[Acanthamoeba keratitis]. / Kératites amibiennes.

Early diagnosis and appropriate therapy are key elements for a good prognosis in Acanthamoeba keratitis (AK). AK should be considered in any case of corneal trauma complicated by exposure to soil or contaminated water, and in all contact lens (CL) wearers. A presumptive diagnosis of AK can be made clinically and with in vivo confocal microscopy, although a definitive diagnosis requires identification of Acanthamoeba on direct scraping, histology, or identification of Acanthamoeba DNA by polymerase chain reaction (PCR). We use cysticidal drugs for treating AK because encysted forms are more resistant than trophozoites to treatment. The treatment protocol used a biguanide (PHMB 0.02% or chlorhexidine 0.02%) and a diamidine (propamidine 0.1% or hexamidine 0.1%). New diagnostic modalities and more specific topical anti-amoebic treatments would substantially benefit patients with AK.

[Rational approach for the treatment of postoperative endophthalmitis in impoverished populations]. / Approche rationnelle pour le traitement des endophtalmies post-chirurgicales des populations vivant dans des conditions de pauvreté

Due to the need for treatment guidelines for endophthalmitis in impoverished areas, we have formulated an approach which takes into account pharmacokinetic data, keeping in mind that, whether oral or intramuscular, antibiotics must achieve therapeutic intraocular levels, antibiotic susceptibility of the most common pathogens in endophthalmitis, and routine availability of bioequivalent generics in the areas in question. In this work, we present the basic guidelines for the management of postoperative endophthalmitis by ophthalmology services in impoverished areas.

Prognostic factors associated with the need for surgical treatments in acanthamoeba keratitis.

PURPOSE: The objective of this study was to assess the factors associated with anatomical and visual outcomes in patients presenting with Acanthamoeba keratitis (AK). METHODS: This is a retrospective noncomparative interventional case series study comprising 44 eyes from 42 patients presenting with AK, treated with topical hexamidine diisethionate and topical polyhexamethylene biguanide, monitored between 2004 and 2008. AK was confirmed by polymerase chain reaction or direct microscopic examination. Correlation between clinical presentation and prognosis was assessed. Anatomical outcome was assessed according to the percentage of eyes requiring at least 1 surgical procedure in addition to topical treatment. Visual outcome was assessed by the best-corrected visual acuity at the end of follow-up. RESULTS: Polymerase chain reaction results were positive for Acanthamoeba in 40 of the 44 eyes (91%) and in 16 of the 44 eyes (36%) by direct microscopic examination. Confocal microscopy suggested the presence of Acanthamoeba in 12 of 19 eyes (63%). Amniotic membrane transplantation was performed in 8 eyes, penetrating keratoplasty in 4 eyes, and evisceration in 2 eyes. The average follow-up time was 10 months. Surgical treatment was significantly associated (P < 0.05) with time from symptom onset to diagnosis of >30 days, an initial visual acuity of ≤20/200, an infiltrate size of >3 mm, preperforating infiltrates, and corneal neovascularization. The average final visual acuity was 20/48 in eyes that did not require surgical treatment (n = 34) and 20/1702 in eyes that required at least 1 surgical procedure (n = 10; P < 0.0001). CONCLUSIONS: Late diagnosis, low initial visual acuity, corneal neovascularization, large infiltrates, and preperforated infiltrates were associated with surgical treatment in patients presenting with AK. Surgical intervention was associated with worse visual outcome.

The efficacy of voriconazole in 24 ocular Fusarium infections.

PURPOSE: We examined, retrospectively, the efficacy of voriconazole in Fusarium eye infections. METHODS: Voriconazole-treated patients with proven or probable keratitis or endophthalmitis from the voriconazole database (9 patients) and six French ophthalmology departments (15 patients) were included. Sociodemographic features, predisposing factors, history of corneal trauma, associated ocular conditions, other diseases and prior therapies were analysed. Investigator-determined success was defined as infection resolution with medical treatment. Failure was no response or persistent infection and required surgery. RESULTS: Most patients were Caucasian (83 %) and male (71 %). The infection was keratitis (63 %) or endophthalmitis (37 %) and proven in 23 (96 %). Prior therapy included topical and/or systemic amphotericin (46 %), fluconazole (17 %) or others (33 %), often in combination. Causative fungi were Fusarium solani (14, 58 %), Fusarium moniliforme (1), Fusarium oxysporum (1) and Fusarium spp. (8). Voriconazole was administered systemically, topically and/or by intraocular injection, and 16 patients (67 %) received salvage and eight primary therapy. The overall response was 67 % (73 % keratitis and 56 % endophthalmitis) but seven patients required adjunctive surgery. However, response was 63 % for eight primary therapy patients and 69 % for 16 salvage therapy patients. Response by species was Fusarium solani 64 % (9/14) and all others 80 % (8/10). In 13 patients (77 %), voriconazole was used in combination (response 69 vs. 64 % alone) with topical [amphotericin B 10/24 (42 %), caspofungin 5 (21 %), natamycin 1 (4 %)] and systemic agents [caspofungin 3 (13 %), amphotericin 2 (8 %)]. CONCLUSIONS: Topical and systemic voriconazole appears to be effective alone or in combination with other agents for treating severe Fusarium keratitis or endophthalmitis.

[Fungal keratitis caused by Cylindrocarpon lichenicola]. / Kératite fongique à Cylindrocarpon lichenicola.

We report a case of a 67-year-old woman with no significant past ocular history, who was referred for management of an unresponsive microbial keratitis resulting from trauma with a piece of clothing fabric 1 month previously in Portugal and worsening despite topical fortified antibiotics. On examination, visual acuity was limited to "light perception". Slit lamp examination revealed an 11×11mm full-thickness corneal infiltrate. Confocal images showed branching hyphae suggestive of a fungal infection. Fungal cultures of corneal scrapings revealed growth of Cylindrocarpon lichenicola, a saprophytic, filamentous fungus, which is an unusual cause of keratitis. Despite aggressive antifungal therapy with voriconazole and amphotericin B, she required penetrating keratoplasty for impending corneal perforation. Follow-up was uneventful, with no recurrence at 1 year. Fungal infections must be suspected in all corneal ulcers of traumatic etiology. Specific cultures and confocal microscopy must be performed early, so as to enable early treatment modification.

[Clinical, microbiological and therapeutic features of severe bacterial keratitis]. / Caractéristiques cliniques, microbiologiques et thérapeutiques d'une série de 111 kératites bactériennes sévères.

PURPOSE: To analyze risk factors and prognosis factors of severe bacterial keratitis. METHODS: Retrospective study of 111 eyes from 105 patients hospitalized from 2005 to 2006 for bacterial keratitis proven by microbiological assessment or suspected (favorable outcome after antibiotic treatment). RESULTS: The main risk factors were contact lens wear (39.6%), ocular surface diseases (36.9%), a history of ocular surgery (27.9%), and ocular trauma (11.7%). Gram-positive cocci were found in 46.8% of cases, Gram-negative bacilli in 19.8%, Gram-positive bacilli in 7.2%, Gram-negative cocci in 2.7%, and Gram-negative coccobacilli in 0.9%. No infectious agents were found in 22.5% of the cases. Two or more bacteria were found in 25.6%. The mean follow-up time was 6.5 months. Resolution of infection was obtained in 77.5% with only medical treatment and in 99.1% with further surgical treatment. Amniotic membrane transplantation was performed in 16.2% and emergency keratoplasty in 8.1%. The mean LogMAR visual acuity was 1.43 initially and 0.84 at the last examination. The final visual acuity was 1.03 for Gram-positive and 0.35 for Gram-negative organisms (p=0.03). CONCLUSION: Bacterial keratitis is a sight-threatening infection. Gram-positive keratitis is more frequent, except for contact lens wearers, and is also more severe.

Human epithelial cell cultures from superficial limbal explants.

PURPOSE: To study the kinetics of growth and the phenotype of cells cultured from human limbal explants in a cholera toxin-free medium with no feeder cell layer. METHODS: Human organ-cultured corneas were used to prepare limbal explants (full-thickness and superficial limbal explants) and corneal stromal explants. Cell growth kinetics and phenotypes were assessed by cultivating explants in cholera toxin-free Green medium. Epithelial and progenitor cell markers were assessed by immunocytochemistry, flow cytometry, and Reverse Transcription and Polymerase Chain Reaction (RT-PCR). RESULTS: The successful epithelial cell growth rates from full thickness limbal explant and superficial limbal explant tissues were 41 and 86%, respectively (p=0.0001). The mean cell area and the percentage of small cells in superficial and full-thickness explant cultures were, respectively, 317 µm(2) and 429 µm(2), and 8.9% and 1.7% (p<0.001). The percentage of positive cells in superficial and full-thickness limbal explant cultures as assessed by immunocytochemistry were the following: broad spectrum cytokeratins (cytokeratins 4, 5, 6, 8, 10, 13, and 18 [MNF116]), 82%/37% (p=0.01); cytokeratin 3 (CK3), 74%/25% (p=0.009); cytokeratin 19 (CK19), 46%/25% (p=0.19); vimentin, 56%/53% (p=0.48); delta N p63α, 54%/0% (p<0.001); and ABCG2, 5%/0% (p=0.1). Flow cytometry showed a higher percentage of small cells, a higher percentage of MNF116+ cells, and stronger expression of progenitor-associated markers in superficial than in full-thickness explant cultures. For superficial limbal explant cultures, analysis of the expression profiles for various mRNAs at the end of 21 days of culture showed high levels of expression of the mRNAs encoding CK3, vimentin, and CK19. The expression of mRNA of delta N p63α and ABCG2 was weaker. Cultures obtained from full-thickness limbal explants featured no expression of mRNA of CK19, delta N p63α, and ABCG2, whereas mRNAs encoding CK3 and vimentin were detected. Human corneal stromal explants cultured with the same medium featured late cell growth, large mean cell area (2,529 µm(2)), no expression of cytokeratins, delta N p63α, and ABCG2, and high expression of vimentin. CONCLUSIONS: Superficial limbal explants appear to be superior to full-thickness limbal explants for growing human limbal epithelial cells. Preparation of explants using surgical facilities (i.e., operating microscope and microsurgical blades) led to a dramatic increase in the percentage of successful cultures, higher epithelial cell growth, decreased fibroblast contamination, and better preservation of limbal epithelial progenitors.

[Fusobacterium nucleatum isolated from a patient presenting lachrymal canaliculitis]. / Fusobacterium nucleatum isolé chez un patient présentant une canaliculite.

A 68-year-old woman presented with a painless inflammation of the right superior eyelid that had started several weeks before. The clinical diagnosis concluded in canaliculitis and the solid concretions were surgically extracted from the superior canalicula. The anaerobic bacteria Fusobacterium nucleatum sp. nucleatum was isolated. Signs dramatically regressed two weeks after surgery followed by one course of oral amoxicillin and clavulanic acid associated with topical tobramycin. The clinical signs had disappeared two months later.

[New ultra rapid test for detection of bacteria]. / Nouveau test ultrarapide pour la détection de bactéries.

INTRODUCTION: Bacteriological testing is aimed to reduce the risk of transmission of infections. However, the detection of Bacteria by culture requires from 18hours to 14 days and may produce erroneous results for fastidious species. The goal of this work was to design and validate a new tool for bacterial testing. METHODS: The test is based on the fast real-time PCR (frt PCR). The DNA extracted from samples containing internal controls are introduced into four tubes containing primers and probes for the frt PCR. The cycling program consists in 1×at 95°C for 10min and 45×(15s at 95°C, 8s) at 52°C and 10s at 72°C. RESULTS: The frt PCR detects 0,01 CFU/µl of Bacteria and identifies eight Genera without interferences from the environment or from fungi and with no need for melting curve analysis or additional sequencing. DISCUSSION: The frt PCR detects and quantifies Bacteria identifying and assessing the load of Staphylococci, Streptococci, Haemophilus, Pseudomonas, Enterobacteria, Acinetobacter, Propionibacteriacae and Corynebacteria. CONCLUSION: Cultures require at least 24hours but the new frt PCR reduces the time to 90minutes. Larger series of samples are necessary to confirm the usefulness of this new test for routine bacterial sterility controls.

[In vivo confocal microscopy: a new tool for the diagnosis of Acanthamoeba keratitis]. / Apport de la microscopie confocale in vivo au diagnostic des kératites amibiennes.

PURPOSE: To study the usefulness of in vivo confocal microscopy imaging for the diagnosis of Acanthamoeba keratitis. METHODS: A retrospective review of 50 cases of Acanthamoeba keratitis followed at the Quinze-Vingts National Ophthalmology Hospital from January 2005 to July 2008 was conducted. Gender, age, contact lens wear, best-corrected visual acuity before and after treatment, slit-lamp examination findings, corneal scrapings for biological analysis, and in vivo confocal microscopy images were analyzed. RESULTS: Nearly 82% of the cases of keratitis had a history of contact lens wear. Polymerase chain reaction (PCR) was positive for 40% of the samples. Heidelberg Retinal Tomograph II-Rostock Cornea Module (HRTII-RCM) examination detected images evoking Acanthamoeba cyst-like images in 84% of the cases. When the quality of biological samples was inadequate, the assessment of Acanthamoeba cysts using in vivo confocal microscopy made it possible to orient the diagnosis and to partially explain favorable progression under treatment. This technique showed images suggesting combined Acanthamoeba and fungal keratitis. CONCLUSION: HRTII-RCM in vivo confocal microscopy is a non invasive and rapid technique that may be helpful for the diagnosis of Acanthamoeba keratitis, especially when laboratory testing is not contributive and when Acanthamoeba keratitis is combined with a fungal infection.

New tool for the simultaneous detection of 10 different genotypes of Acanthamoeba available from the American Type Culture Collection.

BACKGROUND: Acanthamoeba keratitis (AK) is a sight-threatening infection, and none of the current diagnosis tests are able to detect in one reaction low levels of the vast majority of strains associated with pathology. The goal of this work was to validate a new tool for the detection of the American Type Cell Collection (ATCC) referenced Acanthamoeba monitoring simultaneously DNA extraction yields and PCR inhibitors. Performances were assessed on corneal scrapings. METHODS: Primers were selected in a region bracketing a 41 591 bp of the A castellanii mitochondrion gene. DNA extraction and PCR inhibitors were monitored by adding an internal control (virus). Acanthamoeba were detected and quantified by the real-time fast-duplex TaqMan PCR (f-d-real-t PCR) and negativity confirmed by SYBR Green real-time PCR. RESULTS: The f-d-real-t PCR detects 0.1 cyst/microl or less of the 10 referenced strains (sensitivity slightly lower for A astronyxis). Bacteria, fungi and herpesviruses do not cross-react. The specificity and sensitivity of the f-d-real-t PCR were higher than culture and other real-time PCR on 20 keratitis samples. CONCLUSION: The f-d-real t PCR detects in less than 2 h the Acanthamoeba strains available from the ATCC with a higher sensitivity and specificity than techniques previously reported. Larger trials are necessary to validate its usefulness for disease management and environmental studies.

New test for the diagnosis of bacterial endophthalmitis.

BACKGROUND: Diagnosis of bacterial endophthalmitis (BE) often fails due to: (1) insufficient volumes of vitreous fluid (VF) and aqueous humour (AH); (2) lack of sensitivity of culture; (3) antibiotic treatments; (4) polymerase chain reaction (PCR) cross-contamination; and (5) limitations on the interpretation of the real-time PCR melting curve. We developed a fast real-time (f-real-t) PCR to improve the performance of the laboratory diagnosis of BE. METHODS: The following samples were processed after adding an internal control: phosphate buffered saline (PBS); VF, AH and cell suspensions spiked with Bacteria (Bac); VF and AH from patients with endophthalmitis; and VF and AH from non-infective patients. DNA was extracted (MagNA Pure) and added to four tubes containing selected primers and probes for the identification and quantification of all Bac and eight genera by f-real-t PCR. Diagnostic performances based on direct microscopic examination, culture and f-real-t PCR were compared. RESULTS: The f-real-t PCR detected at least 0.01 colony-forming units (CFU) of Bac/microl with no cross-reactivity with fungi. Correlation with culture-positive results was 100%. Sixty per cent of BE samples tested culture-positive, but f-real-t PCR tested positive for 90%. Samples from non-infective cases were negative. CONCLUSION: The f-real-t PCR detected and quantified Bac, Staphylococci, Streptococci, Haemophilus, Pseudomonas, Enterobacteria, Acinetobacter, Propionibacteriacae and Corynebacteria in one run. Cultures required several hours to days (with a non-negligible number of false-negative results) and the f-real-t PCR was completed in 90 min. The f-real-t PCR is presented as a new tool for the diagnosis of BE: its usefulness requires validation with larger series of samples.

Rapid detection and quantification of Propionibacteriaceae.

BACKGROUND: Propionibacteriaceae (Propioni) are anaerobic bacteria associated with human and animal infections. Present-day methods of diagnosis for Propioni are unsatisfactory due to a lack of sensitivity of culture, time required for culture results (3 to 14 days) and difficulties in interpreting SYBR Green real-time PCR results. The goal of this work was to validate a new rapid and sensitive test for the diagnosis of Propioni infections (endophthalmitis, corneal ulcers and others). MATERIAL AND METHODS: DNA was extracted using the MagNA Pure isolation kit (Roche), and bacterial detection and quantification were carried out with a set of original primers and probe (5'ATACGTAGGGTGCGAGCGTTGTCC; 5'TGGTGTTCCTCCTGATATCTGCGC and [Amino C6+JOE]-GATCGCGTCGGAAGTGTAATCTTGGGG-Black Hole Quencher). The PCR cycling programme consisted of one cycle at 95 degrees C, 20 s and 45 cycles at 95 degrees C, 3 s and 30 s at 60 degrees C. DNA extraction yields were assessed in the same tube. RESULTS: This test detects as few as 0.01 Equivalent PFU/microl Propioni in phosphate-buffered saline (PBS), aqueous humour, vitreous or cell suspensions. Propioni is detected as a single contaminant or mixed with other bacteria, fungi or human cells. CONCLUSION: The new real-time PCR is able to detect 0.01 Eq/CFU microl of Propioni suspended in PBS, vitreous, aqueous humour and human cells in less than 1.30 h.

Severe ocular infections with contact lens: role of multipurpose solutions.

PURPOSE: To determine whether multipurpose solutions, widely used for contact lens disinfections, could be at the origin of ocular pathologies (contact lens intolerance and ocular infections). METHODS: An observational cohort study (questionnaire analysis) was carried out to estimate the number of contact lens wearers, type of infection, and type of lens care regimen used by patients. Besides, multipurpose solutions cytotoxicity (necrosis and apoptosis) was evaluated on a conjunctival cell line using cytofluorometry. RESULTS: In the general population, 59% of contact lens wearers use multipurpose solutions whereas 35% use oxidative products. Of the questioned contact lens wearers with ocular infections, 80% used multipurpose solutions. Multipurpose solutions are therefore not efficient enough against microorganisms, and cannot be considered as disinfectant solutions but only as preservatives. However, preservatives are known to be toxic to ocular surface, so apoptosis induced by multipurpose solutions could lead to ocular surface diseases. Our cytofluorometry study allowed us to demonstrate that contact lens multipurpose solutions containing preservatives are cytotoxic through caspase 3 induction, chromatin condensation and P2X7 cell-death receptor activation, in contrast with unpreserved sterile saline solutions that were found inert. CONCLUSIONS: Multipurpose solutions seem to be preservative but not disinfecting solutions. They are not adapted to the final rinse of contact lenses because of apoptosis induction. It could explain part of lens intolerance.

Microbiological efficacy of 3-day treatment with azithromycin 1.5% eye-drops for purulent bacterial conjunctivitis.

PURPOSE: Antibacterial efficacy of topically applied azithromycin 1.5% was compared with tobramycin 0.3% in a multicenter, randomized, investigator-masked study for the treatment of purulent bacterial conjunctivitis. METHODS: A total of 1043 adults and children received either azithromycin twice daily for 3 days (n=524) or tobramycin every 2 hours while awake for 2 days, then four times daily for 5 days (n=519). Conjunctival swabbing was taken at days 0, 3, and 9, using alginate swabs resuspended in a dissolution-transport medium, providing rapid and reproducible results. Cagle's criteria were used to define the pathogenicity level for each isolated bacterium. RESULTS: In the per-protocol set, the rate of bacteriologic resolution was 85.2% for azithromycin versus 83.8% for tobramycin on day 3, and 92.8% for azithromycin versus 94.6% for tobramycin on day 9. Azithromycin was demonstrated to be noninferior to tobramycin according to the 10% noninferiority margin. Although some bacteria were categorized as resistant to tested antibiotics, eradication was observed (for azithromycin: Acinetobacter, Enterobacteriaceae, Pseudomonas), highlighting the specific pharmacokinetics/pharmacodynamics of the ocular route. CONCLUSIONS: In total, topical therapy with azithromycin 1.5% administered only twice daily for 3 days effectively eradicates most pathogenic bacteria associated with bacterial conjunctivitis. These microbiologic results are in accordance with the observed clinical outcome. This new anti-infective product has the advantage of a short treatment course which could lead to an improvement in patient compliance.

The genotypic characterisation of Acanthamoeba isolates from human ocular samples.

BACKGROUND: We characterised 37 amoebae cultured from corneal scrapings, contact lenses or lens case solutions of patients with suspected Acanthamoeba keratitis. METHODS: The isolates were identified by their morphology and by PCR targeting the Acanthamoeba nuclear small-subunit rRNA gene. Acanthamoeba isolates were genotyped by DNA sequence analysis. RESULTS: The 37 isolates comprised 35 Acanthamoeba, one Hartmannella and one Vahlkampfia. Ten Acanthamoeba isolates were shown to be responsible for keratitis. CONCLUSION: Genotype T4 was the only Acanthamoeba genotype responsible for keratitis in this study, and represented 79% of non-pathogenic isolates.

[Usefulness of voriconazole in treatment of Phoma glomerata after penetrating injury]. / Endophtalmie à Phoma glomerata après plaie du globe et efficacité du traitement par voriconazole en intravitréen.

We report the first case of endophthalmitis caused by Phoma glomerata. A 32-year-old man who underwent retinal detachment surgery consecutive to a penetrating globe injury presented with endophthalmitis 7 days after surgery. Anterior chamber tap and intravitreal injection of antibiotics (ceftazidime and vancomycin) were performed systematically. Fungus was observed at microscopic examination of the aqueous humor and treatment with intravitreal injection of amphotericin B was decided. The patient failed to improve with intravitreal amphotericin B but responded clinically to intravitreal voriconazole. The fungus was identified after culture as Phoma glomerata. The MIC for amphotericin B was 1microg/ml, for caspofungin was 2microg/ml, and for itraconazole was 8microg/ml or more. The MIC for voriconazole was up to 8microg/ml. The clinical response after intravitreal injection may be related to the high concentrations reached in the vitreous. Because of severity and ominous prognosis of intraocular fungal infections and posttraumatic Phoma ocular infections, aggressive management is required by intravitreal voriconazole administration.

Resistance of Acanthamoeba to classic DNA extraction methods used for the diagnosis of corneal infections.

AIMS: Sensitive diagnosis of Acanthamoeba infections may prevent the clinical condition from becoming worse. In order to improve the diagnosis tool performances, we studied the implication of the DNA extraction procedures on the detection of Acanthamoeba by real-time PCR. METHODS: Acanthamoeba cysts mixed with a tag virus were processed according to different DNA preparation procedures: heat, Proteinase K (ProtK), alkali lysis, QIAmp kit, MagNA Pure (DNA Mini kit, MagNA Pure Nucleic Acid isolation kit), ProtK+QIAmp and ProtK+MagNA Pure. Parasite-DNA loads were assessed by real-time PCR. RESULTS: The results show that the structures of Acanthamoeba cysts are resistant to reagents releasing the DNA from other cells and viruses. Heat, NaOH or ProtK did not allow the DNA extraction yields to be assessed or the inhibitors to be eliminated The QIAmp and the MagNA Pure partially improved the sensitivity of the PCR and eliminated the inhibitors. A significant increase in positive results was obtained with a ProtK treatment before commercial extraction kits. ProtK+MagNA Pure yielded the highest rates of positivity. CONCLUSION: To minimise false negative results, the nucleic-acid based Acanthamoeba diagnosis requires, first, the efficient lysis of cysts (without affecting the DNA) to make the DNA available for extraction and amplification, and, second, the elimination of PCR inhibitors. A significant increase in the detection rates is obtained by adding a ProtK treatment (10 min at 56 degrees C) before the commercial procedures. ProtK+MagNA Pure yielded the best results in 30 min, followed by ProtK+QIAmp (150 min).