Improved outcomes of islet autotransplant after total pancreatectomy by combined blockade of IL-1ß and TNFα.

The efficacy of islet transplant is compromised by a significant loss of islet mass posttransplant due to an innate inflammatory reaction. We report the use of a combination of etanercept and anakinra (ANA+ETA) to block inflammatory islet damage in 100 patients undergoing total pancreatectomy with islet autotransplant. The patients were divided into 3 groups: no treatment (control [CTL]), etanercept alone (ETA), or a combination of etanercept and anakinra (ANA+ETA). Peritransplant serum samples were analyzed for protein markers of islet damage and for inflammatory cytokines. Graft function was assessed by fasting blood glucose, basal C-peptide, secretory unit of islet transplant objects (SUITO) index, and hemoglobin A1c . Administration of both antiinflammatory drugs was well tolerated without any major adverse events. Reductions in interleukin-6, interleukin-8, and monocyte chemoattractant protein 1 were observed in patients receiving ANA+ETA compared with the CTL group, while also showing a modest improvement in islet function as assessed by basal C-peptide, glucose, hemoglobin A1c , and SUITO index but without differences in insulin dose. These results suggest that double cytokine blockade (ANA+ETA) reduces peritransplant islet damage due to nonspecific inflammation and may represent a promising strategy to improve islet engraftment, leading to better transplant outcomes.

Electricity production from municipal solid waste using microbial fuel cells.

The organic content of municipal solid waste has long been an attractive source of renewable energy, mainly as a solid fuel in waste-to-energy plants. This study focuses on the potential to use microbial fuel cells to convert municipal solid waste organics into energy using various operational conditions. The results showed that two-chamber microbial fuel cells with carbon felt and carbon felt allocation had a higher maximal power density (20.12 and 30.47 mW m(-2) for 1.5 and 4 L, respectively) than those of other electrode plate allocations. Most two-chamber microbial fuel cells (1.5 and 4 L) had a higher maximal power density than single-chamber ones with corresponding electrode plate allocations. Municipal solid waste with alkali hydrolysis pre-treatment and K3Fe(CN)6 as an electron acceptor improved the maximal power density to 1817.88 mW m(-2) (~0.49% coulomb efficiency, from 0.05-0.49%). The maximal power density from experiments using individual 1.5 and 4 L two-chamber microbial fuel cells, and serial and parallel connections of 1.5 and 4 L two-chamber microbial fuel cells, was found to be in the order of individual 4 L (30.47 mW m(-2)) > serial connection of 1.5 and 4 L (27.75) > individual 1.5 L (20.12) > parallel connection of 1.5 and 4 L (17.04) two-chamber microbial fuel cells . The power density using municipal solid waste microbial fuel cells was compared with information in the literature and discussed.

First Report of Euphorbia leaf curl virus and Papaya leaf curl Guangdong virus on Passion Fruit in Taiwan.

Passion fruit (Passiflora edulis × Passiflora edulis f. flavicarpa) 'Tainung No. 1' is the main variety cultivated in Taiwan, which is a hybrid and propagated only by grafting. In the spring of 2011, plants with systemic mottle and malformation on leaves were found in some orchards located in Puli and Nantou in central Taiwan. Interestingly, after 3 months of growth, most of these diseased plants became symptomless when the weather became warmer. Nevertheless, some striped concaves were observed on immature fruit surfaces of diseased plants. In March of 2011, two leaf samples exhibiting mosaic and three samples showing malformation were collected and tested by DAS-ELISA; none positively reacted with antibodies against the Cucumber mosaic virus (CMV), East Asian passiflora virus (EAPV), Passion fruit mottle virus (PaMV), or Passion fruit crinkle virus (PCV) that have previously occurred in Taiwan. Rolling-circle amplification (RCA) with hexamer primers were adopted to analyze potential begomoviruses that were prevalent on the other crops in Taiwan (3). The RCA amplified products were digested with BamHI and separated on 1.2% agarose by gel electrophoresis. A fragment, about 3 kb, was purified from each gel and cloned into the respective site of pBluescript SK(-) individually. Clones were screened by EcoRI digestion and two types of restriction fragment length patterns were found among them. One type of a clone containing 2,745 nucleotides (Accession No. KC161185) with 98.5% identity to Euphorbia leaf curl virus (EuLCV) (1) and the other type of a clone containing 2,732 nucleotides (KC161184) with 91.7% identity to Papaya leaf curl Guangdong virus (PaLCuGDV) (2) were revealed by nucleotide comparisons of their DNA-A in GenBank. Accordingly, we confirmed the existence of passiflora isolates of EuLCV and PaLCuGDV. PCR primers CPup/Edw/Pdw (5'TGTGAAGG(A/C/G/T)CC(A/G/T)TGTAA(A/G)GT3'/5'CGCAGTTT CTGGAGGATATTAAG3'/5'TCGCATGCCACTTCCTCAGT3') were designed to differentiate these viruses by amplifying a 235 bp DNA fragment for EuLCV and 345 bp for PaLCuGDV. In a brief survey, all 26 passion fruit leaf samples collected from seven orchards were double infected with EuLCV and PaLCuGDV; only six samples collected from a specific orchard were found to harbor the PaLCuGDV infection. Thirty-seven seedlings from passion fruit (P. edulis f. flavicarpa) seeds were indexed and all were free from both viruses. Five virus-free plantlets of P. edulis f. flavicarpa, one EuLCV and PalCuGDV double infected P. edulis × P. edulis f. flavicarpa, and 20 whiteflies were put into one net tent for 2 months, and then the five plantlets were tested by PCR. The two EuLCV and PalCuGDV specific fragments were amplified from all five plantlets. The two begomoviruses cause mild symptoms on passion fruit plant but the appearance of the fruit was affected. To our knowledge, this is the first report of begomoviruses infecting passion fruit in Taiwan and in Asia. References: (1) X. Ma et al. J. Phytopathol. 152:215. (2) X. Wang et al. Virus Genes 29:303. (3) C. Wu et al. J. Virol. Methods 147:355.

First Report of Cowpea mild mottle virus in Cowpea and French Bean in Taiwan.

In 2009, more than 50% of vine type French beans were found bearing severe viral symptoms in a vegetable garden in Nantou County, Taiwan. Infected plants were stunted and exhibited pronounced mottling symptoms on their leaves. The symptomatic plants were mechanically inoculated on Chenopodium quinoa and local lesions developed 7 to 10 days after inoculation. The virus source established by back isolation the single lesion from C. quinoa on French beans developed symptoms similar to those found in the field. Host range test showed that this isolate could only infect leguminous plants, including soybean, mung bean, pea, peanut, asparagus bean, cowpea, adzuki bean, and lima bean, but not cucurbitaceous and solanaceous plants. Since only Cucumber mosaic virus (CMV) has been reported in Taiwan to induce similar symptoms in French beans, we tested both the field collected and inoculated French beans by CMV antiserum in ELISA but obtained a negative result. Due to subsequent electron microscopy studies that found potyvirus and carlavirus like particles in the leaf dips of infected French beans, we conducted reverse transcription (RT)-PCR using generic degenerate primers for potyviruses (Hrp5/Pot1 (2) and PotZ/Pot1 (3)) and carlaviruses (Decarla-u2 (5'-TGCACTGARTCMGAYTATGARGCYTT-3' and Decarla-d1 (5'-GCACATRTCRTCVCCDGCAAA-3') previously designed in our lab. No amplification was found from the potyvirus primers, while the carlavirus one gave an expected amplicon of 285 bp, which was found sharing 81% nucleotide sequence identity with the replicase gene of Cowpea mild mottle virus (CpMMV) (GenBank Accession No. FJ560903). A primer pair (CpMMV-CPu: 5'-TTTACTCTTAggTWATggAgTC-3' and CpMMV-CPd: 5'-CCTATTAAAACACACAAHTCAAA-3') was thus designed to amplify the complete coat protein (CP) gene based on the reported CP sequences and obtained an expected 867-bp product from our French bean isolate. This 867-bp sequence (JX020701) was confirmed to have 97.6% amino acid sequence identities with the CP gene of a Puerto Rican CpMMV isolate (GU191840). In a separate survey, another isolate from asparagus bean (CpMMV-V) causing mild mottling symptom was obtained. Analyses of the CP gene of CpMMV-V (JX070669) confirmed that it shared 88.8% and 97.8% of nucleotide and amino acid sequence identities with the French bean isolate, respectively. Different from most carlaviruses with aphid transmissibility, CpMMV has been shown to be transmitted non-persistently by whiteflies (1). Both CpMMV isolates from Taiwan were confirmed to be transmitted by silver leaf whiteflies (Bemicia argentifolii Bellows and Perring). This is the first record of whitefly transmissible legume virus in Taiwan. Since whitefly has been a problem in agriculture worldwide, CpMMV can be a new emerging threat for Taiwan's legume crop production. References: (1) M. Iwaki et al. Plant Dis. 66:365, 1982. (2) S. S. Pappu et al. J. Virol. Methods 41:9, 1993. (3) F. M. Zerbini et al. Phytopathology 85:746.

Remnant living cells that escape cell loss in late-stage tumors exhibit cancer stem cell-like characteristics.

A balance between cell proliferation and cell loss is essential for tumor progression. Although up to 90% of cells are lost in late-stage carcinomas, the progression and characteristics of remnant living cells in tumor mass are unclear. Here we used molecular imaging to track the progression of living cells in a syngeneic tumor model, and ex vivo investigated the properties of this population at late-stage tumor. The piggyBac transposon system was used to stably introduce the dual reporter genes, including monomeric red fluorescent protein (mRFP) and herpes simplex virus type-1 thymidine kinase (HSV1-tk) genes for fluorescence-based and radionuclide-based imaging of tumor growth in small animals, respectively. Iodine-123-labeled 5-iodo-2'-fluoro-1-beta-D-arabinofuranosyluracil was used as a radiotracer for HSV1-tk gene expression in tumors. The fluorescence- and radionuclide-based imaging using the single-photon emission computed tomography/computed tomography revealed that the number of living cells reached the maximum at 1 week after implantation of 4T1 tumors, and gradually decreased and clustered near the side of the body until 4 weeks accompanied by enlargement of tumor mass. The remnant living cells at late-stage tumor were isolated and investigated ex vivo. The results showed that these living cells could form mammospheres and express cancer stem cell (CSC)-related biomarkers, including octamer-binding transcription factor 4, SRY (sex-determining region Y)-box 2, and CD133 genes compared with those cultured in vitro. Furthermore, this HSV1-tk-expressing CSC-like population was sensitive to ganciclovir applied for the suicide therapy. Taken together, the current data suggested that cells escaping from cell loss in late-stage tumors exhibit CSC-like characteristics, and HSV1-tk may be considered a theranostic agent for targeting this population in vivo.

First Report of Pepper mottle virus in Bell Pepper in Taiwan.

Bell pepper (Capsicum annuum L.) plants exhibiting systemic mild mosaic, vein yellowing, and leaf malformation were collected from Puli City in 2006. Double-antibody sandwich (DAS)-ELISA was used to test these samples for Chilli veinal mottle virus (ChiVMV) infection using polyclonal antibodies. In addition, Chenopodium quinoa, C. amaranticolor, and Nicotiana benthamiana plants were mechanically inoculated with sap extracted from collected samples. Ten days postinoculation, chlorotic local lesions were observed on inoculated leaves of C. quinoa and C. amaranticolor plants, whereas, systemic mosaic and foliar distortion symptoms were developed on upper leaves of N. benthamiana plants. The DAS-ELISA test showed that field-collected pepper samples and inoculated leaves of C. quinoa and C. amaranticolor were infected with ChiVMV, while N. benthamiana with mosaic symptoms did not react with ChiVMV antibodies. To confirm ChiVMV, field-collected samples as well as mechanically inoculated plants were tested by reverse transcription (RT)-PCR using the potyvirus degenerate primers Hrp5/Pot1 (2). Amplified RT-PCR products were cloned and sequenced. Sequence analysis of amplified fragments (1.4 kb) revealed that field-collected pepper samples were infected with ChiVMV and Pepper mottle virus (PepMoV). The DNA fragment amplified from C. quinoa and C. amaranticolor showed high (99.2%) sequence identities with the CP gene of ChiVMV (3) (GenBank Accession No. AM909717). However, amplicons obtained from N. benthamiana plants (GenBank Accession No. HQ329082) that showed mosaic symptoms showed 83.6% to 98.7% nucleotide identities with PepMoV (GenBank Accession Nos. AB126033, AF227728, AF440801, AF501591, EU586133, and M96425). Next, a pure isolate of PepMoV was established on N. benthamiana by mechanical inoculation of diluted plant sap obtained from a PepMoV-infected N. benthamiana plant. Bell pepper plants inoculated with the Taiwan isolate of PepMoV developed mosaic and leaf distortion symptoms. Antiserum against the PepMoV Taiwan isolate was subsequently prepared by immunizing rabbits with purified virus particles. Using the prepared antiserum and specific primers (1) to detect PepMoV, ChiVMV, and Pepper veinal mottle virus (PVMV), three viruses could be readily detected and differentiated from diseased bell peppers in the field. In a survey done in 2007, 18 of 33 pepper samples from southern Taiwan were found with mixed infections of PepMoV and ChiVMV, seven samples were infected with PepMoV and PVMV, five samples were infected with PVMV, and another three samples were infected with ChiVMV. To our knowledge, this is the first report of the occurrence of PepMoV in bell peppers in Taiwan. References: (1) Y. H. Cheng et al. Plant Dis. 93:107, 2009. (2) S. S. Pappu et al. Plant Dis. 82:1121, 1998. (3) W. S. Tsai et al. Plant Pathol. 58:408, 2008.

First Report of Capsicum chlorosis virus Infecting Amaryllis and Blood Lily in Taiwan.

Capsicum chlorosis virus (CaCV), a thrips-transmitted, tentative species in the genus Tospovirus, family Bunyaviridae, was first identified in solanaceous crops, but also infects several ornamental crops such as orchid (4), gloxinia (3), and calla lily (1). From 2005 to 2007, virus-like yellow ringspots were observed on the leaves of amaryllis (Hippeastrum hybridum Hort.) and blood lily (Haemanthus multiflorus Martyn.) plants cultured in screenhouses and a private garden, respectively. Three of several hundred amaryllis plants in screenhouses from two places were observed as showing yellow ringspot symptoms and one of six blood lily plants was observed as showing similar yellow ringspot symptoms. Sap extracts from symptomatic leaves were inoculated to Chenopodium quinoa Willd. and the resulting local lesions were passaged three successive times to C. quinoa for virus isolation. Using the tospovirus genus-specific primers gL3637 and gL4435c designed from the conserved region in the L RNA (2), DNA fragments of the expected size of 800 bp were amplified by reverse transcription (RT)-PCR from field samples and local lesions from C. quinoa. Extracts from the diseased plants and local lesions of C. quinoa reacted strongly with antiserum against the nucleocapsid (N) protein of CaCV in ELISA and western blotting. To confirm the identity of this virus, we amplified the N gene from three amaryllis and one blood lily source using primer pair WN2328 and WN3534 designed from the S RNA of Watermelon silver mottle virus (1), and these products were cloned and sequenced. The sequence from each virus isolate was determined from three independent clones. The nucleotide and deduced amino acid sequences of N genes for the blood lily isolate (GenBank Accession No. EF101344) and three amaryllis isolates (GenBank Accession Nos. EF101343, EF137177, and FJ185170) had identities greater than 97% with that of a CaCV isolate infecting Capsicum spp. found in Australia (GenBank Accession No. AY036057). Phylogenetic analysis using maximum parsimony showed that these sequences clustered with CaCV. These results show that the virus identified from amaryllis and blood lily that were expressing yellow ringspot symptoms are isolates of CaCV. To our knowledge, this is the first report of CaCV naturally infecting amaryllis and blood lily and it could become an important threat to ornamental production in Taiwan. References: (1) C. C. Chen et al. Plant Dis. 91:1201, 2007. (2) F. H. Chu et al. Phytopathology 91:361, 2001. (3) H. T. Hsu et al. J. Gen. Plant Pathol. 66:167, 2000. (4) Y. X. Zheng et al. Eur. J. Plant Pathol. 120:199, 2008.

First Report of Pepper veinal mottle virus in Tomato and Pepper in Taiwan.

In May of 2006, samples from tomato plants (Solanum lycopersicum cv. Known-you 301) exhibiting necrotic symptoms on stems, petioles, and leaves were collected from Chiayi County, Taiwan. Double-antibody sandwich-ELISAs were performed using Cucumber mosaic virus, Tomato mosaic virus, Potato virus Y, Watermelon silver mottle virus, and Chilli veinal mottle virus (ChiVMV) polyclonal antibodies. Three of eight samples reacted with antibodies against ChiVMV but not with the others. Using the potyvirus degenerate primers (Hrp 5/Pot 1) (2), an expected 1.5-kb DNA fragment including the 3'-end of the NIb gene, the complete coat protein (CP) gene, and the 3'-nontranslatable region of the virus was amplified from total RNA isolated from these three samples by reverse transcription (RT)-PCR. A homology search in GenBank indicated that the new tomato-infecting virus in Taiwan belongs to Pepper veinal mottle virus (PVMV) since they shared >90% amino acid identity in the CP gene. A virus culture (Tom1) isolated from one of the diseased tomatoes was then established in Chenopodium quinoa and Nicotiana benthamiana and the CP gene was amplified and sequenced (GenBank Accession No. EU719647). Comparisons of the 807-nt CP gene with those of five PVMV isolates available in GenBank showed 81.5 to 93.1% nucleotide and 90.0 to 97.8% amino acid identity. Tom1 induced irregular necrotic lesions on stems, petioles, and leaves of tomato while inducing only mild mottle symptoms on pepper. Serological cross reaction between ChiVMV and PVMV has been observed previously (1,3) and also found in this study. To differentiate these two potyviruses by RT-PCR, primer pair CPVMVup/dw (5'-TATTC(T/C)TCAGTGTGG(A/T/C)T(T/C)CCACCAT and 5'-(T/C)C(A/T)C(A/T)(A/T/G)(A/T)AA(A/G)CCATAA(A/C)(A/C)ATA(A/G)T(T/C)T) was designed on the basis of the comparison of the CP gene and the 3'-nontranslatable region of the PVMV and ChiVMV. DNA fragments of 171 and 259 bp are expected to be amplified from ChiVMV and PVMV, respectively, by RT-PCR with primers CPVMVup/dw. In a field survey done in 2006, samples from diseased peppers (Capsicum annuum) that reacted with the polyclonal antibodies against ChiVMV were further identified by RT-PCR with primers CPVMVup/dw, indicating that both ChiVMV and PVMV infected pepper crops (Capsicum spp.) in Taiwan. A pepper isolate (Pep1) of PVMV was obtained from Nantou County through three times of single lesion passages on C. quinoa and then propagated on N. benthamiana. The CP gene of Pep1 was amplified and sequenced (GenBank Accession No. EU719646) and found to share 99.1% nucleotide and 100% amino acid identity with that of Tom1. Pep1 caused mild mottle symptoms on leaves of both tomato and pepper. To our knowledge, this is the first report of the presence of PVMV in Taiwan as well as in East Asia. References: (1) B. Moury et al. Phytopathology 95:227, 2005. (2) S. S. Pappu et al. Plant Dis. 82:1121, 1998. (3) W. S. Tsai et al. Plant Pathol. 58:408, 2008.

First Report of Capsicum chlorosis virus Causing Yellow Stripes on Calla Lilies in Taiwan.

Tomato spotted wilt virus (TSWV) and Calla lily chlorotic spot virus (CCSV) are two recognized species of the Tospovirus genus in the family Bunyaviridae infecting calla lily (Zantedeschia spp.). During 2005, 15 virus isolates were collected from different calla lily plants exhibiting yellow stripes on their leaves in Ho-Li, a major calla lily-production township in Taiwan. After three successive local lesion passages on Chenopodium quinoa Willd., diseased leaf tissues individually infected by these isolates were preserved in liquid nitrogen and used for subsequent identification studies. Using the tospovirus genus-specific primers gL3637 and gL4435c designed from the L RNA, an 800-bp DNA fragment was amplified in reverse transcription-PCR from all 15 isolates. Moreover, leaf extracts of the diseased calla lilies and the C. quinoa plants inoculated with the 15 virus isolates reacted with antisera against the nucleocapsid proteins (NP) of Capsicum chlorosis virus (CaCV)-gloxinia and Watermelon silver mottle virus (WSMoV), but not to monoclonal antibodies against the NP of TSWV, CCSV, Peanut chlorotic fan-spot virus (PCFV), or Impatiens necrotic spot virus (INSV) in indirect ELISA. These results indicate that the 15 virus isolates are tospoviruses belonging to the WSMoV serogroup. Additionally, we amplified and sequenced the full-length N gene from these tospovirus isolates using primers WN2328 (5'-CCATTGGTTTGCCTCCG-3') and WN3534 (5'-CGTCGACAGAGCAATCGAGGC-3') designed from the S RNA of WSMoV. The deduced amino acid sequences of the N protein from these 15 tospovirus isolates showed a greater than 92% identity to that of CaCV (GenBank Accession No. NC-008301). Furthermore, results of phylogenetic analysis of the 15 isolates on the basis of amino acids sequences, both genetic distance and parsimony trees indicated that they were all genetically clustered within CaCV using INSV, TSWV, and WSMoV as outgroups. The results indicate that the virus causing yellow stripes in calla lilies is a strain of CaCV. To our knowledge, this is the first evidence that CaCV can naturally infect calla lilies and cause yellow stripe symptoms. Reference: (1) F.-H. Chu et al. Phytopathology 91:361, 2001.

Identification of a Potyvirus Causing Latent Infection in Calla Lilies.

A new potyvirus designated as Calla lily latent virus (CLLV) was isolated from apparently healthy calla lilies (Zantedeschia spp.) collected from nurseries in Taichung County, Taiwan. Different from most calla lily-infecting potyviruses, CLLV infects Chenopodium quinoa and develops local lesions on inoculated leaves (3). Typical potyvirus particles approximately 780 nm long were detected from CLLV-induced C. quinoa local lesions. CLLV was transmitted readily to and established in C. quinoa. Attempts to establish CLLV infection in calla lilies from extracts of C. quinoa lesions were not successful. The virus was transmitted from infected to healthy calla lilies with difficulty. A 1.3-kb cDNA product was amplified by reverse transcription-polymerase chain reaction (RT-PCR) from CLLV-infected calla lilies and C. quinoa using potyvirus degenerate primers (2). The PCR product was cloned and sequenced. It was found to consist of 1,339 nucleotides (nt) (GenBank Accession No. AF469171) corresponding to the genome organization of the 3'terminal region of potyviruses. The deduced amino acid sequence contains 362 residues encoding the 3'terminal region of the nuclear inclusion b gene (80 residues) and the complete coat protein (CP) gene (282 residues). A 253-nt noncoding region (NCR) was found at the 3'terminal region of the cDNA. By comparing with known sequences of potyviruses, CLLV was identified as a new species of Potyvirus based on the uniqueness in the CP gene and 3' NCR. Soybean mosaic virus and Watermelon mosaic virus 2 are the potyviruses most similar to CLLV, but they share only approximately 80% nucleotide identity with CLLV in the CP and NCR regions. Attempts to purify sufficient CLLV from C. quinoa for antiserum preparation were not successful. Alternatively, polyclonal antibodies were produced using E. coli-expressed CLLV CP (1). The antibodies were useful for detection of CLLV and its CP in calla lilies using enzyme-linked immunosorbent assay, sodium dodecyl sulfate-immunodiffusion, immuno-specific electron microscopy, and western blot. Field surveys showed that calla lily plants found positive for CLLV by serological methods always remained symptomless throughout the six-month growing season. Occasionally, CLLV was detected in symptomatic calla lilies, but these plants were consistently confirmed dually infected by other viruses (Dasheen mosaic virus and Konjak mosaic virus found most commonly). Infection of CLLV alone in calla lilies may not have a direct impact on the production and marketing of the crop. Synergism is not currently known when calla lilies are coinfected with other viruses. CLLV is spread by vegetative propagation through infected rhizomes or tubers. References: (1) C. C. Chen et al. Plant Dis. 87:901-905, 2003. (2) S. S. Pappu et al. Plant Dis. 82:1121-1125, 1998. (3) F. W. Zettler and R. D. Hartman. Pages 464-470 in: Virus and Virus-like Diseases of Bulb and Flower Crops. G. Loebenstein et al., eds. John Wiley and Sons Inc., UK, 1995.

Identification of Turnip mosaic virus Isolates Causing Yellow Stripe and Spot on Calla Lily.

Two virus cultures, RC4 and YC5, were isolated in Taiwan from calla lily (Zantedeschia spp.) cv. Black magic displaying yellow spot and stripe on leaves. Both isolates were mechanically transmitted to various hybrids of Zantedeschia and induced systemic symptoms similar to those observed on diseased Black magic. In addition to Zantedeschia spp., the two virus isolates also infected several cruciferous species and induced mosaic symptoms. Electron microscopy revealed the presence of flexuous virus particles about 750 nm in length. The two isolates were propagated in and purified from mustard plants and were used as immunogens for production of antisera in rabbits. In enzyme-linked immunosorbent assay and sodium dodecyl sulfate-immunodiffusion tests, both antisera reacted strongly with their homologous antigens and with antigens of two Turnip mosaic virus (TuMV) isolates from radish (TuMV-R) and lisianthus (TuMV-L), but not with 21 other different potyviruses tested. In reciprocal tests, antisera against TuMV-R and TuMV-L also reacted strongly with RC4 and YC5 antigens, indicating that these two calla lily isolates are serologically indistinguishable from other known TuMV strains. Cloning and sequence analyses confirmed that both isolates shared 95 to 99% of deduced amino acid sequence identities in the coat protein genes with those of various known TuMV strains. This investigation represents the first record of the natural infection of TuMV in calla lily.

Genetic variability in the coat protein genes of two orchid viruses: Cymbidium mosaic virus and Odontoglossum ringspot virus.

The variability in coat protein gene sequences of Cymbidium mosaic virus (CymMV) and Odontoglossum ringspot virus (ORSV) that naturally infect orchids worldwide was investigated. Samples were collected from Korea, Singapore and Taiwan. The sequence data were compared with available published coat protein gene sequences of CymMV and ORSV, including those from Japan and Thailand. Among CymMV isolates, the homology was 89.1%-99.7% and 93.2%-100% at the nucleotide and amino acid levels, respectively. Among the ORSV isolates, the homology was 95.5%-100% and 93%-100% at the nucleotide and amino acid levels, respectively. No particular region of variability could be defined in either of the viruses. In deduced amino acid sequence, the N-terminal was more conserved than the C-terminal in both CymMV and ORSV. By comparing all sequences determined in this study and those that are published in the GenBank databases, we did not find clustering based on geographical distribution or sequence identity. Such high sequence conservation suggests that both CymMV and ORSV coat protein genes are suitable candidates to provide resistance to orchids cultivated in different geographical locations.

Ligand preorganization in metal ion complexation: molecular mechanics/dynamics, kinetics, and laser-excited luminescence studies of trivalent lanthanide complex formation with macrocyclic ligands TETA and DOTA.

The molecular mechanics and dynamics calculations, kinetics, and laser-excited luminescence studies were carried out for trivalent lanthanide (Ln(3+)) complexes of macrocyclic polyaminopolycarboxylate ligands TETA and DOTA (where TETA is 1,4,8,11-tetraazacyclotetradecane-1,4,8,11-tetraacetic acid and DOTA is 1,4,7,10-tetraazacyclododecane-1,4,7,10-tetraacetic acid) to further understand the observed thermodynamic, kinetic, and structural properties and to examine how ligand preorganization affects metal ion complexation. Excitation spectroscopy (emission monitored at 614.0 nm) of the (7)F(0) --> (5)D(0) transition of Eu(3+) was used to study the aqueous properties of the Eu(3+)-TETA system. A stopped-flow spectrophotometric method was used to study the formation kinetics of the aqueous Ce(3+)-TETA/DOTA systems in the pH range 6.1-6.7. Molecular mechanics calculation results are consistent with the proposed mechanism of Ln(DOTA)(-) formation, i.e., formation of a carboxylate O-bonded precursor, followed by metal ion moving into the preformed macrocyclic cavity. For Ln(TETA)(-) formation, at least two carboxylate O-bonded intermediates have been predicted and Ln(3+) ion assisted reorganization of the TETA ligand is present. The calculated bond distances and overall structures of Ln(DOTA)(-) and Ln(TETA)(-) were in agreement with the single-crystal and solution NMR structural data. The origin of the difference in thermodynamic stability of Ln(DOTA)(-) and Ln(TETA)(-) complexes and the corresponding formation intermediates is mainly due to the differences in water-occupancy energy (i.e., whether there is an apical coordinated water molecule), the ligand strain energy, and the cation-ligand interaction energy. Kinetic studies revealed that the formation rates of the Ce(TETA)(-) complex are smaller at lower pH and temperature but become greater at higher pH and temperature, as compared to those of the Ce(DOTA)(-) complex. This is attributed to the lanthanide ion and both mono- and di-hydroxide ion assisted TETA conformational reorganization and higher kinetic activation parameters. The presence of a di-hydroxide ion assisted intermediate rearrangement pathway could make the Ce(TETA)(-) complex formation rate faster at higher pH, and the higher activation barrier makes Ce(TETA)(-) complex formation rate slower at lower pH, as compared to those of the Ce(DOTA)(-) complex.

Identifying differentially expressed genes associated with metastasis of follicular thyroid cancer by cDNA expression array.

Patients with follicular thyroid carcinoma have a higher incidence of metastasis than papillary thyroid carcinoma when thyroid cancer is diagnosed. The cDNA expression array technology is utilized herein to profile differentially expressed genes from metastatic human follicular thyroid carcinoma and reveal new tumor markers as well as target genes for therapeutic intervention. Tissue samples were obtained during surgical resection of the thyroid follicular carcinoma and metastatic tissue in the brain of the same patient. Two identical Atlas human cDNA expression arrays were hybridized with 32P-labeled cDNA probes derived from RNA of either primary thyroid cancer or metastatic tissue. Parallel analysis of the hybridized signals allowed us to identify the alteration of gene expression in the metastasis process. Eighteen genes significantly overexpressed and 40 genes significantly underexpressed were identified in the metastatic thyroid cancer. Genes that displayed an altered expression were associated with the processes of cell cycle regulation, apoptosis, DNA damage response, angiogenesis, cell adhesion and mobility, invasion, and immune response. An expression profile of genes that are associated with metastasis process of follicular thyroid cancer was also discussed. Further investigation is required to understand the precise relationship between the altered expression of these genes and the metastasis process of follicular thyroid cancer.

Purification and characterization of neutral sphingomyelinase from Helicobacter pylori.

Phospholipase activities of human gastric bacterium, Helicobacter pylori, are regarded as the pathogenic factors owing to their actions on epithelial cell membranes. In this study, we purified and characterized neutral sphingomyelinase (N-SMase) from the superficial components of H. pylori strains for the first time. N-SMase was purified 2083-fold with an overall recovery of 37%. The purification steps included acid glycine extraction, ammonium sulfate precipitation, CM-Sepharose, Mono-Q, and Sephadex G-75 column chromatography. Approximate molecular mass for the native N-SMase was around 32 kDa. When N-omega-trinitrophenylaminolauryl sphingomyelin (TNPAL-SM) was used as a substrate, the purified enzyme exhibited a K(m) of 6.7 microM and a V(max) of 15.6 nmol of TNPAL-sphingosine/h/mg of protein at 37 degrees C in 50 mM phosphate-buffered saline, pH 7.4. N-SMase reaches optimal activity at pH 7.4 and has a pI of 7.15. The enzyme activity is magnesium dependent and specifically hydrolyzed sphingomyelin and phosphatidylethanolamine. The enzyme also exhibits hemolytic activity on human erythrocytes. According to Western blot analysis, a rabbit antiserum against purified N-SMase from H. pylori cross-reacted with SMase from Bacillus cereus. Sera from individuals with H. pylori infection but not uninfected ones recognizing the purified N-SMase indicated that it was produced in vivo. In enzyme-linked immunosorbent assays, the purified N-SMase used as an antigen was as effective as crude protein antigens in detecting human antibodies to H. pylori.

Differentiation of Biologically Distinct Peanut Stripe Potyvirus Strains by a Nucleotide Polymorphism-Based Assay.

A necrotic strain of peanut stripe potyvirus (PStV-Ts) was used to design and test strain-differentiating oligonucleotides. The 3' region of PStV-Ts, including a part of the NIb region, the complete coat protein (CP) gene, and the 3'-untranslated region, was cloned and sequenced. PStV-Ts had a high degree of sequence identity (92 to 95%) to the known non-necrotic (blotch) strains both at the nucleotide and amino acid sequence levels. Nucleotide sequence differences unique to the necrotic strain were identified when compared to the available non-necrotic isolates of PStV. Nucleotide polymorphism in the CP gene sequences was utilized in designing oligonucleotides that were specific to the necrotic strain, and were employed in an assay to differentiate the necrotic strain from non-necrotic. The 3' end mismatch in the oligonucleotides contributed in particular to the differentiation of the strains. This approach facilitated rapid, sensitive, and reliable detection and differentiation of PStV strains.

Characterization of a Potyvirus Causing Mild Mosaic on Tuberose.

A virus inducing mild mosaic symptoms on the leaves and peduncles of tuberose (Polianthes tuberosa) was isolated and partially characterized. The isolate, designated Tbr1, could be transmitted mechanically and by green peach aphids (Myzus persicae) in a non-persistent manner to tuberose seedlings but not to 16 common assay species. Flexuous rod-shaped particles with a mean length of 750 nm could be easily seen in infected leaf dips and in purified samples. Cytoplasmic cylindrical inclusions, pinwheel and laminated aggregates similar to those assigned to potyviral cylindrical inclusion type II, were observed in infected tuberose leaves. The purified capsid contained a single species of protein monomer with an estimated relative mass of 38 kDa. In reciprocal sodium dodecyl sulfate-immunodiffusion tests, antiserum against Tbr1 reacted only with its homologous antigen but not with 22 different known potyviruses. Using primer pairs designed for potyvirus sequence amplification, a 2-kb DNA product equivalent to the estimated size for potyviruses was consistently amplified from purified Tbr1 virions or from crude infected tissue by reverse transcription polymerase chain reaction. On the basis of these results, Tbr1 was recognized as a unique species in the genus Potyvirus and hence designated as tuberose mild mosaic potyvirus (TMMV).

An improved divergent synthesis of comb-type branched oligodeoxyribonucleotides (bDNA) containing multiple secondary sequences.

The divergent synthesis of branched DNA (bDNA) comb structures is described. This new type of bDNA contains one unique oligonucleotide, the primary sequence, covalently attached through a comb-like branch network to many identical copies of a different oligonucleotide, the secondary sequence. The bDNA comb structures were assembled on a solid support and several synthesis parameters were investigated and optimized. The bDNA comb molecules were characterized by polyacrylamide gel electrophoretic methods and by controlled cleavage at periodate-cleavable moieties incorporated during synthesis. The developed chemistry allows synthesis of bDNA comb molecules containing multiple secondary sequences. In the accompanying article we describe the synthesis and characterization of large bDNA combs containing all four deoxynucleotides for use as signal amplifiers in nucleic acid quantification assays.

Chemical synthesis and characterization of branched oligodeoxyribonucleotides (bDNA) for use as signal amplifiers in nucleic acid quantification assays.

The divergent synthesis of bDNA structures is described. This new type of branched DNA contains one unique oligonucleotide, the primary sequence, covalently attached through a comb-like branching network to many identical copies of a different oligonucleotide, the secondary sequence. The bDNA comb molecules were assembled on a solid support using parameters optimized for bDNA synthesis. The chemistry was used to synthesize bDNA comb molecules containing 15 secondary sequences. The bDNA comb molecules were elaborated by enzymatic ligation into branched amplification multimers, large bDNA molecules (a total of 1068 nt) containing an average of 36 repeated DNA oligomer sequences, each capable of hybridizing specifically to an alkaline phosphatase-labeled oligonucleotide. The bDNA comb molecules were characterized by electrophoretic methods and by controlled cleavage at periodate-cleavable moieties incorporated during synthesis. The branched amplification multimers have been used as signal amplifiers in nucleic acid quantification assays for detection of viral infection. It is possible to detect as few as 50 molecules with bDNA technology.

Helicobacter pylori induces gene expression in human gastric cells identified by mRNA differential display.

Changes in gene expression patterns in gastric cells infected with Helicobacter pylori were characterized by means of mRNA differential display. Total RNA preparations were extracted from the H. pylori infected gastric cells and paired non-infected cells, and were probed with candidate clones identified after screening up to 6,000 mRNA species. Among them, four clones, 04G-1, 04G-2, 01G-1, and Cppa-2 show significant expression in the infected cells by Northern blot analysis, and they are 199 bp, 196 bp, 228 bp, and 276 bp in length, respectively. Database search revealed that nucleotide sequences of these clones share very low identity with any known sequence. These results indicate that H. pylori can significantly affect gene expression in gastric cells. Furthermore mRNA differential display can be used in pathogenesis studies to identify new genes in gastric cells in response to insults such as H. pylori.