Aptamer-Drug conjugates for a targeted and synergistic anticancer Response: Exploiting T30923-5-fluoro-2'-deoxyuridine (INT-FdU) derivatives.

One of the most appealing approaches for cancer treatment is targeted therapy, which is based on the use of drugs able to target cancer cells without affecting normal ones. This strategy lets to overcome the major limitation of conventional chemotherapy, namely the lack of specificity of anticancer drugs, which often leads to severe side effects, decreasing the therapy effectiveness. Delivery of cell-killing substances to tumor cells is one-way targeted drug therapy can work. Generally, monoclonal antibodies are combined with chemotherapeutic drugs, allowing cellular uptake through the binding to their targets on the surface of cancer cells. Aptamer-drug conjugates represent a promising alternative solution to antibodies to minimize off-target effects, considering the remarkable selective binding capabilities of aptamers. In this study, to enhance the therapeutic efficacy of the antineoplastic agent 5-fluoro-2'-deoxyuridine (FdU) in various cancer cells, we focused on the development of a novel conjugate using the antiproliferative aptamer T30923 (INT) as a drug vehicle. Three derivatives composed of T30923 conjugated with a different number of FdU units were synthesized, and their structural and biological properties were thoroughly characterized, highlighting their potential for targeted and synergistic anticancer responses.

Improving the Biological Properties of Thrombin-Binding Aptamer by Incorporation of 8-Bromo-2'-Deoxyguanosine and 2'-Substituted RNA Analogues.

Thrombin-binding aptamer (TBA) is one of the best-known G-quadruplex (G4)-forming aptamers. By adopting its peculiar chair-like G4 structure, TBA can efficiently bind to thrombin, thus producing an anticoagulant effect. The major limit to its therapeutic application is represented by its poor thermal and biological resistance. Therefore, numerous research studies have been focused on the design of TBA analogues with chemical modifications to improve its pharmacokinetic and pharmacodynamic properties. To maintain the functional recognition to protein surface on which TBA anticoagulant activity depends, it is essential to preserve the canonical antiparallel topology of the TBA quadruplex core. In this paper, we have designed three TBA variants with modified G-tetrads to evaluate the effects of nucleobase and sugar moiety chemical modifications on biological properties of TBA, preserving its chair-like G-quadruplex structure. All derivatives contain 8-bromo-2'-deoxyguanosine (GBr) in syn positions, while in the anti-positions, locked nucleic acid guanosine (GLNA) in the analogue TBABL, 2'-O-methylguanosine (GOMe) in TBABM, and 2'-F-riboguanosine (GF) in TBABF is present. CD (Circular Dichroism), CD melting, 1H-NMR (Nuclear Magnetic Resonance), and non-denaturing PAGE (Polyacrylamide Gel Electrophoresis), nuclease stability, prothrombin time (PT) and fibrinogen-clotting assays have been performed to investigate the structural and biological properties of these TBA analogues. The most interesting results have been obtained with TBABF, which revealed extraordinary thermal stability (Tm approximately 40 °C higher than that of TBA), anticoagulant activity almost doubled compared to the original aptamer, and, above all, a never-observed resistance to nucleases, as 50% of its G4 species was still present in 50% FBS at 24 h. These data indicate TBABF as one of the best TBA analogue ever designed and investigated, to the best of our knowledge, overcoming the main limitations to therapeutic applications of this aptamer.

Structural and Biological Features of G-Quadruplex Aptamers as Promising Inhibitors of the STAT3 Signaling Pathway.

In this paper, we investigate the structural and biological features of G-quadruplex (G4) aptamers as promising antiproliferative compounds affecting the STAT3 signalling pathway. Targeting the STAT3 protein through high-affinity ligands to reduce its levels or activity in cancer has noteworthy therapeutic potential. T40214 (STAT) [(G3C)4] is a G4 aptamer that can influence STAT3 biological outcomes in an efficient manner in several cancer cells. To explore the effects of an extra cytidine in second position and/or of single site-specific replacements of loop residues in generating aptamers that can affect the STAT3 biochemical pathway, a series of STAT and STATB [GCG2(CG3)3C] analogues containing a thymidine residue instead of cytidines was prepared. NMR, CD, UV, and PAGE data suggested that all derivatives adopt dimeric G4 structures like that of unmodified T40214 endowed with higher thermal stability, keeping the resistance in biological environments substantially unchanged, as shown by the nuclease stability assay. The antiproliferative activity of these ODNs was tested on both human prostate (DU145) and breast (MDA-MB-231) cancer cells. All derivatives showed similar antiproliferative activities on both cell lines, revealing a marked inhibition of proliferation, particularly at 72 h at 30 µM. Transcriptomic analysis aimed to evaluate STAT's and STATB's influence on the expression of many genes in MDA-MB-231 cells, suggested their potential involvement in STAT3 pathway modulation, and thus their interference in different biological processes. These data provide new tools to affect an interesting biochemical pathway and to develop novel anticancer and anti-inflammatory drugs.

Properties and Potential Antiproliferative Activity of Thrombin-Binding Aptamer (TBA) Derivatives with One or Two Additional G-Tetrads.

In this paper, we study the biological properties of two TBA analogs containing one and two extra G-tetrads, namely TBAG3 and TBAG4, respectively, and two further derivatives in which one of the small loops at the bottom (TBAG41S) or the large loop at the top (TBAG4GS) of the TBAG4 structure has been completely modified by replacing all loop residues with abasic site mimics. The therapeutical development of the TBA was hindered by its low thermodynamic and nuclease stability, while its potential as an anticancer/antiproliferative molecule is also affected by the anticoagulant activity, being a side effect in this case. In order to obtain suitable TBA analogs and to explore the involvement of specific aptamer regions in biological activity, the antiproliferative capability against DU 145 and MDAMB 231 cancer cell lines (MTT), the anticoagulant properties (PT), the biological degradability (nuclease stability assay) and nucleolin (NCL) binding ability (SPR) of the above described TBA derivatives have been tested. Interestingly, none of the TBA analogs exhibits an anticoagulant activity, while all of them show antiproliferative properties to the same extent. Furthermore, TBAG4 displays extraordinary nuclease stability and promising antiproliferative properties against breast cancer cells binding NCL efficiently. These results expand the range of G4-structures targeting NCL and the possibility of developing novel anticancer and antiviral drugs.

Antiproliferative Effects of the Aptamer d(GGGT)4 and Its Analogues with an Abasic-Site Mimic Loop on Different Cancer Cells.

In this paper, we study the T30923 antiproliferative potential and the contribution of its loop residues in six different human cancer cell lines by preparing five T30923 variants using the single residue replacement approach of loop thymidine with an abasic site mimic (S). G-rich oligonucleotides (GRO) show interesting anticancer properties because of their capability to adopt G-quadruplex structures (G4s), such as the G4 HIV-1 integrase inhibitor T30923. Considering the multi-targeted effects of G4-aptamers and the limited number of cancer cell lines tested, particularly for T30923, it should be important to find a suitable tumor line, in addition to considering that the effects also strictly depend on G4s. CD, NMR and non-denaturating polyacrylamide gel electrophoresis data clearly show that all modified ODNs closely resemble the dimeric structure of parallel G4s' parent aptamer, keeping the resistance in biological environments substantially unchanged, as shown by nuclease stability assay. The antiproliferative effects of T30923 and its variants are tried in vitro by MTT assays, showing interesting cytotoxic activity, depending on time and dose, for all G4s, especially in MDA-MB-231 cells with a reduction in cell viability approximately up to 30%. Among all derivatives, QS12 results are the most promising, showing more pronounced cytotoxic effects both in MDA-MB-231 and Hela cells, with a decrease in cell viability from 70% to 60%. In summary, the single loop residue S substitution approach may be useful for designing antiproliferative G4s, considering that most of them, characterized by single residue loops, may be able to bind different targets in several cancer cell pathways. Generally, this approach could be of benefit by revealing some minimal functional structures, stimulating further studies aimed at the development of novel anticancer drugs.

Discovering New G-Quadruplex DNA Catalysts in Enantioselective Sulfoxidation Reaction.

The natural human telomeric G-quadruplex (G4) sequence d(GGGTTAGGGTTAGGGTTAGGG) HT21 was extensively utilized as a G4 DNA-based catalytic system for enantioselective reactions. Nine oligonucleotides (ODNs) based on this sequence and containing 8-bromo-2'-deoxyadenosine (ABr), 8-oxo-2'-deoxyadenosine (Aoxo) or ß-L-2'-deoxyadenosine (AL) at different single loop positions were investigated to evaluate their performances as DNA catalysts in an enantioselective sulfoxidation reaction of thioanisole. The substitution of an adenosine in the loops of HT21 with these modified residues had a negligible impact on the G4 DNA structural features, thermal stability, and catalytic activity, since almost all investigated ODNs were able to form G-quadruplexes strictly resembling that of HT21 and catalyze a full conversion of the thioanisole substrate. More marked effects were obtained in chiral selectivity of G4 DNA metalloenzymes, considering that in most cases the DNA-modified catalysts induced lower enantioselectivities compared to the natural one. However, the HT21 derivative containing an AL residue in the first loop sequence significantly proved to be capable of producing about 84% enantiomeric excess, the highest enantioselectivity for DNA-based oxidation reaction to date.

Exploring New Potential Anticancer Activities of the G-Quadruplexes Formed by [(GTG2T(G3T)3] and Its Derivatives with an Abasic Site Replacing Single Thymidine.

In this paper, we report our investigations on five T30175 analogues, prepared by replacing sequence thymidines with abasic sites (S) one at a time, in comparison to their natural counterpart in order to evaluate their antiproliferative potential and the involvement of the residues not belonging to the central core of stacked guanosines in biological activity. The collected NMR (Nuclear Magnetic Resonance), CD (Circular Dichroism), and PAGE (Polyacrylamide Gel Electrophoresis) data strongly suggest that all of them adopt G-quadruplex (G4) structures strictly similar to that of the parent aptamer with the ability to fold into a dimeric structure composed of two identical G-quadruplexes, each characterized by parallel strands, three all-anti-G-tetrads and four one-thymidine loops (one bulge and three propeller loops). Furthermore, their antiproliferative (MTT assay) and anti-motility (wound healing assay) properties against lung and colorectal cancer cells were tested. Although all of the oligodeoxynucleotides (ODNs) investigated here exhibited anti-proliferative activity, the unmodified T30175 aptamer showed the greatest effect on cell growth, suggesting that both its characteristic folding in dimeric form and its presence in the sequence of all thymidines are crucial elements for antiproliferative activity. This straightforward approach is suitable for understanding the critical requirements of the G-quadruplex structures that affect antiproliferative potential and suggests its application as a starting point to facilitate the reasonable development of G-quadruplexes with improved anticancer properties.