RESUMO
BACKGROUND AND AIMS: Impaired myocardial mechano-energetic efficiency (MEE) has been associated with cardiac insulin resistance measured by dynamic positron emission tomography (PET) with 18F-fluorodeoxyglucose (18F-FDG) combined with euglycemic-hyperinsulinemic clamp. Estimate glucose disposal rate (eGDR) index has a good correlation with whole-body insulin sensitivity. It remains unsettled whether eGDR index is a suitable proxy of cardiac insulin sensitivity as well as its association with myocardial MEE. The aims of this study were: 1) to compare eGDR index with HOMA-IR, QUICKI and FIRI indexes for association with myocardial glucose metabolic rate (MrGlu); and 2) to determine the association of eGDR index with myocardial MEE. METHODS: We evaluated MrGlu using PET with 18F-FDG combined with euglycemic-hyperinsulinemic clamp in 50 individuals without history of coronary heart disease. Myocardial MEE per gram of left ventricular mass (MEEi) was measured in 1181 subjects by echocardiography. eGDR (mg kg-1/min) was calculated as: 21.158 - (0.09 × waist circumference in cm) - (3.407 × hypertension, 1 = yes 0 = no) - (0.551 × HbA1c%). RESULTS: eGDR index was more strongly associated with myocardial MrGlu than HOMA-IR, QUICKI, and FIRI indexes (r = -0.662, r = -0.492, r = 0.570, and r = -0.492, respectively). Individuals in the lower tertiles of eGDR exhibited a significant reduction of MEEi as compared to those in the highest tertile (P < 0.001). In a stepwise multivariate linear regression analysis eGDR index was the major determinant of MEEi independently of well-established cardio-metabolic risk factors. CONCLUSIONS: These data suggest that the eGDR index may be a useful marker to identifying individuals at high cardiovascular risk.
RESUMO
AIMS: The International Diabetes Federation (IDF) has recently recommended determination of 1-hour plasma glucose (1-hPG) during an oral glucose tolerance test (OGTT) to diagnose intermediate hyperglycemia (IH) and type 2 diabetes (T2DM). Herein, we investigated the cardiometabolic characteristics of individuals with IH and T2DM according to IDF criteria. METHODS: We studied 3086 individuals stratified on the basis of fasting, 1-hPG and 2-hPG in four groups: 1) normal glucose tolerance (NGT), 2) isolated impaired fasting glucose (iIFG,), 3) IH (fasting glucose < 126 mg/dL, 1-hPG 155-208 mg/dL, and/or 2-hPG 140-199 mg/dL, and 4) newly diagnosed T2DM (fasting glucose, 1-hPG and/or 2-hPG≥126 mg/dL, 209 mg/dL and 200 mg/dL, respectively). RESULTS: Individuals with IH and T2DM exhibited higher adiposity, blood pressure, uric acid, a worse lipid and inflammatory profile and a progressive reduction in Matsuda index of insulin sensitivity, insulinogenic index, and disposition index as compared to the NGT group. Moreover, individuals with IH and T2DM exhibited lower Matsuda, insulinogenic, and disposition indexes as compared to the iIFG group. CONCLUSIONS: 1-h PG-based criteria for diagnosis of IH and diabetes identify individuals having an unfavorable cardiometabolic risk profile with a progressive reduction in insulin sensitivity associated with impaired ß cell function.
RESUMO
Biomarkers of aging (BOA) are quantitative parameters that predict biological age and ideally its changes in response to interventions. In recent years, many promising molecular and omic BOA have emerged with an enormous potential for translational geroscience and improving healthspan. However, clinical translation remains limited, in part due to the gap between preclinical research and the application of BOA in clinical research and other translational settings. We surveyed experts in these areas to better understand current challenges for the translation of aging biomarkers. We identified six key barriers to clinical translation and developed guidance for the field to overcome them. Core recommendations include linking BOA to clinically actionable insights, improving affordability and availability to broad populations and validation of biomarkers that are robust and responsive at the level of individuals. Our work provides key insights and practical recommendations to overcome barriers impeding clinical translation of BOA.
RESUMO
Introduction: Post-transplant relapse of acute myeloid leukemia and myelodysplastic syndrome faces restricted effective salvage regimens. We retrospectively analyzed the use of Azacitidine-donor lymphocyte infusion (AZA/DLI) in this setting. Furthermore, data on bone marrow Wilms tumor gene 1 (WT1) expression were collected. Methods: A Cox proportional hazards model, an outcome-oriented approach for the lowest smoothed plot of the martingale residuals, was performed for the cut-point determination of the respective WT1 expression levels. Finally, a Cox proportional hazards model investigated the association of overall survival (OS) with predictors. Results: An overall response of 41.4% with a median duration of 11.9 months for stable disease and 19.5 months for complete response (CR) patients was achieved. The disease risk index (DRI) high-/very high-risk patients had a shorter OS of 4.4 months than intermediate-risk patients, with 14.5 months, p = 0.007. At transplant, WT1-overexpressing patients (>150 copies) had a shorter median OS of 5.3 months than low-WT1-expressing ones, with 13.5 months, p = 0.024. Furthermore, patients with ≤1000 WT1 copies at relapse had a significantly longer OS with 15.3 months than patients overexpressing WT1, with 4.4 months, p = 0.0002. Conclusions: DRI and WT1 expression associate significantly with OS after AZA/DLI. Hence, WT1 may represent an MRD marker, especially in CR patients at high risk.
RESUMO
This mini review spotlights the most promising treatments for geographic atrophy, the advanced form of age-related macular degeneration, often resulting in severe and irreversible vision loss. The pathophysiology is complex, and various therapeutic strategies, including anticomplement therapies, gene therapies, cell-based interventions, and artificial intelligence-driven diagnostics are discussed. Anticomplement therapies (antifactors C3 and C5) showed promise in reducing the inflammatory response and the progression of the atrophy. Gene therapies, targeting specific genetic mutations, are under development to correct underlying defects and potentially reverse disease progression. Cell-based therapies are gaining momentum, with early studies indicating encouraging results in the replacement of damaged retinal pigment epithelium cells.
Assuntos
Terapia Genética , Atrofia Geográfica , Humanos , Atrofia Geográfica/terapia , Atrofia Geográfica/tratamento farmacológico , Animais , Terapia Genética/métodos , Inteligência Artificial , Terapia Baseada em Transplante de Células e Tecidos/métodosRESUMO
BACKGROUND: Ductal carcinoma in situ (DCIS) is the most common form of preinvasive breast cancer, with 5-10% of cases progressing into invasive disease. Herein, we investigated the association between HER2-low and clinico-pathological characteristics in DCIS and subsequent ipsilateral loco-regional relapse (LRR). MATERIALS AND METHODS: We accessed our prospectively maintained institutional database. HER2 status was determined by immunohistochemistry and classified as null (score 0), over-expressed (3+), and low (1+ or 2+); in situ hybridization was not considered since it is not used for routine DCIS diagnostics. RESULTS: Among 375 patients with DCIS, median age was 54 (27-88) years, with a primary tumor size < 2.5 cm in 63%, grade III in 33%, and positive hormone receptor status (HR) in 81% of cases; 71% underwent breast-conserving surgery, 34% received adjuvant endocrine and 39% radiotherapy. A total of 197 (52%) had tumors with low HER2 expression, which resulted significantly associated with grade I/II (P < .001), Ki67< 20% (P < .001), and HR-positive status (P < .001). HER2-low distribution varied from 19.61% and 50% in ER negative and ER-low (<10%) to 60% and 69% in ER high (50%-95%) and very high tumors (> 95%) (P < .001). After a median 39-month follow-up (IQR 16-65), cumulative incidences of LRR was 0.054. Among 17 patients with paired primary tumor and LRR, 5 had discordant HER2 status, with an even distribution of increased and decreased HER2 expression. CONCLUSIONS: Low HER2 expression in DCIS is associated with features of reduced aggressiveness. Importantly, changes in HER2 expression may occur prompting retesting in recurrent cases, in line with observations in invasive breast cancer.
RESUMO
Mucosal enrichment of the Adherent-Invasive E. coli (AIEC) pathotype and the expansion of pathogenic IFNγ-producing Th17 (pTh17) cells have been linked to Crohn's Disease (CD) pathogenesis. However, the molecular pathways underlying the AIEC-dependent pTh17 cell transdifferentiation in CD patients remain elusive. To this aim, we created and functionally screened a transposon AIEC mutant library of 10.058 mutants to identify the virulence determinants directly implicated in triggering IL-23 production and pTh17 cell generation. pTh17 cell transdifferentiation was assessed in functional assays by co-culturing AIEC-infected human dendritic cells (DCs) with autologous conventional Th17 (cTh17) cells isolated from blood of Healthy Donors (HD) or CD patients. AIEC triggered IL-23 hypersecretion and transdifferentiation of cTh17 into pTh17 cells selectively through the interaction with CD-derived DCs. Moreover, the chronic release of IL-23 by AIEC-colonized DCs required a continuous IL-23 neutralization to significantly reduce the AIEC-dependent pTh17 cell differentiation. The multi-step screenings of the AIEC mutant's library revealed that deletion of ybaT or rfaP efficiently hinder the IL-23 hypersecretion and hampered the AIEC-dependent skewing of protective cTh17 into pathogenic IFNγ-producing pTh17 cells. Overall, our findings indicate that ybaT (inner membrane transport protein) and rfaP (LPS-core heptose kinase) represent novel and attractive candidate targets to prevent chronic intestinal inflammation in CD.
Assuntos
Transdiferenciação Celular , Doença de Crohn , Células Dendríticas , Escherichia coli , Interleucina-23 , Células Th17 , Células Th17/imunologia , Doença de Crohn/imunologia , Doença de Crohn/genética , Humanos , Transdiferenciação Celular/genética , Células Dendríticas/imunologia , Interleucina-23/genética , Interleucina-23/metabolismo , Interleucina-23/imunologia , Escherichia coli/genética , Escherichia coli/imunologia , Proteínas de Escherichia coli/genética , Proteínas de Escherichia coli/metabolismo , Deleção de Genes , Interferon gama/metabolismo , Interferon gama/genética , Interferon gama/imunologia , Fatores de Virulência/genética , Fatores de Virulência/metabolismoRESUMO
Advances in biological degradation of per- and polyfluoroalkyl substances (PFAS) have shown that bioremediation is a promising method of PFAS mineralization; however, most of these studies focus on remediation of more reactive polyfluorinated compounds. This review focuses on the defluorination of the more recalcitrant perfluorinated alkyl acids (PFAAs) by bacteria. We highlight key studies that report PFAA degradation products, specific bacteria, and relevant genes. Among these studies, we discuss trends in anaerobic versus aerobic conditions with specific bacterial species or consortia. This holistic review seeks to elucidate the state of PFAA biodegradation research and discuss the need for future research for environmental application.
Assuntos
Bactérias , Biodegradação Ambiental , Fluorocarbonos , Fluorocarbonos/metabolismo , Fluorocarbonos/química , Bactérias/metabolismo , Poluentes Ambientais/metabolismoRESUMO
Frailty is an age-related syndrome that drives multiple physiological system impairments in some older adults, and its pathophysiological mechanisms remain unclear. We evaluated whether frailty-related biological processes could impair stem cell compartments, specifically the renal stem compartment, given that kidney dysfunctions are frequent in frailty. A well-characterized in vitro nephrosphere model of human adult renal stem/progenitor cells has been instrumental to and was appropriate for verifying this hypothesis in our current research. Evaluating the effects of plasma from older individuals with frailty (frail plasma) on allogeneic renal stem/progenitor cells, we showed significant functional impairment and nuclear DNA damage in the treated cells of the renal stem compartment. The analysis of the frail plasma revealed mitochondrial functional impairment associated with the activation of oxidative stress and a unique inflammatory mediator profile in frail individuals. In addition, the plasma of frail subjects also contained the highest percentage of DNA-damaged autologous circulating hematopoietic progenitor/stem cells. The integration of both molecular and functional data obtained allowed us to discern patterns associated with frailty status, irrespective of the comorbidities present in the frail individuals. The data obtained converged toward biological conditions that in frailty caused renal and hematopoietic impairment of stem cells, highlighting the possibility of concomitant exhaustion of several stem compartments.
RESUMO
In the spectrum of colorectal tumors, microsatellite-stable (MSS) tumors with DNA polymerase ε (POLE) mutations exhibit a hypermutated profile, holding the potential to respond to immunotherapy similarly to their microsatellite-instable (MSI) counterparts. Yet, due to their rarity and the associated testing costs, systematic screening for these mutations is not commonly pursued. Notably, the histopathological phenotype resulting from POLE mutations is theorized to resemble that of MSI. This resemblance not only could facilitate their detection by a transformer-based Deep Learning (DL) system trained on MSI pathology slides, but also indicates the possibility for MSS patients with POLE mutations to access enhanced treatment options, which might otherwise be overlooked. To harness this potential, we trained a Deep Learning classifier on a large dataset with the ground truth for microsatellite status and subsequently validated its capabilities for MSI and POLE detection across three external cohorts. Our model accurately identified MSI status in both the internal and external resection cohorts using pathology images alone. Notably, with a classification threshold of 0.5, over 75% of POLE driver mutant patients in the external resection cohorts were flagged as "positive" by a DL system trained on MSI status. In a clinical setting, deploying this DL model as a preliminary screening tool could facilitate the efficient identification of clinically relevant MSI and POLE mutations in colorectal tumors, in one go.
RESUMO
AIMS: To utilize the estimated glucose disposal rate (eGDR) index of insulin sensitivity, which is based on readily available clinical variables, namely, waist circumference, hypertension and glycated haemoglobin, to discriminate between metabolically healthy and unhealthy phenotypes, and to determine the prevalence of prediabetic conditions. METHODS: Non-diabetic individuals (n = 2201) were stratified into quartiles of insulin sensitivity based on eGDR index. Individuals in the upper quartiles of eGDR were defined as having metabolically healthy normal weight (MHNW), metabolically healthy overweight (MHOW) or metabolically healthy obesity (MHO) according to their body mass index, while those in the lower quartiles were classified as having metabolically unhealthy normal weight (MUNW), metabolically unhealthy overweight (MUOW) and metabolically unhealthy obesity (MUO), respectively. RESULTS: The frequency of impaired fasting glucose (IFG), impaired glucose tolerance (IGT), and IFG + IGT status was comparable among the MHNW, MHOW and MHO groups, while it increased from those with MUNW status towards those with MUOW and MUO status. As compared with participants with MHNW, the odds ratio of having IFG, IGT, or IFG + IGT was significantly higher in participants with MUOW and MUO but not in those with MUNW, MHOW and MHO, respectively. CONCLUSIONS: A metabolically healthy phenotype is associated with lower frequency of IFG, IGT, and IFG + IGT status across all body weight categories.
Assuntos
Adiposidade , Resistência à Insulina , Fenótipo , Estado Pré-Diabético , Humanos , Estado Pré-Diabético/epidemiologia , Estado Pré-Diabético/sangue , Masculino , Feminino , Pessoa de Meia-Idade , Adulto , Intolerância à Glucose/epidemiologia , Intolerância à Glucose/sangue , Prevalência , Índice de Massa Corporal , Obesidade/complicações , Obesidade/epidemiologia , Obesidade Metabolicamente Benigna/epidemiologia , Obesidade Metabolicamente Benigna/complicações , Hemoglobinas Glicadas/análise , Hemoglobinas Glicadas/metabolismo , Glicemia/metabolismo , Glicemia/análise , Circunferência da Cintura , Sobrepeso/complicações , Sobrepeso/epidemiologia , Estudos TransversaisRESUMO
We examine the characteristics and causes of southeast Australia's Tinderbox Drought (2017 to 2019) that preceded the Black Summer fire disaster. The Tinderbox Drought was characterized by cool season rainfall deficits of around -50% in three consecutive years, which was exceptionally unlikely in the context of natural variability alone. The precipitation deficits were initiated and sustained by an anomalous atmospheric circulation that diverted oceanic moisture away from the region, despite traditional indicators of drought risk in southeast Australia generally being in neutral states. Moisture deficits were intensified by unusually high temperatures, high vapor pressure deficits, and sustained reductions in terrestrial water availability. Anthropogenic forcing intensified the rainfall deficits of the Tinderbox Drought by around 18% with an interquartile range of 34.9 to -13.3% highlighting the considerable uncertainty in attributing droughts of this kind to human activity. Skillful predictability of this drought was possible by incorporating multiple remote and local predictors through machine learning, providing prospects for improving forecasting of droughts.
Assuntos
Mudança Climática , Secas , Humanos , Austrália , Temperatura Baixa , Aprendizado de MáquinaRESUMO
BACKGROUND AND AIMS: Our prior study showed that endothelial dysfunction contributed to reduced myocardial mechano-energetics efficiency (MEEi) independently of several confounders. Reduced activity of endothelial nitric oxide synthase may be due to increased levels of the endogenous inhibitor asymmetric dimethylarginine (ADMA). The impact of ADMA on myocardial MEEi has not been determined yet. This study aims to investigate the association between plasma ADMA levels and MEEi in drug-naïve hypertensive individuals. METHODS AND RESULTS: 63 hypertensive individuals participating in the CATAnzaro MEtabolic RIsk factors (CATAMERI) study were included. All participants underwent to an echocardiogram for myocardial MEEi measurement. ADMA plasma concentrations were measured by high-performance liquid chromatography. A multivariate linear regression analysis was conducted to investigate the independent association between ADMA levels and MEEi. In a univariate analysis, ADMA levels were significantly associated with myocardial MEEi (r = 0.438; P < 0.001). In a multivariate regression analysis, plasma ADMA levels were associated to decreased myocardial MEEi (ß = 0.458, P < 0.001) independently of well-established cardiovascular risk factors including age, sex, BMI, waist circumference, smoking status, total cholesterol and HDL, triglycerides, glucose tolerance status, and HOMA-IR index of insulin resistance. CONCLUSIONS: ADMA may contribute to reduced myocardial MEEi by reducing nitric oxide bioavailability.
Assuntos
Arginina/análogos & derivados , Hipertensão , Resistência à Insulina , Humanos , Hipertensão/diagnóstico , Fatores de RiscoRESUMO
BACKGROUND: Artificial intelligence (AI) has numerous applications in pathology, supporting diagnosis and prognostication in cancer. However, most AI models are trained on highly selected data, typically one tissue slide per patient. In reality, especially for large surgical resection specimens, dozens of slides can be available for each patient. Manually sorting and labelling whole-slide images (WSIs) is a very time-consuming process, hindering the direct application of AI on the collected tissue samples from large cohorts. In this study we addressed this issue by developing a deep-learning (DL)-based method for automatic curation of large pathology datasets with several slides per patient. METHODS: We collected multiple large multicentric datasets of colorectal cancer histopathological slides from the United Kingdom (FOXTROT, N = 21,384 slides; CR07, N = 7985 slides) and Germany (DACHS, N = 3606 slides). These datasets contained multiple types of tissue slides, including bowel resection specimens, endoscopic biopsies, lymph node resections, immunohistochemistry-stained slides, and tissue microarrays. We developed, trained, and tested a deep convolutional neural network model to predict the type of slide from the slide overview (thumbnail) image. The primary statistical endpoint was the macro-averaged area under the receiver operating curve (AUROCs) for detection of the type of slide. RESULTS: In the primary dataset (FOXTROT), with an AUROC of 0.995 [95% confidence interval [CI]: 0.994-0.996] the algorithm achieved a high classification performance and was able to accurately predict the type of slide from the thumbnail image alone. In the two external test cohorts (CR07, DACHS) AUROCs of 0.982 [95% CI: 0.979-0.985] and 0.875 [95% CI: 0.864-0.887] were observed, which indicates the generalizability of the trained model on unseen datasets. With a confidence threshold of 0.95, the model reached an accuracy of 94.6% (7331 classified cases) in CR07 and 85.1% (2752 classified cases) for the DACHS cohort. CONCLUSION: Our findings show that using the low-resolution thumbnail image is sufficient to accurately classify the type of slide in digital pathology. This can support researchers to make the vast resource of existing pathology archives accessible to modern AI models with only minimal manual annotations.
Assuntos
Neoplasias Colorretais , Aprendizado Profundo , Humanos , Neoplasias Colorretais/patologia , Neoplasias Colorretais/diagnóstico , Redes Neurais de Computação , Processamento de Imagem Assistida por Computador/métodos , Interpretação de Imagem Assistida por Computador/métodosRESUMO
BACKGROUND: Dietary interventions have been proposed as therapeutic approaches for several diseases, including cancer. A low-inflammatory Mediterranean dietary intervention, conducted as a pilot study in subjects with Familial Adenomatous Polyposis (FAP), reduced markers of local and systemic inflammation. We aim to determine whether this diet may modulate faecal microRNA (miRNA) and gene expression in the gut. METHODS: Changes in the faecal miRNome were evaluated by small RNA sequencing at baseline (T0), after the three-month intervention (T1), and after an additional three months (T2). Changes in the transcriptome of healthy rectal mucosa and adenomas were evaluated by RNA sequencing at T0 and T2. The identification of validated miRNA-gene interactions and functional analysis of miRNA targets were performed using in silico approaches. RESULTS: Twenty-seven subjects were included in this study. It was observed that the diet modulated 29 faecal miRNAs (p < 0.01; |log2 Fold Change|>1), and this modulation persisted for three months after the intervention. Levels of miR-3612-3p and miR-941 correlated with the adherence to the diet, miR-3670 and miR-4252-5p with faecal calprotectin, and miR-3670 and miR-6867 with serum calprotectin. Seventy genes were differentially expressed between adenoma and normal tissue, and most were different before the dietary intervention but reached similar levels after the diet. Functional enrichment analysis identified the proinflammatory ERK1/2, cell cycle regulation, and nutrient response pathways as commonly regulated by the modulated miRNAs and genes. CONCLUSIONS: Faecal miRNAs modulated by the dietary intervention target genes that participate in inflammation. Changes in levels of miRNAs and genes with oncogenic and tumour suppressor functions further support the potential cancer-preventive effect of the low-inflammatory Mediterranean diet. CLINICAL TRIAL NUMBER REGISTRATION: NCT04552405, Registered in ClinicalTrials.gov.
Assuntos
MicroRNAs , Neoplasias , Humanos , Inflamação/genética , Inflamação/prevenção & controle , Complexo Antígeno L1 Leucocitário , MicroRNAs/genética , Projetos PilotoRESUMO
Deep Learning (DL) can predict biomarkers from cancer histopathology. Several clinically approved applications use this technology. Most approaches, however, predict categorical labels, whereas biomarkers are often continuous measurements. We hypothesize that regression-based DL outperforms classification-based DL. Therefore, we develop and evaluate a self-supervised attention-based weakly supervised regression method that predicts continuous biomarkers directly from 11,671 images of patients across nine cancer types. We test our method for multiple clinically and biologically relevant biomarkers: homologous recombination deficiency score, a clinically used pan-cancer biomarker, as well as markers of key biological processes in the tumor microenvironment. Using regression significantly enhances the accuracy of biomarker prediction, while also improving the predictions' correspondence to regions of known clinical relevance over classification. In a large cohort of colorectal cancer patients, regression-based prediction scores provide a higher prognostic value than classification-based scores. Our open-source regression approach offers a promising alternative for continuous biomarker analysis in computational pathology.
Assuntos
Aprendizado Profundo , Neoplasias , Humanos , Biomarcadores Tumorais/genética , Tecnologia , Microambiente TumoralRESUMO
Recent discoveries have revealed that mature miRNAs could form highly ordered structures similar to aptamers, suggesting diverse functions beyond mRNA recognition and degradation. This study focuses on understanding the secondary structures of human miR-26b-5p (UUCAAGUAAUUCAGGAUAGGU) using circular dichroism (CD) and chiroptical probes; in particular, four achiral porphyrins were utilized to both act as chiroptical probes and influence miRNA thermodynamic stability. Various spectroscopic techniques, including UV-Vis, fluorescence, resonance light scattering (RLS), electronic circular dichroism (ECD), and CD melting, were employed to study their interactions. UV-Vis titration revealed that meso-tetrakis(4-N-methylpyridyl) porphyrin (H2T4) and meso-tetrakis(4-carboxyphenylspermine) porphyrin (H2TCPPSpm4) formed complexes with distinct binding stoichiometries up to 6 : 1 and 3 : 1 ratios, respectively, and these results were supported by RLS and fluorescence, while the zinc(II) derivative porphyrin ZnT4 exhibited a weaker interaction. ZnTCPPSpm4 formed aggregates in PBS with higher organization in the presence of miRNA. CD titrations displayed an induced CD signal in the Soret region for every porphyrin investigated, indicating that they can be used as chiroptical probes for miR-26b-5p. Lastly, CD melting experiments revealed that at a 1 : 1 ratio, porphyrins did not significantly affect miRNA stability, except for H2TCPPSpm4. However, at a 3 : 1 ratio, all porphyrins, except ZnTCPPSpm4, exhibited a strong destabilizing effect on miRNA secondary structures. These findings shed light on the structural versatility of miR-26b-5p and highlight the potential of porphyrins as chiroptical probes and modulators of miRNA stability.
Assuntos
MicroRNAs , Porfirinas , Humanos , Porfirinas/química , Zinco , Oligonucleotídeos , Dicroísmo CircularRESUMO
SARIFA (Stroma AReactive Invasion Front Areas) has recently emerged as a promising histopathological biomarker for colon and gastric cancer. To elucidate the underlying tumor biology, we assessed SARIFA-status in tissue specimens from The-Cancer-Genome-Atlas (TCGA) cohorts COAD (colonic adenocarcinoma) and READ (rectal adenocarcinoma). For the final analysis, 207 CRC patients could be included, consisting of 69 SARIFA-positive and 138 SARIFA-negative cases. In this external validation cohort, H&E-based SARIFA-positivity was strongly correlated with unfavorable overall, disease-specific, and progression-free survival, partly outperforming conventional prognostic factors. SARIFA-positivity was not associated with known high-risk genetic profiles, such as BRAF V600E mutations or microsatellite-stable status. Transcriptionally, SARIFA-positive CRCs exhibited an overlap with CRC consensus molecular subtypes CMS1 and CMS4, along with distinct differential gene expression patterns, linked to lipid metabolism and increased stromal cell infiltration scores (SIIS). Gene-expression-based drug sensitivity prediction revealed a differential treatment response in SARIFA-positive CRCs. In conclusion, SARIFA represents the H&E-based counterpart of an aggressive tumor biology, demonstrating a partial overlap with CMS1/4 and also adding a further biological layer related to lipid metabolism. Our findings underscore SARIFA-status as an ideal biomarker for refined patient stratification and novel drug developments, particularly given its cost-effective assessment based on routinely available H&E slides.
Assuntos
Adenocarcinoma , Neoplasias Colorretais , Humanos , Prognóstico , Neoplasias Colorretais/patologia , Biomarcadores Tumorais/genética , Biomarcadores Tumorais/metabolismo , Instabilidade de Microssatélites , BiologiaRESUMO
INTRODUCTION: This cross-sectional study aimed to investigate the association between myocardial mechano-energetic efficiency (MEE) and whole blood viscosity (WBV) in nondiabetic adults participating in the CATAnzaro MEtabolic RIsk factors (CATAMERI) study. METHODS: 1143 participants underwent an oral glucose tolerance test and an echocardiogram for myocardial MEE per gram of left ventricular mass (MEEi) measurement. WBV was measured as: [0.12 × h] + [0.17 × (p-2.07)], where h is haematocrit and p is plasma protein levels. RESULTS: Study population includes 595 males and 548 females with a mean age of 46 ± 12 years and a mean BMI of 30.0 ± 6.2 kg/m2 . Individuals with normal glucose tolerance were 63%, while those with impaired fasting glucose, impaired glucose tolerance and or the combination of both were 14.3%, 13% and 9.7%, respectively. A univariate analysis showed that MEEi was significantly associated with sex, age, smoking, BMI, waist circumference, total cholesterol, HDL, triglycerides, fasting glucose, fasting insulin, HOMA-IR index, glucose tolerance, C-reactive protein, haematocrit, haemoglobin, plasma protein and WBV. In a multivariable regression model including variables that were significantly associated with MEEi in univariate analysis, MEEi was associated with HOMA-IR (ß = -0.144, p < .001), age (ß = -0.140, p < .001), WBV (ß = -0.129, p < .001) and glucose tolerance (ß = -0.064, p = .04). The independent association between WBV and MEEi remained statistically significant (ß = -0.122, p < .001) when antihypertensive therapy and lipid-lowering therapy were included in the model. CONCLUSION: WBV is associated with decreased myocardial MEE independently of other cardiovascular risk factors.