RESUMO
The Dominican Republic has a significant area of the country cultivated with vegetables. In July 2013, in the provinces of Moca and La Vega, horticultural crops showed typical tospovirus symptoms (>30% incidence), including bronzing, chlorosis, necrosis, and ring spots on leaves and fruits. Samples were collected from potatoes (Solanum tuberosum), long beans (Vignaun guiculata), chili peppers (Capsicum frutescens), sweet peppers (C. annuum), and tomatoes (S. lycopersicum). Serological tests were clearly positive for infection by Tomato spotted wilt virus (TSWV) and/or related tospoviruses when tested with AgDia immunostrips. The viral RNA extracted from five plants per host was pooled to construct a cDNA library that was sequenced using an Illumina HiSeq 2000 platform. The paired-end reads were assembled using CLC Genomic Workbench version 6.0.3. The assembled contigs were submitted to BLASTx against a viral genome database. The results confirmed the presence of Tomato chlorotic spot virus (TCSV) and TSWV. Then, PCR tests were performed with primers pairs TSWV-LF 5' CTGTTGTCTATTGAGGATTGTG 3' AND TSWV-LR 5' CAGAGAGCTTGTTAATGCAGGAC 3' to amplify part of the TSWV L RNA, the pairs TCSV-SF 5' AACTGGGAAAGCAGAAAACC 3' and TCSV-SR 5' CCTTACTCCGAACATTGCA 3', and GRSV-SF 5' CTGTCAGGAAAATCTTGACCTG 3' and GRSV-SR 5' CTTGACTCCAAACATCTCGT 3' to detect part of the TCSV and Groundnut ringspot virus (GRSV) S segments. In the long bean and chili pepper samples from La Vega, only TCSV was detected (40% of the all samples) based on amplification of the expected size fragment with the S RNA specific primer pair. All the other samples were positive for TSWV and no GRSV was detected. The complete N gene of TCSV and TSWV were amplified using the primer pairs TCSV-NR2 5' CACACTGAACTGAACTATAACACAC 3' and TCSV-NF 5' ACCTTGAATCATATCTCTCG 3' and primers N-TSWV_FW 5' TACGGATCCGATGTCTAAGGTTAAGCTCAC 3' and N-TSWV_RV 5' TTATCTCGAGTCAAGCAAGTTCTGCGAG 3'. The TCSV N protein sequences (KJ399303 and KJ399304) were 99% identical with the TCSV found in processing tomatoes in the Dominican Republic (1) and the United States (2). The TSWV N protein sequences (KJ399313, KJ399314 and KJ399315) shared 96 to 98% identity with the TSWV N sequences available. Dot blot hybridization tests (1) using DIG-labeled specific TCSV N gene probe confirmed TCSV infection in PCR-positive long bean and chili pepper samples, whereas no hybridization signal was detected for TSWV-infected tomatoes, potatoes, sweet peppers, or healthy samples. In addition, no reassortants were detected based on amplification of the expected size RNA fragments (3). These other amplicons (KJ399301, KJ399299, KJ399302, and KJ399300) showed 98% identity with the L and M segments of TCSV. Thrips collected from symptomatic plants were identified mainly as Frankliniella schultzei, consistent with the main thrips species transmitting TCSV. In the last two years, TCSV was reported in North and Central America and in the Caribbean Basin (1,2,4). These findings have an important epidemiological impact since TCSV represents a new threat to other horticultural crops affected by this tospovirus. References: (1) O. Batuman et al. Plant Dis. 98:286, 2014. (2) A. Londono et al. Trop. Plant Pathol. 37:333, 2012. (3) C. G. Webster et al. Virology 413:216, 2011. (4) C. G. Webster et al. Plant Health Progress. Online publication. doi:10.1094/PHP-2013-0812-01-BR, 2013.
RESUMO
In the Dominican Republic, green bell pepper (Capsicum annuum L.) and tomato (Solanum lycopersicum L.) are widely cultivated under protected greenhouse conditions as high value commercial crops for export. For the past 2 to 3 years, pepper and tomato have been observed in protected crop facilities in Jarabacoa and Constanza in the North Region with chlorotic and necrotic spots and rings on leaves, petioles, and stems, leaf bronzing, and tip necrosis. Fruits on symptomatic pepper and tomato plants showed concentric rings, irregular chlorotic blotches and deformation, and uneven maturation and development. Incidence on pepper and tomato was 20 to 100% and 5 to 20%, respectively. In initial tests, leaves and fruits from each of 20 symptomatic tomato and pepper plants from several greenhouse facilities were reactive in Tomato spotted wilt virus (TSWV; genus Tospovirus, family Bunyaviridae) immunostrip assays (Agdia, Inc., Elkhart, IN). Since these immunostrips are known to react with other tospoviruses, such as Tomato chlorotic spot virus (TCSV) and Groundnut ring spot virus, additional molecular diagnostic assays were conducted. Leaf and fruit samples from symptomatic plants were imprinted on nitrocellulose membrane (NCM) (2), air-dried, and sent to Washington State University for confirmatory tests. Viral nucleic acids were eluted from NCM discs (1) and subjected to reverse transcription (RT)-PCR using primers gL3637 (CCTTTAACAGTDGAAACAT) and gL4435 (CATDGCRCAAGARTGRTARACAGA) designed to amplify a portion of the L RNA segment of several tospoviruses (3). A single DNA product of ~800 bp was amplified from all samples. Amplicons from two tomato (leaf and fruit) and one pepper fruit samples were cloned separately into pCR2.1 (Invitrogen Corp., Carlsbad, CA). Two independent clones per amplicon were sequenced in both orientations. Sequence analyses of these clones (GenBank Accession Nos. KF 219673 to 75) showed 100% nucleotide sequence identity among themselves and 97% identity with corresponding L RNA sequences of pepper isolates of TSWV from Taiwan (HM180088) and South Korea (HM581940), 94 to 95% with tomato isolates of TSWV from South Korea (HM581934) and Hawaii (AY070218), and 89% with a tomato isolate from Indonesia (FJ177301). These results further confirm the presence of TSWV in symptomatic tomato and pepper plants. A comparison of TSWV sequences from the Dominican Republic with TSWV isolates from the United States and other countries in the Caribbean region could not be made due to the absence of corresponding sequences of the L-RNA of the virus from these countries in GenBank. TSWV-positive samples were negative for TCSV in RT-PCR, indicating the absence of this tospovirus that has been reported in the Caribbean region (data not shown). To our knowledge, this is the first confirmed report of TSWV in tomatoes and peppers in the Dominican Republic. The presence of vector thrips, Frankliniella occidentalis, on symptomatic plants was also confirmed, suggesting a role in the spread of TSWV under greenhouse conditions. Recent surveys identified some greenhouses with 100% symptomatic peppers. The presence of TSWV in tomato and pepper has important implications for the domestic and export vegetable industry in the Dominican Republic because of the broad host range of the virus (4). It is critical for commercial producers to monitor TSWV and deploy appropriate management strategies to limit virus spread. References: (1) O. J. Alabi et al. J. Virol. Methods 154:111, 2008. (2) P.-G. S. Chang et al. J. Virol. Methods 171:345, 2011. (3) F. H. Chu et al. Phytopathology 91:361, 2001. (4) G. Parrella et al. J. Plant Pathol. 85:227, 2003.
