Xanthines Studied via Femtosecond Fluorescence Spectroscopy.

Xanthines represent a wide class of compounds closely related to the DNA bases adenine and guanine. Ubiquitous in the human body, they are capable of replacing natural bases in double helices and give rise to four-stranded structures. Although the use of their fluorescence for analytical purposes was proposed, their fluorescence properties have not been properly characterized so far. The present paper reports the first fluorescence study of xanthine solutions relying on femtosecond spectroscopy. Initially, we focus on 3-methylxanthine, showing that this compound exhibits non-exponential fluorescence decays with no significant dependence on the emission wavelength. The fluorescence quantum yield (3 × 10-4) and average decay time (0.9 ps) are slightly larger than those found for the DNA bases. Subsequently, we compare the dynamical fluorescence properties of seven mono-, di- and tri-methylated derivatives. Both the fluorescence decays and fluorescence anisotropies vary only weakly with the site and the degree of methylation. These findings are in line with theoretical predictions suggesting the involvement of several conical intersections in the relaxation of the lowest singlet excited state.

Ultrafast Electron Transfer in Complexes of Doxorubicin with Human Telomeric G-Quadruplexes and GC Duplexes Probed by Femtosecond Fluorescence Spectroscopy.

Doxorubicin (DOX) is a natural anthracycline widely used in chemotherapy; its combined application as a chemotherapeutic and photodynamic agent has been recently proposed. In this context, understanding the photoinduced properties of DOX complexes with nucleic acids is crucial. Herein, the study of photoinduced electron transfer in DOX-DNA complexes by femtosecond fluorescence spectroscopy is reported. The behaviour of complexes with two model DNA structures, a G-quadruplex (G4) formed by the human telomeric sequence (Tel21) and a d(GC) duplex, is compared. The DOX affinity for these two sequences is similar. Although both 1:1 and 2:1 stoichiometries have been reported for DOX-G4 complexes, only 1:1 complexes form with the duplex. The steady-state absorption indicates a strong binding interaction with the duplex due to drug intercalation between the GC base pairs. In contrast, the interaction of DOX with Tel21 is much weaker and arises from drug binding on the G4 external faces at two independent binding sites. As observed for DOX-d(GC) complexes, fluorescence of the drug in the first binding site of Tel21 exhibits decays within a few picoseconds following a biphasic pattern; this is attributed to the existence of two drug conformations. The fluorescence of the drug in the second binding site of Tel21 shows slower decays within 150 ps. These timescales are consistent with electron transfer from the guanines to the excited drug, as favoured by the lower oxidation potential of the stacked guanines of G4 with respect to those in the duplex.

Ultrafast Excited-State Deactivation of 8-Hydroxy-2'-deoxyguanosine Studied by Femtosecond Fluorescence Spectroscopy and Quantum-Chemical Calculations.

The fluorescence properties of the 8-hydroxy-2'-deoxyguanosine (8-oxo-dG) in aqueous solution at pH 6.5 are studied by steady-state spectroscopy and femtosecond fluorescence up-conversion and compared with those of 2'-deoxyguanine (dG) and 2'-deoxyguanine monophosphate (dGMP). The steady-state fluorescence spectrum of 8-oxo-dG is composed of a broad band that peaks at 356 nm and extends over the entire visible spectral region, and its fluorescence quantum yield is twice that of dG/dGMP. After excitation at 267 nm, the initial fluorescence anisotropy at all wavelengths is lower than 0.1, giving evidence of an ultrafast internal conversion (<100 fs) between the two lowest excited ππ* states (Lb and La). The fluorescence decays of 8-oxo-dG are biexponential with an average lifetime of 0.7 ± 0.1 ps, which is about two times longer than that of dGMP. In contrast with dGMP, only a moderate dynamical shift (∼1400 vs 10,000 cm(-1)) of the fluorescence spectra of 8-oxo-dG is observed on the time scale of a few picoseconds without modification of the spectral shape. PCM/TD-DFT calculations, employing either the PBE0 or the M052X functionals, provide absorption spectra in good agreement with the experimental one and show that the deactivation path is similar to that proposed for dGMP, with a fast motion toward an energy plateau, where the purine ring keeps an almost planar geometry, followed by decay to S0, via out-of-the plane motion of amino substituent.

Electronic Excitations in G-quadruplexes Formed by the Human Telomeric Sequence: A Time-Resolved Fluorescence Study.

The present study deals with G-quadruplexes formed by folding of the human telomeric sequence d(GGGTTAGGGTTAGGGTTAGGG), in presence of K(+) cations, noted Tel21/K(+) . Fluorescence decays and fluorescence anisotropy decays, obtained upon excitation at 267 nm, are probed from femtosecond to nanosecond domains using two different detection techniques, fluorescence upconversion and time-correlated single photon counting. The results are discussed in light of recent theoretical studies. It is shown that efficient energy transfer takes place among the bases on the femtosecond time scale, possible only via exciton states. The major part of the fluorescence originates from bright excited states having weak charge transfer character and decaying between 1 and 100 ps. Charge transfer states involving guanines in different tetrads decay mainly after 100 ps and emit at the red wing of the spectrum. The persistence of electronic excitations in Tel21/K(+) is longer and the contribution of charge transfer states is more pronounced than what is observed for G-quadruplexes formed by association of four d(TGGGT) strands and containing the same number of tetrads. This difference is due to the increased structural rigidity of monomolecular structures which reduces nonradiative deactivation pathways and favors collective effects.

Electronic excitations in Guanine quadruplexes.

Guanine rich DNA strands, such as those encountered at the extremities of human chromosomes, have the ability to form four-stranded structures (G-quadruplexes) whose building blocks are guanine tetrads. G-quadruplex structures are intensively studied in respect of their biological role, as targets for anticancer therapy and, more recently, of their potential applications in the field of molecular electronics. Here we focus on their electronic excited states which are compared to those of non-interacting mono-nucleotides and those of single and double stranded structures. Particular emphasis is given to excited state relaxation processes studied by time-resolved fluorescence spectroscopy from femtosecond to nanosecond time scales. They include ultrafast energy transfer and trapping of ππ* excitations by charge transfer states. The effect of various structural parameters, such as the nature of the metal cations located in the central cavity of G-quadruplexes, the number of tetrads or the conformation of the constitutive single strands, are examined.

Ultrafast carbonyl motion of the photoactive yellow protein chromophore probed by femtosecond circular dichroism.

Motions of the trans-p-coumaric acid carbonyl group following the photoexcitation of the R52Q mutant of photoactive yellow protein (PYP) are investigated, for the first time, by ultrafast time-resolved circular dichroism (TRCD) spectroscopy. TRCD is monitored in the near-ultraviolet, over a time scale of 10 ps. Immediately after excitation, TRCD is found to exhibit a large negative peak, which decays within a few picoseconds. A quantitative analysis of the signals shows that, upon excitation, the carbonyl group undergoes a fast (≪0.8 ps) and unidirectional flipping motion in the excited state with an angle of ca. 17-53°. For the subset of proteins that do not enter the signaling photocycle, TRCD provides strong evidence that the carbonyl group moves back to its initial position, leading to the formation of a nonreactive ground-state intermediate of trans conformation. The initial ground state is then restored within ca. 3 ps. Comparative study of R52Q and wild-type PYP provides direct evidence that the absence of Arg52 has no effect on the conformational changes of the chromophore during those steps.

The effect of size on the optical properties of guanine nanostructures: a femtosecond to nanosecond study.

G-quadruplexes, whose building blocks are guanine tetrads, encounter increasing interest with respect to their potential applications in the field of molecular electronics. Here we study how the size of these nanostructures affects their fluorescence. We compare the properties of thymine capped G-quadruplexes, formed by association of four single DNA strands d(TG3T), d(TG4T) and d(TG5T) and stabilized by K(+) ions. We show that an increase in the number of tetrads induces a narrowing of the fluorescence spectrum, an increase in the fluorescence quantum yield, a lengthening of fluorescence lifetime and a decrease of the anisotropy detected on the femtosecond time-scale. The in-plane depolarization of the fluorescence, occurring in less than 1 ps, is attributed to population of Franck-Condon exciton states and ultrafast intraband scattering, leading to energy transfer. The persistence of excitons with partial J-aggregate character on the picosecond time-scale increases with the G-quadruplex size, which enhances the stiffness of the system.

Multi-pathway excited state relaxation of adenine oligomers in aqueous solution: a joint theoretical and experimental study.

The singlet excited states of adenine oligomers, model systems widely used for the understanding of the interaction of ultraviolet radiation with DNA, are investigated by fluorescence spectroscopy and time-dependent (TD) DFT calculations. Fluorescence decays, fluorescence anisotropy decays, and time-resolved fluorescence spectra are recorded from the femtosecond to the nanosecond timescales for single strand (dA)20 in aqueous solution. These experimental observations and, in particular, the comparison of the fluorescence behavior upon UVC and UVA excitation allow the identification of various types of electronic transitions with different energy and polarization. Calculations performed for up to five stacked 9-methyladenines, taking into account the solvent, show that different excited states are responsible for the absorption in the UVC and UVA spectral domains. Independently of the number of bases, bright excitons may evolve toward two types of excited dimers having π-π* or charge-transfer character, each one distinguished by its own geometry and spectroscopic signature. According to the picture arising from the joint experimental and theoretical investigation, UVC-induced fluorescence contains contribution from 1) exciton states with a different degree of localization, decaying within a few ps, 2) "neutral" excited dimers decaying on the sub-nanosecond timescale, being the dominant species, and 3) charge-transfer states decaying on the nanosecond timescale. The majority of the photons emitted upon UVA excitation are related to charge-transfer states.

Unravelling molecular mechanisms in the fluorescence spectra of doxorubicin in aqueous solution by femtosecond fluorescence spectroscopy.

Doxorubicin (DOX) is a potent anti-tumoral agent widely used for cancer therapy. Despite numerous studies, the fluorescence properties of DOX, usually exploited for the characterization of the interaction with biological media, have until now led to controversial interpretations, mainly due to self-association of the drug in aqueous solution. We present here the first femtosecond study of DOX based on measurements with the fluorescence up-conversion technique in combination with time-correlated single photon counting using the same laser source. We provide evidence that fluorescence signals of DOX stem from monomers and dimers. DOX dimerization induces a dramatic decrease in the fluorescence quantum yield from 3.9 × 10(-2) to 10(-5) associated with the red shift of the fluorescence spectrum by ~25 nm. While the fluorescence lifetime of the monomer is 1 ns, the dimer fluorescence is found to decay with a lifetime of about 2 ps. In contrast to monomers, the fluorescence anisotropy of dimers is found to be negative. These experimental observations are consistent with an ultrafast internal conversion (<200 fs) between two exciton states, possibly followed by a charge separation process.

Base pairing enhances fluorescence and favors cyclobutane dimer formation induced upon absorption of UVA radiation by DNA.

The photochemical properties of the DNA duplex (dA)(20)·(dT)(20) are compared with those of the parent single strands. It is shown that base pairing increases the probability of absorbing UVA photons, probably due to the formation of charge-transfer states. UVA excitation induces fluorescence peaking at ∼420 nm and decaying on the nanosecond time scale. The fluorescence quantum yield, the fluorescence lifetime, and the quantum yield for cyclobutane dimer formation increase upon base pairing. Such behavior contrasts with that of the UVC-induced processes.

The design, synthesis and photochemical study of a biomimetic cyclodextrin model of photoactive yellow protein (PYP).

The design, synthesis and study of the photophysical and photochemical properties of the first biomimetic cyclodextrin (CD) model of photoactive yellow protein (PYP) are described. This model bears a deprotonated trans-p-coumaric acid chromophore, covalently linked via a cysteine moiety to a permethylated 6-monoamino ß-CD. NMR and UV/Visible spectroscopy studies showed the formation of strong self-inclusion complexes in water at basic pH. Steady-state photolysis demonstrated that, unlike the free chromophore in solution, excitation of the model molecule leads to the formation of a photoproduct identified as the cis isomer by NMR spectroscopy. These observations provide evidence that the restricted CD cavity offers a promising framework for the design of biomimetic models of the PYP hydrophobic pocket.

Primary photodynamics of a biomimetic model of photoactive yellow protein (PYP).

The present work aims at characterizing the photophysical behavior of a first biomimetic cyclodextrin model (CD-PYP1) of the photoactive site of photoactive yellow protein (PYP). The hydrophobic cyclodextrin cavity in which the chromophore self-includes, mimics its local environment within the protein. The photoinduced behavior of deprotonated CD-PYP1 (dp-CD-PYP1) has been probed by femtosecond transient-absorption spectroscopy and compared to those of the free deprotonated chromophore (pCT(-)) and of wild-type PYP. The excited-state deactivation of dp-CD-PYP1 is found to be non-exponential, with slower time components and higher quantum yield of fluorescence than pCT(-). Like in PYP, the non-exponential decay is attributed to ground-state structural heterogeneities of the self-inclusion complexes. A long-lived photoproduct is observed in the transient spectra of dp-CD-PYP1 and identified as the cis isomer. The isomerization quantum yield of dp-CD-PYP1 is estimated to be about 4%, in contrast with the free chromophore in solution which does not photoisomerize at all. This demonstrates the active role of the cyclodextrin environment to promote the photoisomerization of the chromophore, as is thought to be the case for wild-type PYP. The effects of chromophore inclusion in the cyclodextrin on the photoinduced processes are rationalized within the framework of recent theoretical calculations involving two competitive deactivation channels: (i) trans to cis isomerization and (ii) rotation of the phenolate group, leading to trans ground-state recovery. Inclusion is proposed to favor isomerization by hindering the rotation of the phenolate group. Optimizing the structure of this first model in order to better reproduce the primary photoresponse of PYP thus appears very promising.

Long-lived fluorescence of homopolymeric guanine-cytosine DNA duplexes.

The fluorescence spectrum of the homopolymeric double helix poly(dG) x poly(dC) is dominated by emission decaying on the nanosecond time-scale, as previously reported for the alternating homologue poly(dGdC) x poly(dGdC). Thus, energy trapping over long periods of time is a common feature of GC duplexes which contrast with AT duplexes. The impact of such behaviour on DNA photodamage needs to be evaluated.

Ultrafast light-induced response of photoactive yellow protein chromophore analogues.

The fluorescence decays of several analogues of the photoactive yellow protein (PYP) chromophore in aqueous solution have been measured by femtosecond fluorescence up-conversion and the corresponding time-resolved fluorescence spectra have been reconstructed. The native chromophore of PYP is a thioester derivative of p-coumaric acid in its trans deprotonated form. Fluorescence kinetics are reported for a thioester phenyl analogue and for two analogues where the thioester group has been changed to amide and carboxylate groups. The kinetics are compared to those we previously reported for the analogues bearing ketone and ester groups. The fluorescence decays of the full series are found to lie in the 1-10 ps range depending on the electron-acceptor character of the substituent, in good agreement with the excited-state relaxation kinetics extracted from transient absorption measurements. Steady-state photolysis is also examined and found to depend strongly on the nature of the substituent. While it has been shown that the ultrafast light-induced response of the chromophore in PYP is controlled by the properties of the protein nanospace, the present results demonstrate that, in solution, the relaxation dynamics and pathway of the chromophore is controlled by its electron donor-acceptor structure: structures of stronger electron donor-acceptor character lead to faster decays and less photoisomerisation.

Ultrafast photoisomerization of photoactive yellow protein chromophore analogues in solution: influence of the protonation state.

We investigate solvent viscosity and polarity effects on the photoisomerization of the protonated and deprotonated forms of two analogues of the photoactive yellow protein (PYP) chromophore. These are trans-p-hydroxybenzylidene acetone and trans-p-hydroxyphenyl cinnamate, studied in solutions of different polarity and viscosity at room temperature, by means of femtosecond fluorescence up-conversion. The fluorescence lifetimes of the protonated forms are found to be barely sensitive to solvent viscosity, and to increase with increasing solvent polarity. In contrast, the fluorescence decays of the deprotonated forms are significantly slowed down in viscous media and accelerated in polar solvents. These results elucidate the dramatic influence of the protonation state of the PYP chromophore analogues on their photoinduced dynamics. The viscosity and polarity effects are, respectively, interpreted in terms of different isomerization coordinates and charge redistribution in S(1). A trans-to-cis isomerization mechanism involving mainly the ethylenic double-bond torsion and/or solvation is proposed for the anionic forms, whereas "concerted" intramolecular motions are proposed for the neutral forms.

Solvent effect on the excited-state dynamics of analogues of the photoactive yellow protein chromophore.

We previously reported that two analogues of the Photoactive Yellow Protein chromophore, trans-p-hydroxycinnamic acid (pCA(2-)) and its amide derivative (pCM-) in their deprotonated forms, undergo a trans-cis photoisomerization whereas the thioester derivative, trans-p-hydroxythiophenyl cinnamate (pCT-), does not. pCT- is also the only one to exhibit a short-lived intermediate on its excited-state deactivation pathway. We here further stress the existence of two different relaxation mechanisms for these molecules and examine the reaction coordinates involved. We looked at the effect of the solvent properties (viscosity, polarity, solvation dynamics) on their excited-state relaxation dynamics, probed by ultrafast transient absorption spectroscopy. Sensitivity to the solvent properties is found to be larger for pCT- than for pCA(2-) and pCM-. This difference is considered to reveal that either the relaxation pathway or the reaction coordinate is different for these two classes of analogues. It is also found to be correlated to the electron donor-acceptor character of the molecule. We attribute the excited-state deactivation of analogues bearing a weaker acceptor group, pCA(2-) and pCM-, to a stilbene-like photoisomerization mechanism with the concerted rotation of the ethylenic bond and one adjacent single bond. For pCT-, which contains a stronger acceptor group, we consider a photoisomerization mechanism mainly involving the single torsion of the ethylenic bond. The excited-state deactivation of pCT- would lead to the formation of a ground-state intermediate at the "perp" geometry, which would return to the initial trans conformation without net isomerization.

Early molecular events in the photoactive yellow protein: role of the chromophore photophysics.

We report a comparative study of the isomerization reaction in native and denatured photoactive yellow protein (PYP) and in various chromophore analogues in their trans deprotonated form. The excited-state relaxation dynamics was followed by subpicosecond transient absorption and gain spectroscopy. The free p-hydroxycinnamate (pCA(2-)) and its amide analogue (pCM(-)) are found to display a quite different transient spectroscopy from that of PYP. The excited-state deactivation leads to the formation of the ground-state cis isomer without any detectable intermediate with a mechanism comparable to trans-stilbene photoisomerization. On the contrary, the early stage of the excited-state deactivation of the free thiophenyl-p-hydroxycinnamate (pCT(-)) and of the denatured PYP is similar to that of the native protein. It involves the formation of an intermediate absorbing in the spectral region located between the bleaching and gain bands in less than 2 ps. However, in these two cases, the formation of the cis isomer has not been proved yet. This difference with pCA(-) and pCM(-) might result from the fact that, in the thioester substituted chromophore, simultaneous population of two quasi-degenerate excited states occurs upon excitation. This comparative study highlights the determining role of the chromophore structure and of its intrinsic properties in the primary molecular events in native PYP.

Reversible bulk photorelease of strontium ion from a crown ether-linked merocyanine.

The use of a crown-ether-linked merocyanine, DCM-crown, for producing photoinduced, long-lived and reversible concentration jumps of metal cations is reexamined. In this new investigation, the excited-state behavior of DCM-crown complexed with a strontium ion in acetonitrile is found to exhibit the same trends as those previously reported with calcium and lithium ions. However, some new features provide evidence for cation photorelease to the bulk. Subpicosecond transient absorption experiments confirm the initial fast photodisruption of the interaction between the ion and the crown, and the formation of a loose complex after intramolecular charge transfer within the chromophore. Two additional steps are observed. Firstly, a continuous red shift of the gain spectrum is seen on the subnanosecond scale. It is assigned to the movement of the Sr2+ cation away from the chromophore, partly to the bulk of the solvent and partly towards the formation of an ultraloose complex with oxygen atoms of the crown. Secondly, a free-ligand-like absorption remains after the complete decay of the excited state. This band, which signals a total photorelease of the Sr2+ ion, disappears with a characteristic time of about 110 ns, attributed to the recomplexation of the crown in the ground state of the dye.