Cytokine storms caused by novel coronavirus 2019 and treatment for cardiac injury.

Since December 2019, an outbreak of a new coronavirus, COVID-19, infection has been taking place. At present, COVID-19 has spread to most countries worldwide. The latest evidence suggests that cytokine storm syndrome (CSS) is an important cause of the transition from mild to critical pneumonia and critically ill patients' death. The sudden exacerbation of COVID-19 may be related to a cytokine storm. Therefore, early identification and active treatment of CSS may play very important roles in improving the patients' prognosis, and these tasks are given attention in the current treatment of new Coronavirus pneumonia. However, there is still no specific medicine for this purpose. This article reviews cytokine storms and conducts an exploratory review of pharmacotherapy for cytokine storms to provide a reference for clinical treatment.

Comparison between functional and intravascular imaging approaches guiding percutaneous coronary intervention: A network meta-analysis of randomized and propensity matching studies.

BACKGROUND: The optimal approach to guide percutaneous coronary intervention (PCI) has yet to be defined. The aim of this study was to compare functional driven (fractional flow reserve) versus intravascular imaging (intravascular ultrasound, IVUS, and/or optical coherence tomography, OCT) versus standard (coronary angiography only, CA)-guided PCI. METHODS: Randomized controlled trials (RCTs) and propensity score weight-matched studies (PSWMs) comparing FFR versus IVUS versus OCT versus CA-guided PCI were included. Major adverse cardiovascular event (MACE; a composite end point of death or myocardial infarction [MI] or revascularization) was the primary endpoint, whereas definite stent thrombosis (ST) and single components of MACE were the secondary ones. Primary analyses were performed including only RCTs, secondary also with PSWMs. RESULTS: Thirty-three studies were included in the analysis, 16 RCTs and 17 PSWMs. After 2 (1-3) years, IVUS performed better for MACE than CA (odds ratio [OR] 0.75 0.52-0.88), whereas there was just a trend for FFR (OR 0.81, 0.64-1.02). These results were mainly driven by reduced risk of all cause death, MI (FFR OR 0.74:0.57-0.99 and IVUS OR 0.82:0.54-0.94) and revascularization. IVUS reduced ST while FFR did not, and at meta-regression analysis, there was a trend for superiority of IVUS versus FFR to reduce subsequent MI in acute coronary syndrome (ACS) patients. The present results were consistent also after adding studies with PSWMs. CONCLUSIONS: Functional and intravascular imaging approaches seem to perform similarly in term of clinical outcomes, while both performed better compared with the standard approach. Imaging showed a potential benefit for ACS patients. The present results stress the need for a wider use of functional or imaging driven PCI.

Correlation between intestinal flora and serum inflammatory factors in patients with Crohn's disease.

OBJECTIVE: We investigated the correlation between intestinal flora and serum inflammatory factors in patients with Crohn's disease. PATIENTS AND METHODS: From February 2014 to June 2016, 132 patients with Crohn's were enrolled in this study. There were 84 males and 48 females. The age range was from 28 to 72 years. We had 62 patients in active stage (the activity group) and 70 patients in remission stage (the remission group). We also enrolled 71 healthy cases in the control group. The expression levels of serum inflammatory factors including IL-6, IL-17, IL-22, and IL-33 were measured using ELISA. Fresh feces samples were diluted and, after cultivating the bacteria for 48 hours at 37°C, the number of colonies was counted. The number of flora per gram of feces (CFU/g) was determined. RESULTS: The number of Escherichia coli and Enterococcus sp. in feces was significantly higher in the activity group compared to that of the control group and the remission group. The levels IL-1, IL-17, L-22, and IL-33 in the activity group were significantly higher than those of other groups. The number of Escherichia coli and Enterococcus sp. was positively correlated with the levels of IL-6, IL-17, IL-22, and IL-33, while the number of Bifidobacteria and Bacillus lactic acid was negatively correlated with the levels of IL-6, IL-17, IL-22, and IL-33. CONCLUSIONS: The number of conditional pathogenic bacteria in the activity group, was higher than other groups, while the number of probiotics bacteria decreased distinctly. We concluded that monitoring the changes in distribution and composition of intestinal flora as well as the levels of blood inflammatory factors could play a significant role in the treatment process of Crohn's disease.

Thyroid hormone protects hepatocytes from HBx-induced carcinogenesis by enhancing mitochondrial turnover.

Infection by hepatitis B virus (HBV) accounts for 50-80% of hepatocellular carcinoma (HCC) development worldwide, in which the HBV-encoded X protein (HBx) has critical role in the induction of carcinogenesis. Several studies have shown that thyroid hormone (TH) suppresses HCC development and protects hepatocytes from HBx-induced damage, thus it is of interest to examine whether TH can protect hepatocytes from HBx-induced carcinogenesis. By treating HBx- transgenic mice with or without TH, we confirmed the protective effects of TH on HBx-induced hepatocarcinogenesis, which was achieved via reduction of reactive oxygen species (ROS) inflicted DNA damage. We further found that TH induced biogenesis of mitochondria (MITO) and autophagy of HBx-targeted MITO simultaneously, consequently leading to suppression of HBx-promoted ROS and carcinogenesis. Using microarray data analysis, this protective effect of TH was found to be mediated via activation of PTEN-induced kinase 1 (PINK1) in hepatocytes. PINK1, in turn, activated and recruited Parkin, an E3 ligase, to ubiquitinate MITO-associated HBx protein and trigger selective mitophagy. The pathological significance of the TH/PINK1 pathway in liver protection was confirmed by the concomitant decrease in expression of both TR and PINK1 in matched HCC tumor tissues and negatively correlated with aggressive progression of cancer and poor prognosis. Our data indicate that TH/PINK1/Parkin pathway has a critical role in protecting hepatocytes from HBx-induced carcinogenesis. Notably, several liver-targeting therapeutic derivatives of TH facilitating prevention or therapy of steatosis have been identified. Furthermore, our proof-of-concept experiments suggest that application of T3 constitutes an effective novel therapeutic or preventive option for HCC. Thus, the utilization of the agonists of TRs could be the meaningful strategy in liver relative diseases, ranging from simple hepatic steatosis to HCC.

Effects of risk factors on periodontal disease defined by calibrated community periodontal index and loss of attachment scores.

OBJECTIVES: We evaluated whether and how the effects of risk factors on periodontal disease (PD) were modified by measurement errors using community periodontal index (CPI) and loss attachment (LA) in the community-based survey. METHODS: A pilot validation study was performed to estimate the rates of false negative and false positive for both CPI and LA in 31 subjects from different regions using measurements from 12 well-trained dentists and a senior periodontist as a gold standard. Afterward, a Taiwanese nationwide survey was conducted by enrolling 3,860 participants to estimate the effect of each risk factor on PD calibrated with both sensitivity and specificity of two indices. RESULTS: The values obtained for the sensitivity to false-positive ratio for CPI ranged widely from 1.12 to 7.71, indicating regional variation in both errors. The calibrated adjusted odds ratio for smoking vs non-smoking was higher than the uncalibrated odds ratio for PD defined by CPI (2.75 (2.01, 3.77) vs 2.02 (1.63, 2.52)) and LA (3.85 (2.44, 6.13) vs 1.93 (1.47, 2.54)) scores. Similar underestimation was noted for other risk factors. CONCLUSION: The effects of risk factors on PD measured using CPI and LA in a large population-based survey were underestimated without correcting for measurement errors.

A longitudinal study of the association between the GNB3 C825T polymorphism and metabolic disturbance in bipolar II patients treated with valproate.

This longitudinal study aimed to investigate the associations between the polymorphisms of guanine nucleotide-binding protein subunit ß-3 (GNB3) C825T and metabolic disturbance in bipolar II disorder (BP-II) patients being treated with valproate (VPA). A 100 BP-II patients received a 12-week course of VPA treatment, and their body weight and metabolic indices were measured. At baseline, the GNB3 C825T polymorphisms were associated with the triglyceride level (P=0.032) in BP-II patients. During the VPA treatment course, the polymorphisms were not only associated with body mass index (BMI) and waist circumference (P-values=0.009 and 0.001, respectively), but also with total cholesterol, triglyceride, low-density lipoprotein and leptin levels (P-values=0.004, 0.002, 0.031 and 0.015, respectively). Patients with the TT genotype had a lower BMI, smaller waist circumference, and lower levels of lipids and leptin than those with the CT or CC genotypes undergoing the VPA treatment course.

An Intensive Diabetes Screening and Treatment Program Improves Diagnosis, Treatment and Outcomes of Diabetes in Patients Admitted with Cardiac Diseases.

Aim: Patients with cardiac diseases, especially ischemic heart disease, are known to have a high prevalence of diabetes mellitus (DM). They are at risk of having inadequate glucose control. An intensive diabetes screening and treatment program was developed to identify and treat DM in patients admitted with cardiac diseases. Methods: Adult inpatients of 2 cardiac wards, namely Ward-A and Ward-B, at Nanjing Hospital, Nanjing, China, were studied. Patients were randomly assigned into either ward. In addition to routine examination and treatment, an intensive screening and treatment program to identify and treat patients with DM or impaired glucose regulation (IGR) was only applied in Ward-A patients. The glycated serum protein concentration, the length of hospitalization, and medical and total hospital cost were compared between the 2 wards. Results: The prevalence of DM was 17.85% in Ward-B. With implementation of this program, DM was higher in Ward-A (29.7%) and the prevalence of IRG was 7.8%. The overall prevalence of abnormal glucose metabolism was 37.5% in Ward-A. This program is associated with significantly reduced medical cost and length of inhospital days in patients requiring percutaneous coronary intervention (PCI) and reduced both the medical and total hospital costs in patients without PCI of Ward-A as compared with those of Ward-B who received standard treatment. Conclusion: The intensive screening and treatment program increases diagnosis rate of DM and IRG in inpatient with cardiac diseases, more effectively controls hyperglycemia, and is associated with shorter length of inhospital days and lower medical and total hospital costs. The trial registry number: ChiCTR-IPR-15007487.

The diagnostic utility of preoperative breast magnetic resonance imaging (MRI) and/or intraoperative sub-nipple biopsy in nipple-sparing mastectomy.

BACKGROUND: The necessity of routine sub-nipple biopsy was uncertain, and the role of preoperative magnetic resonance imaging (MRI) in detecting nipple invasion in patients who have been selected for nipple sparing mastectomy (NSM) has not been adequately evaluated. METHODS: We retrospectively collected and analyzed the medical and surgical records of 434 patients with primary operable breast cancer who met the criteria for NSM and underwent breast surgery during the period January 2011 to December 2015. Patients were stratified into three risk groups (low, intermediate, and high) according to tumor size and tumor-to-nipple distance. RESULTS: Among the 434 patients in this study, 29 (6.7%) had occult invasion of the nipple-areola complex (NAC). Sub-nipple biopsy had a sensitivity of 84.6%, a specificity of 100%, a false negative rate of 1.2%, a false positive rate of 0%, and an overall accuracy rate of 98.8% in confirming NAC invasion. The NAC invasion rate was 0% in the low-risk group, 5.1% in the intermediate-risk group, and 19.7% in the high-risk group (P < 0.01). The overall NPV of preoperative MRI for predicting NAC invasion was 94.8%. Cost analysis revealed that the cost of NSM with sub-nipple biopsy was significantly higher than that of NSM alone, with a mean difference in cost of USD 238.5 (P < 0.01). CONCLUSION: The high negative predictive value of MRI for NAC invasion is useful for selection of patients receiving NSM. Sub-nipple biopsy is a reliable procedure to detect occult NAC invasion, however, routine use is not cost-effect for low risk patients.

Predominance of Cryptococcus neoformans var. grubii multilocus sequence type 5 and emergence of isolates with non-wild-type minimum inhibitory concentrations to fluconazole: a multi-centre study in China.

There are few data on the molecular epidemiology of cryptococcosis in China. Here we investigated the species distribution, molecular types and antifungal susceptibilities of 312 Cryptococcus neoformans species complex isolates from ten hospitals over 5 years. Isolates were identified by internal transcribed spacer (ITS) sequencing and by two matrix-assisted laser desorption-ionization time-of-flight mass spectrometry (MALDI-TOF MS) systems. Multilocus sequence typing (MLST) was used to verify species/variety and to designate molecular types. Susceptibility to six antifungal drugs was determined by the Sensititre YeastOne™ method. Cryptococcus neoformans was the predominant species (305/312 isolates (97.8%), all were ITS type 1, serotype A), of which 89.2% (272/305) were C. neoformans var. grubii MLST sequence type (ST) 5 and 6.2% (19/305) were ST31. Other C. neoformans var. grubii STs were rare but included six novel STs. Only two strains were C. neoformans var. neoformans (both serotype AD). Cryptococcus gattii was uncommon (n = 7, four ITS types) and comprised five MLST STs including one novel ST. For C. neoformans var. grubii, the proportion of isolates with non-wild-type MICs to fluconazole significantly rose in the fourth study year (from 0% (0/56 isolates) in the first year to 23.9% (17/71) in the fourth year), including five isolates with fluconazole MICs of ≥32 mg/L. The study has provided useful data on the species epidemiology and their genetic diversity and antifungal susceptibility. The proportional increase in isolates with non-wild-type MICs to fluconazole is noted.

Long-Term (≥10 Years) Safety of Percutaneous Treatment of Unprotected Left Main Stenosis With Drug-Eluting Stents.

Percutaneous coronary intervention (PCI) of unprotected left main disease (ULM) with drug-eluting stents (DES) is hampered by lack of information on long-term (≥10 years) safety data. All patients treated with PCI on ULM in 9 international centers with at least 10 years follow-up were enrolled. Baseline and procedural features were recorded. Repeat PCI (re-PCI) on ULM at 10 years was the primary end point. Secondary end points included major adverse cardiac events and its components (cardiac and noncardiac death, myocardial infarction, re-PCI not on ULM, and stent thrombosis). Sensitivity analysis was performed according to the presence of isolated ULM disease: 284 patients were enrolled. A total of 70 patients (21%) performed a re-PCI on ULM, 39 in the first year, and 31 between 1 and 10 years (only 5 overall performed for acute coronary syndrome). Patients with re-PCI on ULM did not show differences in baseline and procedural features, or experience higher rates of cardiovascular death (12% vs 11%, p 0.65), myocardial infarction (11% vs 6%, p 0.56), or of re-PCI on non-ULM disease (31% vs 27%, p 0.76) compared with those without re-PCI on ULM. At Kaplan-Meier analysis, patients with PCI in other coronary vessels were at higher risk of major adverse cardiac events, driven by target vessel revascularization (20.4% vs 32.9%, p 0.009), as confirmed at multivariate analysis (stenosis other than LM; hazard ratio 2, 1.4 to 2.7, all CI 95%). In conclusion, despite of using first-generation stents, PCI on ULM is safe, with low rates of recurrent events due to index revascularization. Progression of atherosclerotic lesions on other coronary vessels represents the only independent predictive factor for prognosis.

Comparison of nocturia response to desmopressin treatment in elderly men with and without nocturnal polyuria in real-life practice.

OBJECTIVES: To evaluate the safety and efficacy of low-dose desmopressin in elderly men with and without nocturnal polyuria (NP) in real-life practice. METHODS: Patients with lower urinary tract symptoms (LUTS)/ benign prostate hyperplasia (BPH) who were≧ 65 years old with refractory nocturia were enrolled in this study. We retrospectively analysed elderly men treated with adding desmopressin to current medications for nocturia according to category of the baseline nocturnal urine volume. The 48-h frequency volume chart (FVC), International Prostate Symptom Score (IPSS) and quality of life (QoL) were initially assessed and re-evaluated 12 weeks later. Serum sodium level was checked 1 week, 4 weeks, and 12 weeks after initiation of desmopressin therapy or suspected hyponatremia event. The mean change in numbers of nocturnal voids was evaluated for efficacy of treatment. RESULTS: A total of 136 patients were included with 55 in non-NP group and 81 in NP group. Hypertension was more common in NP group in regard of comorbidities. During treatment period, there were significant reductions of nocturnal voids from 4.22 ± 1.38 to 2.31 ± 0.98 (p < 0.001) in non-NP group and from 4.52 ± 1.23 to 2.07 ± 0.89 (p < 0.001) in NP group. The reduction in nocturnal voids was more significant in NP group (2.44 ± 1.15 vs. 1.91 ± 1.48, p = 0.003). The mean decrease in serum sodium levels were 3.89 ± 1.22 mmol/l (p < 0.001) in non-NP group and 4.69 ± 3.5 mmol/l (p < 0.001) in NP group at the extreme value. CONCLUSIONS: Long-term treatment with low-dose desmopressin is safe and effective for nocturia with or without NP in elderly patients with LUTS/BPH during real-life practice. Patients should be well informed about the disease and are closely followed.

Cloning and analysis of the soybean MEKK gene.

In this paper, homologous cloning methods were used to clone the soybean GmMEKK gene, which possesses a high degree of similarity to Arabidopsis thaliana AtMEKK1. AtMEKK1 is formed by 595 amino acids, and its secondary structure is formed by 38 irregular curls, 24 α helix, 14 ß, with S-TKc domain, transmembrane domain and does not have membrane spanning domain and signal peptide. GmMEKK-GFP subcellular localization fusion and prokaryotic expression vectors were generated and it was revealed that GmMEKK encodes a highly conserved 66.8-kDa nuclear protein that is expressed in soybean roots, stem floral pieces, and leaves. A real-time quantitative PCR analysis of GmMEKK under different abiotic stresses revealed that the expression level of GmMEKK increased under drought and low phosphorus and nitrogen conditions. Taken together, these data suggest that GmMEKK may play an important role in the soybean abiotic stress response.

Correlation of plasma brain-derived neurotrophic factor and metabolic profiles in drug-naïve patients with bipolar II disorder after a twelve-week pharmacological intervention.

OBJECTIVE: Brain-derived neurotrophic factor (BDNF) is thought to be involved in the pathophysiology of bipolar disorder (BD) and metabolic syndrome. We investigated the correlation between plasma BDNF with mood symptoms and metabolic indices in patients with BD-II over a 12-week pharmacological intervention. METHOD: Drug-naïve patients with BD-II (n=117) were recruited. Metabolic profiles [cholesterol, triglyceride, HbA1C, fasting serum glucose, body mass index (BMI)] and plasma BDNF wtrun "tblautotrun "tblsctrun "tbl_contere measured at baseline and 2, 8, and 12 weeks after beginning medication. To adjust within-subject dependence over repeated assessments, multiple linear regressions with generalized estimating equation methods were used. RESULTS: Seventy-six (65.0%) patients completed the intervention. Plasma BDNF levels were significantly associated with BMI (P=9.6E-5), low-density lipoprotein (P=0.034) and total (P=0.001) cholesterol, but not with the Hamilton Depression Rating Scale-17 and Young Mania Rating Scale scores over the 12-week treatment. CONCLUSION: We found initial evidence of a positive correlation between plasma BDNF levels and BMI, low-density lipoprotein and total cholesterol in drug-naïve patients with BD-II. The specific function of BDNF in regulating and maintaining peripheral metabolic health requires additional investigation.

BCAS2 promotes prostate cancer cells proliferation by enhancing AR mRNA transcription and protein stability.

BACKGROUND: We showed previously that breast carcinoma amplified sequence 2 (BCAS2) functions as a negative regulator of p53. We also found that BCAS2 is a potential AR-associated protein. AR is essential for the growth and survival of prostate carcinoma. Therefore we characterised the correlation between BCAS2 and AR. METHODS: Protein interactions were examined by GST pull-down assay and co-immunoprecipitation. Clinical prostate cancer (PCa) specimens were evaluated by immunohistochemical assay. AR transcriptional activity and LNCaP cell growth were assessed by luciferase assay and MTT assay, respectively. RESULTS: BCAS2 expression was significantly increased in PCa. BCAS2 stabilised AR protein through both hormone-dependent and -independent manners. There are at least two mechanisms for BCAS2-mediated AR protein upregulation: One is p53-dependent. The p53 is suppressed by BCAS2 that results in increasing AR mRNA and protein expression. The other is via p53-independent inhibition of proteasome degradation. As BCAS2 can form a complex with AR and HSP90, it may function with HSP90 to stabilise AR protein from being degraded by proteasome. CONCLUSIONS: In this study, we show that BCAS2 is a novel AR-interacting protein and characterise the correlation between BCAS2 and PCa. Thus we propose that BCAS2 could be a diagnostic marker and therapeutic target for PCa.

First Report of Fusarium solani Causing Fusarium Root Rot and Stem Canker on Storage Roots of Sweet Potato in China.

China is the biggest sweet potato (Ipomoea batatas (L.) Lam) producer in the world and its total production is about 100 million tons per year. Surveys for diseases of sweet potato in storage were conducted from 2011 to 2013 in Hebei Province, China. The storage roots from cultivars such as Yizi 138 and Beijing 553 developed lesions on their surface during storage. Typical lesions consisted of alternating light and dark brown concentric rings that were darker than the root surface. The size of the lesions was 49 × 63 mm (11 to 75 × 36 to 80 mm, n = 20) on average. The lesion spot was slightly concave. Cutting the diseased roots revealed the lesions could extend into the center of the roots, often with cavities. It smelled bitter within the necrotic tissues and was dark brown or black. The disease incidence was about 10 to 20%. A Fusarium species was consistently isolated from the diseased roots (n = 20). Mycelial plugs from a pure culture of the pathogen on potato dextrose agar were placed on the surface of disinfected sweet potato roots incubated at 25°C with 80 to 90% relative humidity and uninoculated roots were used as control. The same symptom was observed after 14 days on all roots (n = 20) inoculated with the pathogen. The same Fusarium species was consistently reisolated from all lesions. The pathogen was cultured on carnation leaf agar (CLA) for 10 days at 25°C with a 12-h photoperiod. The fungus produced two types of spores on CLA: microconidia were thin-walled, hyaline, fusiform to ovoid, generally 1- or 2-celled, and 3.1 to 9.4 × 1.3 to 2.9 µm (n = 20); macroconidia were slightly curved with blunt and rounded apical cell and notched basal cells, mostly 4- to 8-celled, and 13.3 to 36.5 × 2.3 to 3.8 µm (n = 40). On the basis of morphological characteristics, the fungal isolates were identified as Fusarium solani (Mart.) Appel & Wollenw. emend. Snyd. & Hans. (1). The genomic DNA of the pathogen cultured in potato dextrose broth for 3 days at 25°C was extracted with the CTAB method. The ITS-rDNA sequence, a fragment of the translation elongation factor 1-alpha (EF-1α) gene sequence, and the beta tubulin gene sequence was amplified using the paired primers ITS1F/ITS4(CTTGGTCATTTAGAGGAAGTAA/TCCTCCGCTTATTGA TATGC), EF-1/EF-2 (ATGGGTAAGGARGACAAGAC/GGARGTACCAGTSATCATGTT) and Bt-1/Bt-2(AACATGCGTGAGATTGTAAGT/TCTGGATGTTGTTGGGAATCC), respectively. Those sequence showed 97% homology with ITS sequence of F. solani (GenBank Accession No. AF178407), 99% homology with EF-1α sequence of F. solani (JX945169, DQ247593, and DQ247354), and 98% homology with beta tubulin gene sequence of F. solani (AB553621), respectively. The new sequences of ITS-rDNA, EF-1α, and beta tubulin were deposited in GenBank (KF255997, KF255995, and KF255996). The pathogen was identified as F. solani based on its morphological and molecular characteristics. To our knowledge, this is the first report of F. solani-induced fusarium root rot and stem canker on sweet potato storage roots in China. A rootlet root rot attributed to F. solani in China was reported previously (2). References: (1) J. F. Leslie and B. A. Summerell. The Fusarium Laboratory Manual, Blackwell Publishing, Ames, IA, 2006. (2) Q. J. Liu et al. Acta Phytopathol. Sin. 12(3):21,1982.

Role of DRD2 and ALDH2 genes in bipolar II disorder with and without comorbid anxiety disorder.

The presence of comorbid anxiety disorders (AD) and bipolar II disorders (BP-II) compounds disability complicates treatment, worsens prognosis, and has been understudied. The genes involved in metabolizing dopamine and encoding dopamine receptors, such as aldehyde dehydrogenase 2 (ALDH2) and dopamine D2 receptor (DRD2) genes, may be important to the pathogenesis of BP-II comorbid with AD. We aimed to clarify ALDH2 and DRD2 genes for predisposition to BP-II comorbid with and without AD. The sample consisted of 335 subjects BP-II without AD, 127 subjects BP-II with AD and 348 healthy subjects as normal control. The genotypes of the ALDH2 and DRD2 Taq-IA polymorphisms were determined using polymerase chain reactions plus restriction fragment length polymorphism analysis. Logistic regression analysis showed a statistically significant association between DRD2 Taq-I A1/A2 genotype and BP-II with AD (OR=2.231, P=0.021). Moreover, a significant interaction of the DRD2 Taq-I A1/A1 and the ALDH2*1*1 genotypes in BP-II without AD was revealed (OR=5.623, P=0.001) compared with normal control. Our findings support the hypothesis that a unique genetic distinction between BP-II with and without AD, and suggest a novel association between DRD2 Taq-I A1/A2 genotype and BP-II with AD. Our study also provides further evidence that the ALDH2 and DRD2 genes interact in BP-II, particularly BP-II without AD.