RESUMO
The aim of this study was to evaluate swine females of different genetic lines submitted to different reproductive management and housing systems during pregnancy on reproductive performance and animal welfare parameters. After artificial insemination protocol, 524 females were divided into two gestation housing systems: PEN1=animals housed in individual stalls during the breeding and after group-housed; PEN32=animals housed in individual stalls from breeding until 32 days of pregnancy and after group-housed. The number of piglets born, and the pregnancy and farrowing rates were evaluated. Welfare parameters related to the pregnancy phase were used. Females who weaned more piglets in the previous farrowing had a higher number of piglets born at the next farrowing. The pregnancy rate was affected by the number of semen doses. The farrowing rate was not influenced by the evaluated parameters, with average value of 91.36%. There was no effect of the gestation housing system and the genetic lines on pregnancy and farrowing rates, with values above 90.0%. The animal welfare indicators showed more compromised parameters in PEN1 system. PEN1 system did not impair the reproductive performance although it presented more compromised animal welfare parameters.(AU)
O objetivo deste estudo foi avaliar fêmeas suínas de diferentes linhagens genéticas submetidas a diferentes sistemas reprodutivos de manejo e alojamento durante a prenhez sobre parâmetros de desempenho reprodutivo e bem-estar animal. Após o protocolo de inseminação artificial, 524 fêmeas foram divididas em dois sistemas de alojamento de gestação: PEN1=animais alojados em baias individuais durante o protocolo de inseminação artificial e, depois, alojados em grupo; PEN32=animais alojados em baias individuais desde o protocolo de inseminação artificial até 32 dias de prenhez e, depois, alojados em grupo. O número de leitões nascidos e as taxas de prenhez e parto foram avaliados. Parâmetros de bem-estar relacionados à fase gestacional foram utilizados. As fêmeas que desmamaram mais leitões no parto anterior tiveram um maior número de leitões nascidos no próximo parto. A taxa de prenhez foi afetada pelo número de doses de sêmen. A taxa de parto não foi influenciada pelos fatores avaliados, com valor médio de 91,36%. Não houve efeito do sistema de alojamento gestacional e das linhas genéticas sobre as taxas de prenhez e parto, com valores acima de 90,0%. Os indicadores de bem-estar animal mostraram parâmetros mais comprometidos no sistema PEN1. O sistema PEN1 não prejudicou o desempenho reprodutivo, embora tenha apresentado parâmetros de bem-estar animal mais comprometidos.(AU)
Assuntos
Animais , Feminino , Gravidez , Suínos/genética , Bem-Estar do Animal , Abrigo para Animais , Linhagem , Taxa de GravidezRESUMO
Asiatic and Oriental hybrid lilies (Lilium sp., Liliaceae) are bulbous ornamentals valued for their flowers. Bulbs of several varieties of each lily type, imported from the Netherlands, were purchased in spring 2013 from retail nurseries and grown in a cool greenhouse; additional bulbs were obtained in 2014. After flowering in 2013, but prior to leaf senescence, necrotic streaking was observed in midstem leaves of several plants. RNA extracted from leaves of several individual plants was subjected to reverse-transcription-polymerase chain reaction (RT-PCR) assay using NSNC-odT primed cDNA and PCR with primers PxDeg/BNSNC or potyS/BNSNC to amplify potexvirus/carlavirus and potyvirus products respectively (2,3,4). Sequencing of a c. 1.7-kb PCR product from one lily identified Lily symptomless virus (LSV). Mechanical inoculation of pooled lily leaf samples to Nicotiana benthamiana, N. glutinosa, and Chenopodium quinoa (not hosts of LSV) yielded chlorotic or necrotic local lesions on C. quinoa and systemic mosaic with necrotic spotting, streaking, or apical necrosis on N. benthamiana; electron microscopy revealed potexvirus-like flexuous particles. RT-PCR from C. quinoa and N. benthamiana with PxDeg/BNSNC yielded a c. 1.3-kb product, which was cloned and sequenced; the consensus sequence (KM205357) had 98.7% nucleotide identity to a Dutch isolate of Plantago asiatica mosaic virus (PlAMV, KF471012; 78.5 to 87.8% to other isolates), and 99.0% coat protein amino acid identity to KF471012 (88.9 to 93.2% to other isolates). The 2013 lilies were stored overwinter at 4°C, and RNA was extracted from roots of individual bulbs. Primers PlAMV CP-F2 (TTCGTCACCCTCAGCGG) and PlAMV CP-R3 (AAACGGTAAAATACACACCGGG) were designed based on alignment of KM205357 with all PlAMV sequences available in GenBank. RT-PCR using PlAMV CP-F2/CP-R3 yielded products of the expected 511 bp from 20 bulbs and no product from a no-template control. ELISA of root and bulbscale samples using PlAMV-lily specific antibody and conjugate (a gift of R. Miglino, BKD, The Netherlands) confirmed PlAMV in seven of 20 bulbs positive by RT-PCR. Bioassay of PCR-positive lilies on N. benthamiana, C. quinoa, and Tetragonia expansa confirmed infection in three out of eight by both symptoms and ELISA. Altogether nine out of 13 Asiatic lilies (four of four cultivars: America, Connecticut King, Grand Cru, and Pink Pixie) and 11 Oriental lilies (cvs. Stargazer and Starfighter) were found to be infected with PlAMV by RT-PCR, of which seven were confirmed by bioassay and/or ELISA. Bulbs obtained in 2014 were tested only by ELISA; five of 18 Asiatic lilies (three of six cultivars: Connecticut King, Crimson Pixie, and Yellow Electric) and three of 13 Oriental lilies (three of six cultivars: Anastasia, Casa Blanca, and Garden Party) were found to be infected. PlAMV was reported in lilies in the Netherlands in 2010, with losses of up to 80% in greenhouse cut-flower production (1). The Nandina mosaic isolate (PlAMV-NMV) has been known in the United States since 1976 (5), but PlAMV infection of lily has not previously been documented in the United States. Both RT-PCR and ELISA tests also detected PlAMV-NMV. The degree of damage observed in the Netherlands suggests that growers should seek bulb stocks free of PlAMV. References: (1) Anonymous. https://www.vwa.nl/txmpub/files/?p_file_id=2001424 , accessed June 11, 2014. (2) S. Chen et al. Acta Biochim. Biophys. Sin. 43:465, 2011. (3) J. Hammond et al. Arch. Virol. 151:477, 2006. (4) J. Hammond and M. Reinsel. Acta Hort. 901:119, 2011. (5) P. Moreno et al. Proc. Am. Phytopathol. Soc. 3:319, 1976.
RESUMO
Monogeneans are the parasites mostly found on the body surface and gills of fish and can cause large losses in farmed fish. Some studies demonstrate elevated parasitic levels causing hematological alterations. But few of them relate the effects of parasitism on the hematology and histopathology of native freshwater farmed fish. This study evaluated the host-parasite relationship in pacu (Piaractus mesopotamicus) parasitized by the monogenean Anacanthorus penilabiatus. Hematological and parasitological assessments were obtained in 60 fish captured in a fish farm located in Dourados, State of Mato Grosso do Sul, Central Brazil. Fish were analyzed in different categories of parasite number: class I (n=13; 0-200 parasites), class II (n=17; 201-1200 parasites); class III (n=7; 1201-2200 parasites); and class IV (n=23; more than 2200 parasites per host). The highest levels of parasitism caused significant decrease (p<0.05) in the hematocrit, red blood cells (RBC), mean hemoglobin concentration (MCHC) and basophils number. Thrombocytes, mean corpuscular volume (MCV), mean corpuscular hemoglobin concentration (MCHC), monocytes, eosinophils, neutrophils and LG-PAS did not present significant difference among the parasitic levels. In contrast, increased number of total leukocytes and lymphocytes were found in highly-parasitized fish. A positive linear correlation (p<0.01) was found between the amount of parasites and fish weight. Histopathology revealed severe hyperplasia, sub-epithelial edema, fusion of the secondary lamellae, focal and multifocal necrosis in highly parasitized fish.
Parasitos Monogenea são principalmente encontrados na superficie corporal e brânquias dos peixes, e podem acarretar grandes perdas em pisciculturas. Alguns estudos demonstram que elevados níveis de infestação parasitária podem alterar os parâmetros sanguíneos. Porém, poucos estudos se direcionam a esclarecer os efeitos do parasitismo sobre as características hematológicas em peixes nativos. Este estudo avaliou a relação parasito-hospedeiro em pacu (Piaractus mesopotamicus) parasitado pelo monogenético Anacanthorus penilabiatus. Avaliações hematológicas e parasitológicas foram obtidas de 60 peixes capturados de uma piscicultura localizada em Dourados, Estado de Mato Grosso do Sul (MS), Brasil Central. Os peixes foram divididos em diferentes categorias de número de parasitos: classe I (n=13; 0-200 parasitos), classe II (n=17; 201-1200 parasitos); classe III (n=7; 1201-2200 parasitos); e classe IV (n=23; mais que 2200 parasitos por hospedeiro). Os níveis mais elevados de parasitismo causaram diminuição significativa (p<0.05) no hematócrito, eritrócitos (RBC), concentração de hemoglobina corpuscular média (CHCM) e número de basófilos. Trombócitos, volume corpuscular médio (VCM), concentração de hemoglobina corpuscular media (CHCM), monócitos, eosinófilos, neutrófilos e LG-AS não apresentaram diferença significativa entre os níveis de parasitismo. Em contraste, o aumento do número de leucócitos totais e linfócitos foram encontrados em peixes altamente parasitados. Houve correlação linear positiva entre a quantidade de parasitos e o peso dos peixes. O exame histopatológico revelou severa hiperplasia, edema sub-epitelial, fusão das lamelas secundárias, necroses focal e multifocal em peixes altamente parasitados.
Assuntos
Animais , Characidae/parasitologia , Doenças dos Peixes/parasitologia , Trematódeos/classificação , Brasil , Characidae/sangue , Characidae/classificação , Doenças dos Peixes/sangue , Doenças dos Peixes/patologia , Interações Hospedeiro-Parasita , Trematódeos/isolamento & purificaçãoRESUMO
Monogeneans are the parasites mostly found on the body surface and gills of fish and can cause large losses in farmed fish. Some studies demonstrate elevated parasitic levels causing hematological alterations. But few of them relate the effects of parasitism on the hematology and histopathology of native freshwater farmed fish. This study evaluated the host-parasite relationship in pacu (Piaractus mesopotamicus) parasitized by the monogenean Anacanthorus penilabiatus. Hematological and parasitological assessments were obtained in 60 fish captured in a fish farm located in Dourados, State of Mato Grosso do Sul, Central Brazil. Fish were analyzed in different categories of parasite number: class I (n=13; 0-200 parasites), class II (n=17; 201-1200 parasites); class III (n=7; 1201-2200 parasites); and class IV (n=23; more than 2200 parasites per host). The highest levels of parasitism caused significant decrease (p<0.05) in the hematocrit, red blood cells (RBC), mean hemoglobin concentration (MCHC) and basophils number. Thrombocytes, mean corpuscular volume (MCV), mean corpuscular hemoglobin concentration (MCHC), monocytes, eosinophils, neutrophils and LG-PAS did not present significant difference among the parasitic levels. In contrast, increased number of total leukocytes and lymphocytes were found in highly-parasitized fish. A positive linear correlation (p<0.01) was found between the amount of parasites and fish weight. Histopathology revealed severe hyperplasia, sub-epithelial edema, fusion of the secondary lamellae, focal and multifocal necrosis in highly parasitized fish.