RESUMO
The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.
RESUMO
The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.
RESUMO
BACKGROUND AND OBJECTIVE: Limitations of current periodontal regeneration modalities in both predictability and extent of healing response, especially on new cementum and attachment formation, underscore the importance of restoring or providing a microenvironment that is capable of promoting the differentiation of periodontal ligament stem cells (PDLSCs) towards cementoblast-like cells and the formation of cementum/periodontal ligament-like tissues. The aim of this study was to investigate the biological effect of conditioned medium from developing apical tooth germ cells (APTG-CM) on the differentiation and cementogenesis of PDLSCs both in vitro and in vivo. MATERIAL AND METHODS: Using the limiting dilution technique, single-colony-derived human PDLSCs were isolated and expanded to obtain homogeneous populations of PDLSCs. Morphological appearance, cell cycle analysis, bromodeoxyuridine incorporation, alkaline phosphatase (ALP) activity, mineralization behavior, gene expression of cementoblast phenotype and in vivo differentiation capacities of PDLSCs co-cultured with APTG-CM were evaluated. RESULTS: The induced PDLSCs exhibited several characteristics of cementoblast lineages, as indicated by the morphological changes, increased proliferation, high ALP activity, and the expression of cementum-related genes and calcified nodule formation in vitro. When transplanted into immunocompromised mice, the induced PDLSCs showed tissue-regenerative capacity to produce cementum/periodontal ligament-like structures, characterized by a layer of cementum-like mineralized tissues and associated periodontal ligament-like collagen fibers connecting with the newly formed cementum-like deposits, whereas control, untreated PDLSCs transplants mainly formed connective tissues. CONCLUSION: Our findings suggest that APTG-CM is able to provide a cementogenic microenvironment and induce differentiation of PDLSCs along the cementoblastic lineage. This has important implications for periodontal engineering.
