Visual typing detection of brucellosis with a lateral flow immunoassay based on coloured latex microspheres.

AIMS: Treatment and preventive control strategies for Brucella melitensis (B. melitensis) and Brucella abortus (B. abortus) infection differ. A lateral flow immunoassay (LFIA) for the rapid typing and detection of brucellosis by using polychromatic dye-doped latex microspheres (LMs) as a labelling material was developed. METHODS AND RESULTS: This LFIA utilizes a double-antigen sandwich method in which the BP26 protein is used as the diagnostic antigen to detect brucellosis infection and the OMP31 protein is used as the identified antigen to distinguish between bovine and sheep brucellosis. Thus, people and animals infected with brucellosis can be diagnosed according to the different colours of the signals displayed on the detection lines. The results indicated that the accuracy of this assay was found to reach 98%, and the immunochromatographic test strip is highly accurate, shows good sensitivity and can facilitate typing diagnosis, among other features. CONCLUSIONS: The established LFIA can distinguish B. melitensis infection from B. abortus infection and produces results in a short period of time while retaining the advantages of LFIAs. SIGNIFICANCE AND IMPACT OF THE STUDY: This technology lays a foundation for the development of multi-disease test strips and the establishment of methods for rapid, multi-specimen quantitative detection and is thus of great importance for the development of medical diagnostic technologies.

Rapid and Sensitive Detection of Salmonella in Chickens Using Loop-Mediated Isothermal Amplification Combined with a Lateral Flow Dipstick.

Salmonellosis is a highly contagious bacterial disease that threatens both human and poultry health. Tests that can detect Salmonella in the field are urgently required to facilitate disease control and for epidemiological investigations. Here, we combined loop-mediated isothermal amplification (LAMP) with a chromatographic lateral flow dipstick (LFD) to rapidly and accurately detect Salmonella. LAMP primers were designed to target the Salmonella invA gene. LAMP conditions were optimized by adjusting the ratio of inner to outer primers, MgSO4 concentration, dNTP mix concentration, amplification temperature, and amplification time. We evaluated the specificity of our novel LAMP-LFD method using six Salmonella species and six related non-Salmonella strains. All six of the Salmonella strains, but none of the non-Salmonella strains, were amplified. LAMP-LFD was sensitive enough to detect concentrations of Salmonella enterica subsp. enterica serovar Pullorum genomic DNA as low as 89 fg/µl, which is 1,000 times more sensitive than conventional PCR. When artificially contaminated feed samples were analyzed, LAMP-LFD was also more sensitive than PCR. Finally, LAMP-LFD gave no false positives across 350 chicken anal swabs. Therefore, our novel LAMP-LFD assay was highly sensitive, specific, convenient, and fast, making it a valuable tool for the early diagnosis and monitoring of Salmonella infection in chickens.

Sequencing of complete mitochondrial genomes confirms synonymization of Hyalomma asiaticum asiaticum and kozlovi, and advances phylogenetic hypotheses for the Ixodidae.

Phylogeny of hard ticks (Ixodidae) remains unresolved. Mitochondrial genomes (mitogenomes) are increasingly used to resolve phylogenetic controversies, but remain unavailable for the entire large Hyalomma genus. Hyalomma asiaticum is a parasitic tick distributed throughout the Asia. As a result of great morphological variability, two subspecies have been recognised historically; until a morphological data-based synonymization was proposed. However, this hypothesis was never tested using molecular data. Therefore, objectives of this study were to: 1. sequence the first Hyalomma mitogenome; 2. scrutinise the proposed synonymization using molecular data, i.e. complete mitogenomes of both subspecies: H. a. asiaticum and kozlovi; 3. conduct phylogenomic and comparative analyses of all available Ixodidae mitogenomes. Results corroborate the proposed synonymization: the two mitogenomes are almost identical (99.6%). Genomic features of both mitogenomes are standard for Metastriata; which includes the presence of two control regions and all three "Tick-Box" motifs. Gene order and strand distribution are perfectly conserved for the entire Metastriata group. Suspecting compositional biases, we conducted phylogenetic analyses (29 almost complete mitogenomes) using homogeneous and heterogeneous (CAT) models of substitution. The results were congruent, apart from the deep-level topology of prostriate ticks (Ixodes): the homogeneous model produced a monophyletic Ixodes, but the CAT model produced a paraphyletic Ixodes (and thereby Prostriata), divided into Australasian and non-Australasian clades. This topology implies that all metastriate ticks have evolved from the ancestor of the non-Australian branch of prostriate ticks. Metastriata was divided into three clades: 1. Amblyomminae and Rhipicephalinae (Rhipicephalus, Hyalomma, Dermacentor); 2. Haemaphysalinae and Bothriocrotoninae, plus Amblyomma sphenodonti; 3. Amblyomma elaphense, basal to all Metastriata. We conclude that mitogenomes have the potential to resolve the long-standing debate about the evolutionary history of ticks, but heterogeneous evolutionary models should be used to alleviate the effects of compositional heterogeneity on deep-level relationships.

Expression profiles of circular RNAs in sheep skeletal muscle.

OBJECTIVE: Circular RNAs (circRNAs) are a newfound class of non-coding RNA in animals and plants. Recent studies have revealed that circRNAs play important roles in cell proliferation, differentiation, autophagy and apoptosis during development. However, there are few reports about muscle development-related circRNAs in livestock. METHODS: RNA sequencing analysis was employed to identify and annotate circRNAs from longissimus dorsi of sheep. Reverse transcription followed by real-time quantitative (q) polymerase chain reaction (PCR) analysis verified the presence of these circRNAs. Targetscan7.0 and miRanda were used to analyse the interaction of circRNA-microRNA (miRNA). To investigate the function of circRNAs, an experiment was conducted to perform enrichment analysis hosting genes of circRNAs using gene ontology (GO) and Kyoto encyclopedia of genes and genomes (KEGG) pathways. RESULTS: About 75.5 million sequences were obtained from RNA libraries of sheep skeletal muscle. These sequences were mapped to 729 genes in the sheep reference genome. We identified 886 circRNAs, including numerous circular intronic RNAs and exonic circRNAs. Reverse transcription PCR (RT-PCR) and DNA sequencing analysis confirmed the presence of several circRNAs. Real-Time RT-PCR analysis exhibited resistance of sheep circRNAs to RNase R digestion. We found that many circRNAs interacted with muscle-specific miRNAs involved in growth and development of muscle, especially circ776. The GO and KEGG enrichment analysis showed that hosting genes of circRNAs was involved in muscle cell development and signaling pathway. CONCLUSION: The study provides comprehensive expression profiles of circRNAs in sheep skeletal muscle. Our study offers a large number of circRNAs to facilitate a better understanding of their roles in muscle growth. Meanwhile, we suggested that circ776 could be analyzed in future study.

Morphological and molecular divergence of Rhipicephalus turanicus tick from Albania and China.

Rhipicephalus turanicus is an important tick species potentially carrying tick-borne pathogens. Several tick species have obvious subspecies divergence. However few studies aimed to examine the existence of divergence within R. turanicus. Therefore, a detailed morphological and molecular analysis was conducted for comparing R. turanicus from the Mediterranean Basin (represented by Albania) and Central Asia (Northwestern China). Altogether 315 adult ticks of R. turanicus (103 from Albania and 212 from China) were morphologically and molecularly analysed. DNA samples were used for mitochondrial 16S rRNA and cox1 gene sequences analysis. In addition, as potentially genetic markers, three fragments including partial nad1-16S rRNA, nad2-cox1, cox1-tRNA-Lys, were designed and then phylogenetically analyzed. Based on detailed morphological observations, only basis capituli length:width ratio (females), the length, the width and the length:width ratio of the scutum (males) had differences between R. turanicus from China and Albania. Gene divergences of 16S rRNA, cox1, partial nad1-16S rRNA, nad2-cox1 and cox1-tRNA-Lys from China and Albania ticks were 3.53-4.84, 3.57-4.92, 3.57-4.07, 3.57-4.39 and 3.18-4.69%, respectively. The evaluated five genetic markers revealed two phylogenetic branches in R. turanicus. Obvious differences exist within R. turanicus based on morphological and genetic analysis. Three newly designed genetic markers (partial nad1-16S rRNA, nad2-cox1 and cox1-tRNA-Lys) in this study may be suitable genetic tools for identification and analysis in R. turanicus. Subspecies analysis of R. turanicus from other regions of the world should be initiated in the future.

Inhibition of viral replication by small interfering RNA targeting of the foot-and-mouth disease virus receptor integrin ß6.

In animals, foot-and-mouth disease (FMD) causes symptoms such as fever, limping and the development of blister spots on the skin and mucous membranes. RNA interference (RNAi) may be a novel way of controlling the FMD virus (FMDV), specifically by targeting its cognate receptor protein integrin ß6. The present study used RNAi technology to construct and screen plasmids that expressed small interfering RNA molecules (siRNAs) specific for the integrin ß6 subunit. Expression of green fluorescence protein from the RNAi plasmids was observed following transfection into porcine embryonic fibroblast (PEF) cells, and RNAi plasmids were screened using reverse transcription-quantitative polymerase chain reaction (RT-qPCR) analysis. A fragment (5'AAAGGCCAAGTGGCAAACGGG 3') with marked interference activity was ligated into a PXL-EGFP-NEO integration plasmid and transfected into PEF cells. Transfected cells were selected using G418, and interference of the integrated plasmid was subsequently evaluated by FMDV challenge experiments, in which the levels of viral replication were determined using optical microscopy and RT-qPCR. A total of seven interference plasmids were successfully constructed, including the pGsi-Z4 plasmid, which had a significant interference efficiency of 91.7% in PEF cells (**P<0.01). Upon transfection into PEF cells for 36 h, a Z4 integration plasmid exhibited significant inhibitory effects (**P<0.01) on the integrin ß6 subunit. Subsequent challenge experiments in transfected PEF cells also demonstrated that viral replication was reduced by 24.2 and 12.8% after 24 and 36 h, respectively. These data indicate that RNAi technology may inhibit intracellular viral replication in PEF cells by reducing expression of the FMDV receptor integrin ß6.

The complete mitochondrial genome of the parasitic sheep ked Melophagus ovinus (Diptera: Hippoboscidae).

The complete mitochondrial genome (15,573 bp) of an understudied sheep parasite Melophagus ovinus was sequenced and characterized. Its organization and characteristics, including the size, structure, gene order, start/stop codon usage and gene overlaps, are largely typical for Diptera. It exhibits very high A + T bias (81%). Posterior probability values in the inferred phylogenetic dendrogram were very high, but Oestroidea and Muscoidea superfamilies were both paraphyletic. The sequence was nested within the Oestridae clade, thus also rendering the family paraphyletic. A larger number of Hippoboscoidea mitogenomes will have to be available to achieve a better phylogenetic resolution.

First report of Rickettsia raoultii and R. slovaca in Melophagus ovinus, the sheep ked.

BACKGROUND: Melophagus ovinus (Diptera: Hippoboscidae), a hematophagous ectoparasite, is mainly found in Europe, Northwestern Africa, and Asia. This wingless fly infests sheep, rabbits, and red foxes, and causes inflammation, wool loss and skin damage. Furthermore, this parasite has been shown to transmit diseases, and plays a role as a vector. Herein, we investigated the presence of various Rickettsia species in M. ovinus. METHODS: In this study, a total of 95 sheep keds were collected in Kuqa County and Alaer City southern region of Xinjiang Uygur Autonomous Region, northwestern China. First, collected sheep keds were identified on the species level using morphological keys and molecular methods based on a fragment of the 18S ribosomal DNA gene (18S rDNA). Thereafter, to assess the presence of rickettsial DNA in sheep keds, the DNA of individual samples was screened by PCR based on six Rickettsia-specific gene fragments originating from six genes: the 17-kilodalton antigen gene (17-kDa), 16S rRNA gene (rrs), surface cell antigen 4 gene (sca4), citrate synthase gene (gltA), and outer membrane protein A and B genes (ompA and ompB). The amplified products were confirmed by sequencing and BLAST analysis ( https://blast.ncbi.nlm.nih.gov/Blast.cgi?PROGRAM=blastn&PAGE_TYPE=BlastSearch&LINK_LOC=blasthome ). RESULTS: According to its morphology and results of molecular analysis, the species was identified as Melophagus ovinus, with 100% identity to M. ovinus from St. Kilda, Australia (FN666411). DNA of Rickettsia spp. were found in 12 M. ovinus samples (12.63%, 12/95). Rickettsia raoultii and R. slovaca were confirmed based on phylogenetic analysis, although the genetic markers of these two rickettsial agents amplified in this study showed molecular diversity. CONCLUSIONS: This is the first report of R. raoultii and R. slovaca DNA in M. ovinus. Rickettsia slovaca was found for the first time around the Taklimakan Desert located in China. This finding extends the geographical range of spotted fever group rickettsiae.

Emerging spotted fever group rickettsiae in ticks, northwestern China.

We report Rickettsia conorii subsp. indica, Candidatus R. barbariae and R. massiliae in Rhipicephalus turanicus from sheep around the Taklamakan desert, northwestern China. The topology of the phylogenetic trees produced from the maximum likelihood (ML) analyses of the ompA-gltA-rrs-geneD-ompB concatenated sequence data was very similar to that of the neighbor joining (NJ) tree, and with total support of 69%-100% bootstrap values for the inclusion of the rickettsiae in Rh. turanicus within the clade that contained R. conorii subsp. indica; Candidatus R. barbariae and Rickettsia sp. Tselentii; R. massiliae str. AZT80; and R. massiliae MTU5, respectively. Studies suggest that the co-existence of these spotted fever group rickettsiae is a threat to public health in China. Work is important in exploring novel and emerging pathogens.

First detection of Candidatus Rickettsia barbariae in the flea Vermipsylla alakurt from north-western China.

BACKGROUND: Vermipsylla is a genus of the family Vermipsyllidae within the order Siphonaptera of fleas. Vermipsylla alakurt is mainly distributed in alpine pastoral areas of Kazakhstan, Mongolia, China and Nepal, and infests sheep, yaks and horses, causing irritation, poor condition, anaemia and even death. However, to date, no rickettsial agents have been reported in V. alakurt. FINDINGS: A total of 133 fleas were collected directly from the tails of three sheep flocks (n = 335) in Minfeng County, Xinjiang Uygur Autonomous Region, north-western China. Of these, 55 fleas were identified by morphological examination and molecular analysis of four loci (the ribosomal 18S and 28S rDNA genes and the mitochondrial genes cytochrome  c oxidase subunit II and elongation factor 1-alpha). Eight Rickettsia-specific gene fragments originated from seven genes: the 17-kilodalton antigen gene (17-kDa), citrate synthase gene (gltA), 16S rRNA gene (rrs), outer membrane protein A gene (ompA), surface cell antigen 1 gene (sca1), PS120 protein gene (gene D), and outer membrane protein B gene (ompB, two fragments), were used to identify the species of Rickettsia in 53 fleas. The amplified products were sequenced and included in a phylogenetic analysis to verify the taxonomic identification of the rickettsial agents. Based on morphological and molecular evidence, the flea was identified as Vermipsylla alakurt. Nine samples were positive (16.98 %, 9/53) for Rickettsia spp. The phylogenetic tree revealed that the rickettsial agents found in V. alakurt cluster with Candidatus Rickettsia barbariae. CONCLUSIONS: Our study suggests that: (i) V. alakurt may serve as a carrier for Candidatus R. barbariae; and (ii) Candidatus R. barbariae, previously reported in Israel, is the eighth newly discovered validated Rickettsia species in China. This finding extends our knowledge of the distribution of Candidatus R. barbariae and the profile of carriers, which not only comprise ticks but also fleas.

The Regulatory Roles of ncRNA Rli60 in Adaptability of Listeria monocytogenes to Environmental Stress and Biofilm Formation.

Listeria monocytogenes is a facultative anaerobic Gram-positive bacterium. It is well adapted to external environments and able to infect both humans and animals. To understand the impacts of ncRNA Rli60 on the adaptability of L. monocytogenes to environmental stresses and biofilm formation, a rli60 deletion strain of L. monocytogenes (LM-Δrli60) was constructed using splicing by overlap extension PCR (SOE-PCR) and homologous recombination and then compared it with wild-type strain L. monocytogenes EGD-e in the aspects of adaptability to environmental stresses by measuring their growth under stresses of different temperatures, and acidic, alkaline, hypertonic and alcoholic conditions, and capability of biofilm formation by using crystal violet staining, as well as the transcriptional levels of genes (gltB and gltC) related to the biofilm formation by real-time quantitative PCR (qRT-PCR). The results showed that (1) the growth of LM-Δrli60 strain was significantly slower under environmental stresses of low temperature (30 °C), high temperature (42 °C), as well as alkaline and alcoholic conditions, (2) the amount of biofilm formed by LM-Δrli60 was attenuated, and (3) the transcriptional levels of gltB and gltC genes at 24 h and 48 h in LM-Δrli60 revealed a significant reduction. Overall, the results confirmed that ncRNA Rli60 plays important roles in regulating the adaptability of L. monocytogenes to environmental stresses and biofilm formation possibly through impacting the expression of gltB and gltC genes.

Up-regulation of TDAG51 is a dependent factor of LPS-induced RAW264.7 macrophages proliferation and cell cycle progression.

CONTEXT: As a component of the outer membrane in Gram-negative bacteria, lipopolysaccharide (LPS)-induced proliferation and cell cycle progression of monocytes/macrophages. It has been suggested that the proapoptotic T-cell death-associated gene 51 (TDAG51) might be associated with cell proliferation and cell cycle progression; however, its role in the interaction between LPS and macrophages remains unclear. OBJECTIVE: We attempted to elucidate the role(s) of TDAG51 played in the interaction between LPS and macrophages. MATERIALS AND METHODS: We investigated TDAG51 expression in RAW264.7 cells stimulated with LPS and examined the effects of RNA interference-mediated TDAG51 down-regulation. We used CCK-8 assay and flow cytometry analysis to evaluate the interaction between TDAG51 and LPS-induced proliferation and cell cycle progression in RAW264.7 cells. RESULTS: Our findings indicate that TDAG51 is up-regulated in LPS-stimulated RAW264.7 cells, the TDAG51 siRNA effectively reduced TDAG51 protein up-regulation following LPS stimulation in RAW264.7 cells, the significant changes of the proliferation and cell cycle progression of RAW264.7 cells in TDAG51 Knockdown RAW264.7 cells treated with LPS were observed. CONCLUSION: These findings suggested that TDAG51 up-regulation is a dependent event during LPS-mediated proliferation and cell cycle progression, and which increase our understanding of the interaction mechanism between LPS and macrophages.

Characterization of ribonuclease III from Brucella.

Bacterial ribonuclease III (RNase III) is a highly conserved endonuclease, which plays pivotal roles in RNA maturation and decay pathways by cleaving double-stranded structure of RNAs. Here we cloned rncS gene from the genomic DNA of Brucella melitensis, and analyzed the cleavage properties of RNase III from Brucella. We identified Brucella-encoding small RNA (sRNA) by high-throughput sequencing and northern blot, and found that sRNA of Brucella and Homo miRNA precursor (pre-miRNA) can be bound and cleaved by B.melitensis ribonuclease III (Bm-RNase III). Cleavage activity of Bm-RNase III is bivalent metal cations- and alkaline buffer-dependent. We constructed several point mutations in Bm-RNase III, whose cleavage activity indicated that the 133th Glutamic acid residue was required for catalytic activity. Western blot revealed that Bm-RNase III was differently expressed in Brucella virulence strain 027 and vaccine strain M5-90. Collectively, our data suggest that Brucella RNase III can efficiently bind and cleave stem-loop structure of small RNA, and might participate in regulation of virulence in Brucella.

The roles of noncoding RNA Rli60 in regulating the virulence of Listeria monocytogenes.

BACKGROUND: Listeria monocytogenes (LM) is an important zoonotic foodborne pathogen. Noncoding RNA (ncRNA) has an important role in regulating its virulence. As a member of ncRNA, however, the function of Rli60 in regulating LM virulence remain unclear. The aim of this study was to investigate the role of Rli60 in regulating LM virulence. METHODS: Using a homologous recombination method, a LM EGD-e rli60 gene deletion strain (LM-Δrli60) was constructed and compared with a LM EGD-e strain in the following respects: (1) adhesiveness, invasion ability, intracellular survival, proliferation, and transcription of virulence genes in the mouse macrophage cell line RAW264.7; (2) 50% lethal dose (LD50) to the BALB/c mouse; and (3) the amount in the mouse liver and spleen and the effects on pathology of mouse liver, spleen, and kidney after inoculation. RESULTS: The LM-Δrli60 strain had a significantly higher adhesion rate and lower invasion rate with significantly lower intracellular survival and proliferation rates in the RAW264.7 cell line, compared to the LM EGD-e strain. Inoculation with LM-Δrli60 strain significantly affected the transcription of virulence genes. The LD50 of LM-Δrli60 to BALB/c mouse was increased by 2.12 logarithmic magnitude, which indicated that the virulence in LM-Δrli60 is significantly decreased (p < 0.05). The amount of LM-Δrli60 in the liver and spleen was significantly lower than the amount of LM EGD-e in these organs (p < 0.05). The pathological damage due to LM-Δrli60 infection in the mouse liver, spleen, and kidney was lower than the damage due to LM EGD-e infection. CONCLUSION: This study confirmed that the rli60 deletion could significantly affect LM virulence, adhesion, invasion, survival, and proliferation. This suggests that Rli60 has an important role in regulating LM virulence.

The first detection of Rickettsia aeschlimannii and Rickettsia massiliae in Rhipicephalus turanicus ticks, in northwest China.

BACKGROUND: Rickettsia spp. belonging to the spotted fever group (SFG) cause infections in humans, domestic animals and wildlife. At least five SFG rickettsial species have been reported in China, but the occurrence of Rickettsia aeschlimannii and R. massiliae in ticks has not been characterized to date. FINDINGS: A total of 114 adult ticks were collected from sheep in Yining County, Xinjiang Uygur Autonomous Region, in northwest China. The ticks were identified from morphological and molecular characteristics. All samples were examined by polymerase chain reaction (PCR), and six genetic markers were used to determine the Rickettsia spp. in the ticks. The ticks collected were identified as Rhipicephalus turanicus. Three different lineages of Rh. turanicus from Yining County were discovered on phylogenetic analysis of 16S rDNA and cox1. Twenty-one of the 114 samples (18.42%) were positive for rickettsial agents. Phylogenetic analysis based on six genetic sequences showed that three rickettsial species were present, namely: R. aeschlimannii (19.05%, 4/21), R. massiliae (19.05%, 4/21) and R. sibirica variant (61.90%, 13/21), which is clustered in the clade of R. sibirica subsp. sibirica. CONCLUSIONS: This is the first description of R. aeschlimannii and R. massiliae in China. R. massiliae, R. aeschlimannii and R. sibirica variant co-circulate in the region of the China-Kazakhstan border, in northwest China. Rickettsial agents in ticks of the genus Rhipicephalus from migrant birds, transported livestock, wildlife and human beings should be investigated further in the region of the China-Central Asian border.

A broad-range survey of ticks from livestock in Northern Xinjiang: changes in tick distribution and the isolation of Borrelia burgdorferi sensu stricto.

BACKGROUND: Borreliosis is highly prevalent in Xinjiang Uygur Autonomous Region, China. However, little is known about the presence of Borrelia pathogens in tick species in this region, in addition Borrelia pathogens have not been isolated from domestic animals. METHODS: We collected adult ticks from domestic animals at 19 sampling sites in 14 counties in northern Xinjiang from 2012 to 2014. Ticks were identified to species by morphology and were molecularly analysed by sequences of mitochondrial 16S rDNA gene; 4-8 ticks of each species at every sampling site were sequenced. 112 live adult ticks were selected for each species in every county, and were used to culture Borrelia pathogens; the genotypes were then determined by sequences of the 5S-23S rRNA intergenic spacer and the outer surface protein A (ospA) gene. RESULTS: A total of 5257 adult ticks, belonging to four genera and seven species, were collected. Compared with three decades ago, the abundance of the five common tick species during the peak ixodid tick season has changed. Certain tick species, such as Rhipicephalus turanicus (Rh. turanicus), was found at Jimusaer, Yining, Fukang, and Chabuchaer Counties for the first time. Additionally, the sequence analyses showed that the Hyalomma asiaticum (Hy. asiaticum), Haemaphysalis punctata (Ha. punctata), and Dermacentor marginatus (D. marginatus) that were collected from different sampling sites (≥3 sites) shared identical 16S rDNA sequences respectively. For the tick species that were collected from the same county, such as Hy. asiaticum from Shihezi County and Rh. turanicus from Yining County, their 16S rDNA sequences showed genetic diversity. In addition, sixteen Borrelia isolates were found in Hy. asiaticum, Ha. punctata, D. marginatus and Rh. turanicus, which infested cattle, sheep, horse and camel in Yining, Chabuchaer, Shihezi and Shawan Counties. All of the isolates were genetically identified as B. Burgdorferi sensu stricto. CONCLUSIONS: Warmer and wetter climate may have contributed to the altered distribution and abundance of the five most common ticks in northern Xinjiang. The genetic analyses showed that certain tick species, such as Hy. asiaticum or Rh. turanicus, exhibit genetic commonness or diversity. Additionally, this study is the first to isolate B. burgdorferi sensu stricto in Hy. asiaticum asiaticum, H. punctata, D. nuttalli and D. marginatus ticks from domestic animals. These ticks may transmit borreliosis among livestock.

Rickettsia raoultii in Haemaphysalis erinacei from marbled polecats, China-Kazakhstan border.

We found Rickettsia raoultii DNA in 2 out of 32 (6.25 %) Haemaphysalis erinacei ticks. Result showed that the sequences of five genes (17-kDa, gltA, ompA, rrs, and ompB) were 100 % identity with that of R. Raoultii in GenBank. This study is the first report on the presence of R. raoultii in H. erinacei from wild marbled polecat, Vormela peregusna. Our findings suggest that H. erinacei parasitizing wild marbled polecat may serve as reservoir and carriers for R. raoultii in areas around the China-Kazakhstan border. The transmission of tick-borne diseases originated from wildlife should not be underestimated in border region.

Immunization of BALB/c mice with Brucella abortus 2308ΔwbkA confers protection against wild-type infection.

Brucellosis is a zoonotic disease that causes animal and human diseases. Vaccination is a major measure for prevention of brucellosis, but it is currently not possible to distinguish vaccinated animals from those that have been naturally infected. Therefore, in this study, we constructed the Brucella (B.) abortus 2380 wbkA mutant (2308ΔwbkA) and evaluated its virulence. The survival of 2308ΔwbkA was attenuated in murine macrophage (RAW 264.7) and BALB/c mice, and it induced high protective immunity in mice. The wbkA mutant elicited an anti-Brucella-specific immunoglobulin G response and induced the secretion of gamma interferon. Antibodies to 2308ΔwbkA could be detected in sera from mice, implying the potential for use of this protein as a diagnostic antigen. The WbkA antigen would allow serological differentiation between infected and vaccinated animals. These results suggest that 2308ΔwbkA is a potential attenuated vaccine against 16M. This vaccine will be further evaluated in sheep.

Immunogenic response to a recombinant pseudorabies virus carrying bp26 gene of Brucella melitensis in mice.

Brucellae are facultative intracellular bacterial pathogens of a zoonotic disease called brucellosis. Live attenuated vaccines are utilized for prophylaxis of brucellosis; however, they retain residual virulence to human and/or animals, as well as interfere with diagnosis. In this study, recombinant virus PRV ΔTK/ΔgE/bp26 was screened and purified. One-step growth curve assay showed that the titer of recombinant virus was comparable to the parent strain. Mice experiments showed the recombinant virus elicited high titer of humoral antibodies against Brucella detected by enzyme-linked immunosorbent assay and against PRV by serum neutralization test. The recombinant virus induced high level of Brucella-specific lymphocyte proliferation response and production of interferon gamma. Collectively, these data suggest that the bivalent virus was capable of inducing both humoral and cellular immunity, and had the potential to be a vaccine candidate to prevent Brucella and/or pseudorabies virus infections.

A Brucella melitensis M5-90 wboA deletion strain is attenuated and enhances vaccine efficacy.

Brucella spp. are Gram-negative intracellular pathogens of both humans and animals that cause great economic burdens in developing countries. Live attenuated vaccines are the most efficient means for the prevention and control of animal Brucellosis. However, Brucella vaccines (strain M5-90 and others) have several drawbacks and do not allow serological differentiation between vaccinated and infected animals. A wboA mutant was derived from Brucella melitensis (B. melitensis) vaccine strain M5-90 and tested for virulence and protective efficiency. T-cell responses (CD4(+), CD8(+)), levels of immunoglobulin G (IgG), and cytokine production were observed. WboA was also assessed as a diagnostic marker for Brucellosis. B. melitensis strain M5-90ΔwboA exhibited reduced survival in murine macrophages (RAW 264.7) and BALB/c mice and induced protective immunity in mice comparable to that from the parental strain M5-90. In mice, the wboA mutant elicited an anti-Brucella-specific IgG response and induced the secretion of gamma interferon (IFN-γ) and interleukin-2 (IL-2). In sheep, M5-90ΔwboA immunization induced the secretion of IFN-γ, and serum samples from sheep inoculated with M5-90ΔwboA were negative by Bengal Plate Test (RBPT) and Standard Tube Agglutination Test (STAT). In mice, probes against WboA antigen allowed for serological differentiation between natural infection and vaccination. The M5-90ΔwboA mutant is a potential attenuated live vaccine candidate against virulent B. melitensis 16M infection. It will be further evaluated in livestock.