals were recorded from 12 muscles of a healthy volunteer who was asked to walk, at self-selected pace, for 5 minutes. A dataset of 193 gait cycles was collected and divided into 19 epochs of 10 concatenated gait cycles. The application of the new pre-processing procedure provided 5 instead of 6 muscle synergies accurately reconstructing the original EMG data matrix, and clearer and more stable neural activation commands. The new preprocessing procedure may be easily extended to the extraction of muscle synergies in other cyclic movements, such as running, stair climbing, cyclo-ergometer exercising, and swimming.

Impact of MALDI-TOF-MS-based identification directly from positive blood cultures on patient management: a controlled clinical trial.

OBJECTIVES: Rapid identification of pathogens directly from positive blood cultures (BC) in combination with an antimicrobial stewardship programme (ASP) is associated with improved antibiotic treatment and outcomes, but the effect of each individual intervention is less clear. The current study investigated the impact of matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF) versus conventional identification on antibiotic management in a setting with a well-established ASP and low resistance rates. METHODS: In this single-centre open label, controlled clinical trial 425 patients with positive BCs were allocated by weekday during a 1-year period to either MALDI-TOF directly from positive BCs or conventional processing. ASP was identical throughout the study period. The primary outcome was duration of intravenous antimicrobial therapy and was analysed in an intention-to-treat approach. RESULTS: In all, 368 patients were analysed (MALDI-TOF n = 168; conventional n = 200) with similar baseline characteristics. Mean duration of intravenous antimicrobial therapy (12.9 versus 13.2 days, p 0.9) and length of stay (16.1 versus 17.9 days, p 0.3) were comparable. In the clinically significant bloodstream infection subgroup (n = 242) mean time from Gram-stain to active treatment was significantly shorter (3.7 versus 6.7 h, p 0.003). Admission to the intensive care unit after bloodstream infection onset was less frequent in the MALDI-TOF group (23.1 versus 37.2%, p 0.02). CONCLUSIONS: Rapid identification of contaminated BCs (n = 126) resulted in a shorter duration of intravenous antimicrobial therapy (mean 4.8 versus 7.5 days, p 0.04). Rapid identification using MALDI-TOF directly from positive BCs did not impact on duration of intravenous antimicrobial therapy, but provided fast and reliable microbiological results and may improve treatment quality in the setting of an established ASP.

Effect of cellulose and lignin on disintegration, antimicrobial and antioxidant properties of PLA active films.

This study reports the effects on antimicrobial, antioxidant, migration and disintegrability activities of ternary nanocomposite films based on poly(lactic acid) incorporating two biobased nanofillers, (cellulose nanocrystals (CNC) and lignin nanoparticles (LNP)), in two different amounts (1 and 3% wt.). Results from antimicrobial tests revealed a capacity to inhibit the Gram negative bacterial growth of Xanthomonas axonopodis pv. vesicatoria and Xanthomonas arboricola pv. pruni along the time, offering innovative opportunities against dangerous bacterial plant pathogens. LNP proved to be highly efficient in antioxidation activity, based on the disappearance of the absorption band at 517nm of the free radical, 2,2-diphenyl-1-picrylhydrazyl (DPPH) upon reduction by an antiradical compound; moreover the combination of LNP and CNC generates a synergistic positive effect in the antioxidation response of PLA ternary films. Furthermore, all the studied formulations showed a disintegrability value up to 90% after 15days of incubation in composting conditions. Migration results showed that the films can be considered suitable for application in food packaging field.

Fabrication of slender elastic shells by the coating of curved surfaces.

Various manufacturing techniques exist to produce double-curvature shells, including injection, rotational and blow molding, as well as dip coating. However, these industrial processes are typically geared for mass production and are not directly applicable to laboratory research settings, where adaptable, inexpensive and predictable prototyping tools are desirable. Here, we study the rapid fabrication of hemispherical elastic shells by coating a curved surface with a polymer solution that yields a nearly uniform shell, upon polymerization of the resulting thin film. We experimentally characterize how the curing of the polymer affects its drainage dynamics and eventually selects the shell thickness. The coating process is then rationalized through a theoretical analysis that predicts the final thickness, in quantitative agreement with experiments and numerical simulations of the lubrication flow field. This robust fabrication framework should be invaluable for future studies on the mechanics of thin elastic shells and their intrinsic geometric nonlinearities.

An open-label phase 1 dose-escalation clinical trial of a single intravenous administration of gemcitabine in dogs with advanced solid tumors.

BACKGROUND: A broad range of gemcitabine dosages have been used in dogs. HYPOTHESIS/OBJECTIVES: To determine maximally tolerated dose (MTD), dose-limiting toxicity (DLT), and preliminary antitumor activity of intravenous administration of gemcitabine in dogs with advanced solid tumors. ANIMALS: Twenty-two client-owned dogs. METHODS: Dogs with advanced cancer were prospectively enrolled in an open-label Phase 1 study of gemcitabine. Gemcitabine was administered as a 30-minute intravenous bolus starting at 800 mg/m(2), using escalation of 50 mg/m(2) increments with 3 dogs per dose level. MTD was established based on the number of dogs experiencing DLT assessed after 1 cycle. Treatment continued until disease progression or unacceptable toxicosis. Additional dogs were enrolled at MTD to better characterize tolerability, and to assess the extent and duration of gemcitabine excretion. RESULTS: Twenty-two dogs were treated at 4 dose levels, ranging from 800 to 950 mg/m(2). Neutropenia was identified as DLT. MTD was 900 mg/m(2). DLT consisting of grade 4 febrile neutropenia was observed at 950 mg/m(2) in 2 dogs. There were no nonhematologic DLTs. Twenty dogs received multiple doses, and none had evidence of severe toxicosis from any of their subsequent treatments. At 900 mg/m(2), 2 complete and 5 partial responses were observed in dogs with measurable tumors. The amount of gemcitabine excreted in urine decreased over time, and was undetectable after the first 24 hours. CONCLUSIONS AND CLINICAL IMPORTANCE: The recommended dose of gemcitabine for future Phase 2 studies is weekly 900 mg/m(2). In chemotherapy-naïve dogs with advanced solid tumor this dose level merits further evaluation.

Developing medical device software in compliance with regulations.

In the last decade, the use of information technology (IT) in healthcare has taken a growing role. In fact, the adoption of an increasing number of computer tools has led to several benefits related to the process of patient care and allowed easier access to social and health care resources. At the same time this trend gave rise to new challenges related to the implementation of these new technologies. Software used in healthcare can be classified as medical devices depending on the way they are used and on their functional characteristics. If they are classified as medical devices they must satisfy specific regulations. The aim of this work is to present a software development framework that can allow the production of safe and high quality medical device software and to highlight the correspondence between each software development phase and the appropriate standard and/or regulation.

CPDI: An Index for measuring deviations in Clinical Pathways.

Clinical Pathways (CPs) are evidence-based recommendation for treating a diagnosis and an effective instrument to decrease undesired practice variability and improve clinician performance. Deviations from CPs might just as well reduce quality of care. Moreover they can be associated to possible adverse events. In this perspective, we developed and tested a system for comparing a patient trajectory (PT) with the corresponding CP in order to recognize significant variations. To measure adherence, a Clinical Pathway Deviation Index (CPDI) was constructed as the weighted-sum of five indicators. To build the indicators three different tools for CPs modeling have been tested. Only two of them proved suitable for our system. A preliminary analysis has been carried out using data of 24 real PTs. The aim of this paper is to present the system and to characterize CPDI performances.

Automatic classification of time-frequency plots applied to the center-of-pressure rotational components.

Time-frequency plots are widely applied to the non-stationary analysis of signals. These plots may be difficult to interpret, particularly when large data sets have to be considered. The aim of this work is to propose an automatic procedure of feature selection and clustering to be applied to time-frequency plots. We focus on the application of this procedure to plots obtained from a non-stationary analysis of the center-of-pressure signals acquired in upright bipedal stance. From a data set of 168 time-frequency plots we obtained 5 different clusters, each characterized by a few distinctive features. We were able to interpret the results of the clustering relating them to the physiological mechanisms underlying postural sway.

A Multiplex PCR Assay for Detection of Pseudomonas syringae pv. actinidiae and Differentiation of Populations with Different Geographic Origin.

Pseudomonas syringae pv. actinidiae is responsible for severe outbreaks of bacterial canker of kiwifruit currently occurring around the world. Although molecular detection methods have been reported, none provide complete selectivity for this pathovar or discriminate among pathogen haplotypes. Therefore, a new multiplex polymerase chain reaction (PCR) assay was developed and validated. The assay was tested on 32 P. syringae pv. actinidiae isolates and 15 non-P. syringae pv. actinidiae strains and correctly assigned P. syringae pv. actinidiae strains to three different haplotypes: a Japanese/Korean group, a European group, and a Chinese group. Two P. syringae pv. actinidiae isolates from New Zealand were found to belong to the Chinese group whereas two other isolates from New Zealand, which were isolated from kiwifruit plants but which do not cause bacterial canker, tested negative. The described PCR assays has a limit of detection of approximately 5 to 50 pg of purified DNA or of 5 × 102 bacteria/PCR and were shown to work with both artificially and naturally infected plant tissues. Thus, the described method represents a suitable tool for detection of P. syringae pv. actinidiae and haplotype attribution, in particular, when testing a high number of samples during surveillance and prevention activities.

Severe Outbreak of Bacterial Canker Caused by Clavibacter michiganensis subsp. michiganensis on Tomato in Central Italy.

From May to July 2010, severe outbreaks of bacterial canker of tomato (Solanum lycopersicum L.) were observed in 16 fields in the Province of Viterbo, central Italy. Cultivars affected were Uno Rosso, Peto 1296, UG 812, UG 822, and Podium. Disease incidence ranged from 70 to 100% and was highest for Uno Rosso followed by UG 812, UG 822, Peto 1296, and Podium. Leaf symptoms initially appeared as interveinal, pale green, water-soaked areas that quickly turned yellow-brown to necrotic, resembling sunburn. Infected parts of the plants began to wilt and then die. Light yellow-to-brown streaks or cankers appeared on stems and the cankers darkened. As the disease progressed, affected stems split lengthwise and a pale yellow-to-reddish brown discoloration of the vascular tissue was observed. The pith of infected stems turned brown, granular to mealy, and filled with cavities. Dividing the stem into two pieces lengthwise revealed yellowing of vascular tissues in the fruits that otherwise was asymptomatic. Eventually, vascular wilting and premature death of entire plants were observed. Once a month, infected samples were randomly collected three times from each field from five plants. A gram-positive, nonmotile, nonspore forming, aerobic, curved, rod-shaped bacterium was consistently isolated onto nutrient broth yeast extract agar medium from symptomatic plant tissues. Strains tested positive for gelatin liquefaction, H2S production from peptone, utilization of citrate and negative for starch hydrolysis. Forty-five isolates were used to inoculate four-o'clock (Mirabilis jalapa L.) plants by injecting a bacterial suspension of the appropriate isolate in sterilized distilled water (108 CFU/ml) into leaves (1). Known strains of Clavibacter michiganensis subsp. michiganensis (DPP22) and Pseudomonas fluorescens (DPP09N) were used as positive and negative control treatments, respectively. Four leaves per plant and three plants were inoculated for each bacterial strain and control treatment. All 45 tomato field isolates and the known strain of C. michiganensis subsp. michiganensis produced a hypersensitive reaction within 48 h. Pathogenicity tests were performed on 3-week-old, potted tomato seedlings (cv. Ciliegino) by placing a drop of the appropriate bacterial suspension (108 CFU/ml) on wounds created by excising the leaf petiole. The inoculated plants were maintained at 26 ± 1°C in a greenhouse. The two control isolates were similarly inoculated onto tomato seedlings. After 15 days, all inoculated plants developed symptoms, whereas negative control plants remained asymptomatic. Bacteria reisolated from inoculated leaf lesions had the same characteristics as the original bacteria. A 1,400-bp region of the 16S rDNA was amplified from 15 of the 45 strains with primers NOC 1F (AGAGTTTGATCATGGCTCAG) and NOC 3R (ACGGTTACCTTGTTACGACTT) and sequenced (GenBank Accession Nos. HQ144228 to HQ144242; strains CmmVT1 to CmmVT15). A BlastN search of the sequences in GenBank revealed the tomato strains had 99 to 100% identity with the 16S rDNA sequences of C. michiganensis subsp. michiganensis strains (GenBank Accession Nos. EU 685335, AM711867, and AM410696). In Italy, this pathogen was first reported in 1914 in Vasto and later in a few other regions. However, to our knowledge, this is the first observation of widespread outbreaks in >300 ha of tomato fields with severe economic losses. Reference: (1) R. D. Gitaitis. Plant Dis. 74:58, 1990.

Occurrence of Potato Soft Rot Caused by Erwinia carotovora (synonym Pectobacterium carotovorum) in Nepal: A First Report.

Potato (Solanum tuberosum L.) is the fourth most important major crop of Nepal after rice, corn, and wheat, with an annual production of 1.94 million t and 153,000 ha of harvested area. It is a staple food crop in the remote hilly areas and the main vegetable in other parts of the country. Potato is grown in all three major agricultural zones (high hills, mid hills, and plain land) of Nepal, at an altitude ranging from 60 m to more than 4,000 m. Erwinia carotovora causes soft rot worldwide on a wide range of hosts including potato, carrot, and cabbage. During the spring of 2009, a soft rot with a foul smell was noted in stored potato tubers of different local cultivars, especially Rato Alu and Seto Alu, in the Kathmandu District, central region of Nepal. Symptoms on tubers appeared as tan, water-soaked areas with watery ooze. The rotted tissues were white-to-cream colored. Seven different potato fields, where the stored tubers originated, were surveyed and 23 samples consisting of approximately three symptomatic tubers were collected. Bacteria were successfully isolated from all diseased tissues on nutrient agar supplemented with 5% sucrose and incubated at 26 ± 1°C. After purification on tripticase soy agar medium, 17 isolates were identified as E. carotovora by the following deterministic tests: all strains were gram-negative rods; oxidase negative; facultatively anaerobic; able to degrade pectate; sensitive to erythromycin; negative for phosphatase; unable to produce acid from α-methyl-glucoside; and produced acid from trehalose. Pathogenicity of the strains was evaluated by depositing a bacterial suspension (106 CFU/ml) on potato slices (cv. Monalisa) and incubating at 30 ± 1°C. A reference strain of E. carotovora subsp. carotovora (NCPPB 2577) and sterile distilled water were used, respectively, as positive and negative controls. All strains caused soft rot within a week. Bacteria were reisolated from the slices and were shown to be identical to the original strains according to the above morphological, cultural, and biochemical tests. A 1,430-bp region of the 16S rDNA from all strains was amplified with primers NOC 1F (AGAGTTTGATCATGGCTCAG) and NOC 3R (ACGGTTACCTTGTTACGACTT) and sequenced (GenBank Accession No. GU075708; strain NEP ECC09). A BlastN search of GenBank revealed that the strains had 100% nt identity with the 16S rDNA sequence of E. carotovora subsp. carotovora type strain ATCC 15713 (GenBank Accession No. U80197). The finding of this pathogen is of fundamental value since this crop represents one of the economically important crops of Nepal. This pathogen has already been reported in the countries of China and India (1) with whom Nepal shares its boundaries. The pathogen may have been introduced to this region of Nepal via seed potato tubers from other countries. Reference: (1) G. S. Shekhawat et al. Potato Res. 19:241, 1976.

[Chagas disease in a non endemic country: a study in the district of Bologna (Italy). Multidisciplinary analysis of the disease in the Latin American migrant population]. / La malattia di Chagas in un paese non endemico: il conte- sto bolognese. Analisi multidisciplinare della malattia e del fenomeno migratorio.

Chagas disease is a parasitic illness endemic in 21 countries of Central and South America, affecting over 10 million people. Due to the increase of migration flows to Europe, Chagas disease is an emerging public health issue in non endemic countries. In Italy, where no specific policy has yet been developed, the Centre for International Health of the University of Bologna is carrying out the project "Chagas disease in a non endemic country: a study in the district of Bologna". A multidisciplinary and multi-method approach was adopted to estimate the problem and its impact in our territory. A retrospective analysis was performed searching several databases in order to collect information concerning the demographic and epidemiological profile of Latin American migrants coming from endemic countries. At the same time, a preliminary ethnographic research was conducted to start unveiling the main socio-anthropological characteristics of this population, thanks to the involvement of key informants and community associations. According to preliminary findings, Chagas disease is a present and possibly increasing reality in our territory. Due to the particular features of the affected population, socio-cultural variables have to be considered for their impact on the visibility of the condition and on health seeking behaviors.