Study of the Serum Immunoglobulin and Cell-Mediated Immunity in Patients with Congenital Severe Hemophilia.

BACKGROUND: It has been shown that a close relationship exists between the immune system and coagulation cascade. Hemophilia A is an X-linked, recessive bleeding disorder caused by deficiency of functional plasma clotting factor VIII that is classically treated with factor VIII replacement therapy. Despite this, some patients produce inhibitors or antibodies against epitopes of infused factor VIII, indicating the activation of the adaptive immune system. The aim of this study was to evaluate the change in the T cell frequency and serum immunoglobulin level in patients with congenital hemophilia A, especially those who produce inhibitors against factor VIII. METHODS: This is a cross-sectional, case-control study on congenital hemophilia A patients with severe factor VIII deficiency. Twenty-eight hemophilia A male patients were randomly selected along with twenty age-matched healthy males, as the control group. Serum immunoglobulin concentration was measured by nephelometry (for IgG, IgA and IgM) and enzyme-linked immunosorbent assay (ELISA) (for IgE) and the frequency of CD4+ and CD8+ T cells were calculated using a flow cytometry method. RESULTS: Serum IgG was significantly higher in hemophilic patients compared to controls (14.35 ± 3.60, vs. 12.4 ± 1.72, p = 0.014). Among IgG subtypes, the IgG1 antibody was significantly higher in hemophilia patients than control group (p < 0.001). The frequency of CD4+ as well as CD8+ T cells did not significantly differ between patients and control group (p > 0.05). There was no significant difference between patients with and without inhibitors re-garding serum immunoglobulin level, different IgG subtypes, the frequency of CD4+ and CD8+ T cells as well as CD4/CD8 ratio (p > 0.05). CONCLUSIONS: Patients with hemophilia A have high levels of serum immunoglobulin especially IgG1. Therefore, further larger studies along with close observation and evaluation of the presence of serum inhibitor is recommended every 3 months.

A Homozygous Mutation on the HBA1 Gene Coding for Hb Charlieu (HBA1: c.320T>C) Together with ß-Thalassemia Trait Results in Severe Hemolytic Anemia.

A 4-year-old boy, a ß-thalassemia (ß-thal) carrier, with an unexplained severe chronic microcytic anemia was referred to us. Sequencing of the α-globin genes revealed a Hb Charlieu [α106(G13)Leu→Pro, HBA1: c.320T>C, p.Leu107Pro] mutation present on both HBA1 genes. Quantitative polymerase chain reaction (qPCR) confirmed αCharlieu mRNA in the proband and his parents, showing that the mutation does not affect mRNA stability. However, we were unable to detect the Hb Charlieu protein by capillary electrophoresis (CE), reverse phase electrophoresis, cation exchange electrophoresis or isoelectric focusing. Mass spectrometry (MS) allowed us to confirm the presence of the Hb Charlieu peptide in erythrocyte progenitors. These findings suggest that the mutation affects the stability of αCharlieu. As hemoglobin (Hb) heat stability tests showed no abnormalities in erythrocytes, we speculated that αCharlieu is already degraded during red blood cell (RBC) development. The clinical severity in the proband and the presence of new methylene blue-stained aggregates in his reticulocytes indicates that incorporation of αCharlieu destabilizes Hb. This, combined with an excess of unstable free α-globins as the result of ß-thal minor, results in severely impaired erythropoiesis and, as a consequence, severe and chronic microcytic anemia in the proband.

The frequency of hypothyroidism and its relationship with HCV positivity in patients with thalassemia major in southern Iran.

INTRODUCTION: Hypothyroidism is one the most complication due to iron overload in patients with ß-thalassemia major (TM). On the other hand these patients are prone to Hepatitis C virus (HCV) infection that can cause  thyroid dysfunction by itself or as the side effect of treatment with interferon (INF) or IFN plus ribavirin. The aim of this study is to evaluate the association of hypothyroidism with HCV positivity and serum ferritin levels in patients with TM. METHODS: In this cross-sectional study, 201 randomly selected patients with TM who were registered at the Thalassemia Clinic of a tertiary hospital in Shiraz, southern Iran were investigated. Thyroid function tests and serologic screening assays for HCV seropositivity (HCV Ab and HCV-RNA) were conducted for all patients. RESULTS: Frequency of hypothyroidism was 22.9% including 19.9% subclinical hypothyroidism, 2% primary overt hypothyroidism and 1% central hypothyroidism. Eighty six patients (42.8%) were HCV Ab positive and 60 patients (29.9%) were HCV RNA positive. No significant relationship was found between hypothyroidism and HCV positivity or receiving IFN-α (P>0.05). Hypothyroidism showed a borderline significant association with high serum ferritin levels in TM patients (P=0.055). CONCLUSION: Our results showed no significant association between hypothyroidism and HCV infection in TM patients. It seems that the main mechanism of hypothyroidism in our patients is iron overload; however, for better evaluation a larger multicenter study is recommended.  Also due to the importance of consequences of HCV infection, more careful pre-transfusional screening of blood should be considered in TM patients.

Residual pyruvate kinase activity in PKLR-deficient erythroid precursors of a patient suffering from severe haemolytic anaemia.

OBJECTIVE: Here, we present a 7-year-old patient suffering from severe haemolytic anaemia. The most common cause of chronic hereditary non-spherocytic haemolytic anaemia is red blood cell pyruvate kinase (PK-R) deficiency. Because red blood cells rely solely on glycolysis to generate ATP, PK-R deficiency can severely impact energy supply and cause reduction in red blood cell lifespan. We determined the underlying cause of the anaemia and investigated how erythroid precursors in the patient survive. METHODS: PK activity assays, Western blot and Sanger sequencing were employed to determine the underlying cause of the anaemia. Patient erythroblasts were cultured and reticulocytes were isolated to determine PK-R and PKM2 contribution to glycolytic activity during erythrocyte development. RESULTS: We found a novel homozygous mutation (c.583G>A) in the PK-R coding gene (PKLR). Although this mutation did not influence PKLR mRNA production, no PK-R protein could be detected in the red blood cells nor in its precursors. In spite of the absence of PK-R, the reticulocytes of the patient exhibited 20% PK activity compared with control. Western blotting revealed that patient erythroid precursors, like controls, express residual PKM2. CONCLUSIONS: We conclude that PKM2 rescues glycolysis in PK-R-deficient erythroid precursors.

Introduction of novel α1-hemoglobin gene mutation with transfusion-dependent phenotype.

OBJECTIVE AND IMPORTANCE: Thalassemia is the most frequently monogenetic disorders around the world that is inherited as a recessive single-gene disease, resulting from mutations in α- or ß-globin gene clusters. The aim of this report was to present a new insertional mutation in the α1 globin gene which causes transfusion-dependent anemia in α-thalassemic patients. CLINICAL PRESENTATION: Two 5-year-old girls with blood transfusion-dependent α-thalassemia anemia and another girl with moderate α-thalassemia have been presented among patients who have been referred to Hematology and Thalassemia Research Center, Dastgheib Hospital, Shiraz, Iran. They were not relatives. All children were stunted and pale; they were put on regular blood transfusion every 14-21 days. INTERVENTION: Sequencing of the ß-globin gene was normal in all cases and their parents; but, α-globin gene sequencing results were remarkable. An insertion of 21 base pairs (IVS II+3ins (+21nt)(+GACCCGGTCAACTTCAAGGTG) in the α1-globin gene was detected in all three cases and one of their parents. In two cases, this insertion was accompanied by MED deletion and in one child by POLY A1 mutation. MED deletion was detected by gap-PCR. CONCLUSION: This new 21 base pair insertion cannot affect blood parameters on its own, but can present as continuous blood transfusion-dependent α-thalassemia. Thus, it is important to take this point into account for detecting the carriers, like ß-thalassemia carriers, which can present as transfusion-dependent children in parents with α-thalassemia trait.

A Number of Cases in Iran Presenting with Coinheritance of Hemoglobin-H Disease and Beta-Thalassemia Minor.

Thalassemias are a group of inherited hematological disorders caused by defects in the synthesis of one or more of the hemoglobin (Hb) chains. The ß- and α-thalassemias are widespread throughout the Mediterranean region, the Middle East, and Southeast Asia including Iran. In this study, we report five patients known to carry a coinheritance of Hb H (ß4) disease and ß-thalassemia (ß-thal) minor. There is a high prevalence of consanguineous marriages in our population and the high rate of thalassemia determinants can cause coinheritance of α- and ß-thal. Therefore, it is of special interest to report coinheritance of Hb H disease and ß-thal minor which could lead to misdiagnosis.

Relationship Between Serum Hepcidin and Ferritin Levels in Patients With Thalassemia Major and Intermedia in Southern Iran.

BACKGROUND: Hepcidin is a key regulator of iron absorption in humans. It is mainly affected by hypoxia and iron stores. OBJECTIVES: The current study aimed to determine the correlation between serum hepcidin and ferritin levels in patients with Thalassemia Major (TM) and Thalassemia Intermedia (TI). PATIENTS AND METHODS: The current cross-sectional study investigated 88 randomly selected patients with Thalassemia, 48 TM and 40 TI, registered at the Thalassemia Clinic of Shiraz University of Medical Sciences, a referral center for Thalassemia in Southern Iran in 2013. All patients with TI were receiving Hydroxyurea (HU) 10 - 15 mg/kg/day for at least 10 years. The serum hepcidin, ferritin levels, hemoglobin (Hb) and nucleated Red Blood Cell (RBC) of the two groups were measured. RESULTS: No statistically significant correlation was observed between serum hepcidin and ferritin levels in any of the two groups of patients with TM (rs = 0.02, P = 0.892) or TI (rs = 0.055, P = 0.734). The median Interquartile Range (IQR) for serum hepcidin and ferritin levels were significantly higher in TM compared to TI group, (hepcidin: 87.6 (43.9) vs. 51.8 (23.4), P < 0.001; ferritin: 2208 (3761) vs. 465 (632), P < 0.001). CONCLUSIONS: There was insignificant correlation between serum hepcidin and ferritin levels in the two groups of patients with TM and TI. It seems that regulation of hepcidin in patients with Thalassemia is more affected by erythropoeitic activity than iron stores. Also, hepcidin levels were significantly higher in patients with TM than TI, possibly due to higher erythropoeitic activity in TI. In TI, it seems that low dose HU increases Hb levels and leads to transfusion-independence, but it is not high enough to suppress bone marrow activity and ineffective erythropoiesis. Consequently, serum hepcidin level decreases.

Effectiveness of ß-thalassemia prenatal diagnosis in Southern Iran: a cohort study.

AIM: The aim of this study was to evaluate the effectiveness of prenatal diagnosis (PND) for the prevention of thalassemia in Southern Iran. METHODS: From 2004 to 2012 1346 couples with ß-thalassemia minor were referred to our center. Mutation analyses utilized different methods including polymerase chain reaction-based technique of amplification refractory mutation system (ARMS), Restriction Fragment Length Polymorphism Analysis of PCR-Amplified Fragments (PCR-RFLP) and Gel Electrophoresis and direct sequencing. Haplotype analysis of the ß-globin gene cluster was done routinely using the PCR-RFLP technique. RESULTS: Of the 1346 couples, 884 (66%) requested PND. They had a total of 985 pregnancies (954 singleton and 31 twin pregnancies): the 1016 fetuses underwent chorionic villus sampling (CVS). Thalassemia major was diagnosed in 266 cases (26.2%), and termination of pregnancy was requested by the parents in 264 of them (99%). Thalassemia trait was detected in 499 (49.1%) and 251 cases (24.7%) showed no ß-thalassemia mutations. There were three misdiagnoses (0.4%) (affected children diagnosed as carriers at PND). A unique pattern of thalassemia mutations was present in the study population, with IVS II-I (G→A), C36-37(-T), IVS I-5(G>C), -25bpdel (252-276), IVS I-110(G>A) and C44 (-C) being present in 62% of cases. CONCLUSION: The pattern of distribution of thalassemia mutations differs among ethnic groups within the same country.

The Frequency of Adrenal Insufficiency in Adolescents and Young Adults with Thalassemia Major versus Thalassemia Intermedia in Iran.

BACKGROUND: Endocrine dysfunction is not uncommon complication in patients with transfusion-dependent thalassemia and is thought to occur as a consequence of excessive iron overload. The primary objective of this study is to determine the frequency of adrenal insufficiency in patients with thalassemia major and thalassemia intermediate. METHODS: This cross-sectional study was done at the Shiraz University of Medical Sciences, Shiraz, Southern Iran, in 2013. One hundred and ninety patients were divided into two groups; thalassemia major(TM) and thalassemia intermediate (TI) groups. We measured 8 AM serum cortisol, ACTH and ferritin concentrations in all patients. RESULTS: The mean age of the TM and TI group were 22.5±5.7 and 23.8±6 years, respectively. 90 patients (47.4%) were splenectomized, 34 (36.2%) with TM and 56 (58.2%) with TI (p :<0.001). The median and interquartile range of serum ferritin levels were 2184±3700 ng/ml and 437±443ng/ml in TM and TI respectively (p< 0.001). Three patients with TM (1.6%) had low basal cortisol and ACTH levels. However, their cortisol response to ACTH stimulation was normal. CONCLUSIONS: Low basal concentrations of cortisol and ACTH occurred in 1.6% of our adolescents young adult patients with TM suggesting a central defect in cortisol secretion at the basal state. However, cortisol response to standard - dose ACTH was normal in all patients with TM and TI.

Distribution of alpha-thalassemia mutations in Iranian population.

BACKGROUND: Alpha-thalassemia as one of the most common monogenetic disorders is widely spread over the Mediterranean, Southeast Asian, and Middle Eastern populations, including Iran. Although beta-thalassemia is much more common than alpha-thalassemia, alpha-thalassemia is still one of the main health problems in Iran with different mutation frequencies in various ethnic groups. So the evaluation of alpha-thalassemia mutations could be helpful to detect carriers as well as prevention strategy in Iranian population. OBJECTIVES: The aim of this study was to investigate the spectrum and frequencies of alpha-globin mutations in different ethnic groups of southern Iran. MATERIALS AND METHODS: Common alpha-globin mutations were evaluated in 4010 Iranian population using a reverse dot blot for all point mutations and gap-polymerase chain reaction. RESULTS: Out of all individuals, 3993 were distinguished as carriers of alpha-thalassemia mutations. Thirteen types of alpha-thalassemia mutations were discovered. Allele of α(3.7) mutation was the most prevalent (43.84%) followed by the α(IVS1/-5NT) allele with the prevalence of 4.91%. The less frequent alleles were Hb ICARIA and α(codon16) with the prevalence of 0.04 and 0.01%, respectively. CONCLUSION: Our findings are essential for carrier screening, genetic counseling, and prenatal diagnosis in order to decrease the prevalence of α-thalassemia in Iran which is one of the goals of the national screening program.

Serum cancer antigen 15.3 concentrations in patients with betathalassemia minor compared to those with cancer and healthy individuals.

BACKGROUND: High serum level of cancer antigen 15.3 (CA15.3) has been reported in some malignant and nonmalignant conditions including thalassemia major which could have been resulted from ineffective erythropoiesis. We aimed to evaluate the serum level of CA15.3 in carriers of beta-thalassemia by comparing them with cancer patients and healthy individuals. METHODS: This cross-sectional study was done from February to December 2011 in Southern Iran. Participants consisted of 32 subjects with beta-thalassemia minor, 49 with cancer and 25 healthy individuals. The serum levels of CA15.3 were measured and compared in different groups. RESULTS: The serum levels of CA 15.3 in all participants were in the normal range (<35 U/mL). Also it did not significantly differ among various groups of the participants (p=0.723). Age was not significantly correlated with the serum level of CA 15.3 (r= 0.039, p=0.702). The most frequent cancer in the group of patients with malignancies was hematologic malignancies (96%) with the highest frequency for acute lymphoblastic leukemia (37 patients). Frequency of thalassemia minor in patients with cancer was 11 (22.4%). CONCLUSION: No correlation was found between CA 15.3 serum level with beta-thalssemia minor or with childhood malignancies. Compared to general population, a high proportion of beta-thalssemia minor was observed in patients with cancer in our study. Future prospective studies are needed to evaluate the relationship between cancer and beta-thalassemia minor accurately.

Genotype-phenotype correlation related to lipid profile in beta-thalassemia major and intermedia in southern Iran.

BACKGROUND: Beta-thalassemia is commonly associated with lipid abnormalities. The aim of this study was to search for links between these lipid alterations and different types of ß-thalassemia mutations. METHODS: The study, conducted from 2009 to 2010, included 100 patients with thalassemia major (TM) and 100 with thalassemia intermedia (TI). The control group was selected from 100 age- and sex-matched healthy individuals with normal hematologic indices. Serum lipid profiles, including total cholesterol (TC), low-density lipoprotein cholesterol (LDL-C), high-density lipoprotein cholesterol (HDL-C) and triglycerides (TG), were determined and their relationship with different covariates, including different ß-globin gene mutations, was analyzed. RESULTS: Patients with TI had significantly lower values for TC, LDL-C, HDL-C, and LDL-C/HDL-C ratio compared with TM patients and controls (P < .001). TG was greater in TM compared with TI patients (P = .001) and healthy individuals (P = .007). Hemoglobin was positively associated with TC (P < .001), LDL-C (P = .004), and HDL-C (P = .01) in TM patients. Splenectomy correlated with greater TC (P = .006) and LDL-C (P = .01) in TI patients, but only with greater LDL-C in TM patients (P = .02). The average amounts of TC and LDL-C were lower in persons with the ß(0)/ß(0) mutation compared with the ß(+)/ß(+) group. CONCLUSION: Lower amounts of TG, TC, LDL-C, and HDL-C were seen in TI patients compared with TM patients and healthy individuals. The severity of the genotype (ie, ß(0) type mutations compared with ß(+) type mutations) affected the degree of reduction in serum lipids.

Spectrum of inherited bleeding disorders in southern Iran, before and after the establishment of comprehensive coagulation laboratory.

The objective of the present study was to determine the pattern of inherited bleeding disorders in southern Iran and evaluate the effect of a comprehensive coagulation laboratory and related efforts. A total of 545 patients with inherited bleeding disorders were evaluated during 1992-2007 by a cross-sectional study. Data were collected by a data-gathering form. Statistical analysis was done using Statistical Package for the Social Sciences version 15. A P value less than 0.05 was considered statistically significant. Overall 411 patients had common bleeding disorders including 326 hemophilia A, 46 hemophilia B, and 39 von Willebrand disease. Seventy-nine patients had rare coagulation disorders including deficiency of factor VII (n = 26), factor X (n = 18), factor XIII (n = 9), factor I (n = 9), factor XI (n = 7), factor V (n = 4), combined factor VIII and factor V (n = 4), and combined factor X and factor VII (n = 2). Fifty-five patients had platelet disorders including 23 with Glanzmann's thrombasthenia, 15 with Bernard-Soulier syndrome, and 17 with other platelet disorders, most of which (45) were diagnosed after the establishment of the comprehensive coagulation laboratory. Annual mean number of new diagnosed patients with common and rare bleeding disorders increased from 29 +/- 4 to 38 +/- 17. The ratio of the patients diagnosed with rare bleeding disorders to common bleeding disorders significantly increased after the establishment of the comprehensive diagnosis laboratory (P < 0.001).It seems that implementation of collaborative projects by the Shiraz Hemophilia Society and the establishment of the comprehensive coagulation laboratory and treatment centers have been successful in increasing diagnosis of the inherited bleeding disorders and consequently better management of the patients.

Factor XI deficiency in Southern Iran: identification of a novel missense mutation.

Factor XI (FXI)-deficiency is a rare coagulation disorder inherited as an autosomal recessive trait, which is most common in Ashkenazi Jews, but also found in other groups like Moslems. We have reviewed for the first time cases of FXI deficiency in southern Iran in order to analyze their mutations related to factor XI, the main clinical and biological features, levels of circulating factor XI, and bleeding history. All 15 exons and exon-intron boundaries of F11 were polymerase chain reaction amplified using sets of primers designed on the basis of the known genomic sequence of the gene. Among bleeding disorder cases, five were FXI-deficient. FXI clotting activity ranged 0.39-16%. All were severely deficient. In all analyzed patients, functional level of FXI was markedly reduced, confirming the diagnosis of quantitative FXI deficiency. Sequencing of F11 identified three mutations: (1) a highly prevalent type II nonsense mutation (Glu117stop) in a homozygous patient, (2) a previously reported missense (Glu547Lys), and (3) novel missense (Gly372Ala) mutation. No causative mutation was found in the sequenced regions of other patients. One novel mutation and two previously described mutations were identified in patients living in southern Iran. No recurrent mutation was found, perhaps because there is a more intense population mixing in southern Iran. Screening a higher number of FXI-deficient patients will also be necessary to reveal the existence of a founder effect for these mutations in the Iranian population.

Prevalence of beta-thalassemia trait and glucose-6-phosphate dehydrogenase deficiency in Iranian Jews.

BACKGROUND: beta-thalassemia is the most common inherited single gene disorder worldwide, and glucose-6-phosphate dehydrogenase (G6PD) deficiency is the most common human enzyme deficiency. The goal of this study was to compare the frequency of beta-thalassemia trait and G6PD among the Moslem and Jewish populations in Shiraz, southern Iran. METHODS: We examined 201 Moslems and 187 Jewish subjects who were selected by random sampling. For diagnosis of thalassemia, complete blood count and hemoglobin electrophoresis were carried out and for G6PD deficiency, fluorescent spot test methods were used as a screening test. RESULTS: Among Moslem subjects, 14 cases (7.0%) were diagnosed as carriers of beta-thalassemia minor, whereas no carriers were detected among Jewish subjects. Seven Moslems (7%) and eight Jewish subjects (7.5%) were found to have G6PD deficiency. Among both groups the most common mutation was the Mediterranean type (563 C>T). In one Moslem subject, the detected mutation was 1003 (G>A) and in two Jewish subjects the mutations were 1376 (G>T) and G6PD A-. CONCLUSIONS: Whereas the frequency of beta-thalassemia minor among Moslems is higher than in the Jews in Shiraz, the frequency of G6PD deficiency was not significantly different in the two populations. These findings suggest that obligatory premarital beta-thalassemia screening for Jews in the community is not necessary, whereas neonatal screening for G6PD could be useful for both Jews and Moslems.