Deep learning for the automatic detection and segmentation of parotid gland tumors on MRI.

OBJECTIVES: Parotid gland tumors (PGTs) often occur as incidental findings on magnetic resonance images (MRI) that may be overlooked. This study aimed to construct and validate a deep learning model to automatically identify parotid glands (PGs) with a PGT from normal PGs, and in those with a PGT to segment the tumor. MATERIALS AND METHODS: The nnUNet combined with a PG-specific post-processing procedure was used to develop the deep learning model trained on T1-weighed images (T1WI) in 311 patients (180 PGs with tumors and 442 normal PGs) and fat-suppressed (FS)-T2WI in 257 patients (125 PGs with tumors and 389 normal PGs), for detecting and segmenting PGTs with five-fold cross-validation. Additional validation set separated by time, comprising T1WI in 34 and FS-T2WI in 41 patients, was used to validate the model performance. RESULTS AND CONCLUSION: To identify PGs with tumors from normal PGs, using combined T1WI and FS-T2WI, the deep learning model achieved an accuracy, sensitivity and specificity of 98.2% (497/506), 100% (119/119) and 97.7% (378/387), respectively, in the cross-validation set and 98.5% (67/68), 100% (20/20) and 97.9% (47/48), respectively, in the validation set. For patients with PGTs, automatic segmentation of PGTs on T1WI and FS-T2WI achieved mean dice coefficients of 86.1% and 84.2%, respectively, in the cross-validation set, and of 85.9% and 81.0%, respectively, in the validation set. The proposed deep learning model may assist the detection and segmentation of PGTs and, by acting as a second pair of eyes, ensure that incidentally detected PGTs on MRI are not missed.

SIVA-1 enhances acquired chemotherapeutic drug resistance of gastric cancer in vivo by regulating the ARF/MDM2/p53 pathway.

SIVA-1 has been shown to affect apoptotic processes in various different cell lines, and SIVA-1 significantly contributes to the decreased responsiveness of cancer cells to some chemotherapy agents. However, whether SIVA-1 has potential application in gastric cancer remains unknown. Therefore, the objective of this investigation was to clarify the distinct function of SIVA-1 in chemotherapeutic drug resistance within a living murine model with gastric malignancy, and initially elucidate the underlying mechanisms. In an established multidrug-resistant gastric cancer xenograft mouse model, lentivirus, named Lv-SIVA-1, was injected into xenograft tumors, and increased the mRNA and protein expression of endogenous SIVA-1 in tumors. Immunohistochemical assays of xenograft tumor showed that SIVA-1 was significantly upregulated, and the protein expression levels of SIVA-1 were highly increased, as detected by Western blotting. In addition, we detected the role of SIVA-1 in cell proliferation and cell apoptosis in gastric cancer cells by TUNEL and found that SIVA-1 decreased tumor cell apoptosis and promoted tumor growth in vivo. Using a TMT assay between tumor tissues of experimental and control groups, differentially expressed proteins were examined and three potential biomarkers of multidrug resistance (ARF, MDM2, and p53) were screened. We further investigated the molecular mechanism by which SIVA-1 played an efficient role against chemotherapies and found that overexpressed SIVA-1 leads to increased ARF and MDM2 expression and suppressed expression of p53 in tumor tissue. In conclusion, SIVA-1 plays a significant role in the multidrug resistance of gastric tumors. In addition, overexpressed SIVA-1 positively regulates cell proliferation, adjusts cycle progression, and reduces the response to drug treatment for gastric cancer in an ARF/MDM2/p53-dependent manner. This novel research provides a basis for chemical management of gastric cancer through regulation of SIVA-1 expression.

Pulmonary Transit Time Derived from First-Pass Perfusion Cardiac MR Imaging: A Potential New Marker for Cardiac Involvement and Prognosis in Light-Chain Amyloidosis.

BACKGROUND: First-pass perfusion cardiac MR imaging could reflect pulmonary hemodynamics. However, the clinical value of pulmonary transit time (PTT) derived from first-pass perfusion MRI in light-chain (AL) amyloidosis requires further evaluation. PURPOSE: To assess the clinical and prognostic value of PTT in patients with AL amyloidosis. STUDY TYPE: Prospective observational study. POPULATION: 226 biopsy-proven systemic AL amyloidosis patients (age 58.62 ± 10.10 years, 135 males) and 43 healthy controls (age 42 ± 16.2 years, 20 males). FIELD STRENGTH/SEQUENCE: SSFP cine and phase sensitive inversion recovery late gadolinium enhancement (LGE) sequences, and multislice first-pass myocardial perfusion imaging with a saturation recovery turbo fast low-angle shot (SR-TurboFLASH) pulse sequence at 3.0T. ASSESSMENT: PTT was measured as the time interval between the peaks of right and left ventricular cavity arterial input function curves on first-pass perfusion MR images. STATISTICAL TESTS: Independent-sample t test, Mann-Whitney U test, Chi-square test, Fisher's exact test, analysis of variance, or Kruskal-Wallis test, as appropriate; univariable and multivariable Cox proportional hazards models and Kaplan-Meier curves, area under receiver operating characteristic curve were used to determine statistical significance. RESULTS: PTT could differentiate AL amyloidosis patients with (N = 188) and without (N = 38) cardiac involvement (area under the curve [AUC] = 0.839). During a median follow-up of 35 months, 160 patients (70.8%) demonstrated all-cause mortality. After adjustments for clinical (Hazard ratio [HR] 1.061, confidence interval [CI]: 1.021-1.102), biochemical (HR 1.055, CI: 1.014-1.097), cardiac MRI-derived (HR 1.077, CI: 1.034-1.123), and therapeutic (HR 1.063, CI: 1.024-1.103) factors, PTT predicted mortality independently in patients with AL amyloidosis. Finally, PTT could identify worse outcomes in patients demonstrating New York Heart Association class III, Mayo 2004 stage III, and transmural LGE pattern. DATA CONCLUSION: PTT may serve as a new imaging predictor of cardiac involvement and prognosis in AL amyloidosis. LEVEL OF EVIDENCE: 2 TECHNICAL EFFICACY: Stage 2.

Feasibility of Free-Breathing, Non-ECG-Gated, Black-Blood Cine Magnetic Resonance Images With Multitasking in Measuring Left Ventricular Function Indices.

OBJECTIVE: To clinically validate the feasibility and accuracy of cine images acquired through the multitasking method, with no electrocardiogram gating and free-breathing, in measuring left ventricular (LV) function indices by comparing them with those acquired through the balanced steady-state free precession (bSSFP) method, with multiple breath-holds and electrocardiogram gating. MATERIALS AND METHODS: Forty-three healthy volunteers (female:male, 30:13; mean age, 23.1 ± 2.3 years) and 36 patients requiring an assessment of LV function for various clinical indications (female:male, 22:14; 57.8 ± 11.3 years) were enrolled in this prospective study. Each participant underwent cardiac magnetic resonance imaging (MRI) using the multiple breath-hold bSSFP method and free-breathing multitasking method. LV function parameters were measured for both MRI methods. Image quality was assessed through subjective image quality scores (1 to 5) and calculation of the contrast-to-noise ratio (CNR) between the myocardium and blood pool. Differences between the two MRI methods were analyzed using the Bland-Altman plot, paired t-test, or Wilcoxon signed-rank test, as appropriate. RESULTS: LV ejection fraction (LVEF) was not significantly different between the two MRI methods (P = 0.222 in healthy volunteers and P = 0.343 in patients). LV end-diastolic mass was slightly overestimated with multitasking in both healthy volunteers (multitasking vs. bSSFP, 60.5 ± 10.7 g vs. 58.0 ± 10.4 g, respectively; P < 0.001) and patients (69.4 ± 18.1 g vs. 66.8 ± 18.0 g, respectively; P = 0.003). Acceptable and comparable image quality was achieved for both MRI methods (multitasking vs. bSSFP, 4.5 ± 0.7 vs. 4.6 ± 0.6, respectively; P = 0.203). The CNR between the myocardium and blood pool showed no significant differences between the two MRI methods (18.89 ± 6.65 vs. 18.19 ± 5.83, respectively; P = 0.480). CONCLUSION: Multitasking-derived cine images obtained without electrocardiogram gating and breath-holding achieved similar image quality and accurate quantification of LVEF in healthy volunteers and patients.

Mitochondrial fission drives neuronal metabolic burden to promote stress susceptibility in male mice.

Neurons are particularly susceptible to energy fluctuations in response to stress. Mitochondrial fission is highly regulated to generate ATP via oxidative phosphorylation; however, the role of a regulator of mitochondrial fission in neuronal energy metabolism and synaptic efficacy under chronic stress remains elusive. Here, we show that chronic stress promotes mitochondrial fission in the medial prefrontal cortex via activating dynamin-related protein 1 (Drp1), resulting in mitochondrial dysfunction in male mice. Both pharmacological inhibition and genetic reduction of Drp1 ameliorates the deficit of excitatory synaptic transmission and stress-related depressive-like behavior. In addition, enhancing Drp1 fission promotes stress susceptibility, which is alleviated by coenzyme Q10, which potentiates mitochondrial ATP production. Together, our findings unmask the role of Drp1-dependent mitochondrial fission in the deficits of neuronal metabolic burden and depressive-like behavior and provides medication basis for metabolism-related emotional disorders.

Prediction of radiation pneumonia after radiotherapy for esophageal cancer using a unified fractional dosiomics combined model.

OBJECTIVE: This study aimed to construct an optimal model to predict radiation pneumonia (RP) after radiotherapy for esophageal cancer using unified fractional dosiomics and to investigate the improvements in the prediction efficiency of each model for RP. METHODS: The clinical data, DVH, pre-treatment CT, and dose distribution of 182 patients were retrospectively analyzed.The independent risk factors were screened using univariate and multivariate logistic regression. The mutual information (MI),least absolute shrinkage and selection operator (LASSO), and recursive feature elimination (RFE) methods were used to screen the omics features. The AUC values of ROC, calibration curves, and clinical decision curves were calculated to evaluate the efficacy and trends of each model. RESULTS: The AUC of dosiomics model were 0.783 and 0.760 in the training and test cohorts, higher than 0.585 and 0.579 in the training and test cohorts of the DVH model. The AUC value of the R + D combination was the highest, reaching 0.833. The combined R + D model had a better calibration degree than the other models (mean absolute error = 0.018) and better net benefit in clinical decision-making. CONCLUSIONS: The radiomics combined dosiomics model was the best combined model to predict RP after radiotherapy for esophageal cancer. The dosiomics model could cover the efficiency of the DVH model and significantly improve the efficiency of the combined model.In the future, we will include other centers for further verification. ADVANCES IN KNOWLEDGE: For the first time, this study used CT images combined dose distribution to predict the occurrence of radiation pneumonitis after radiotherapy for esophageal cancer.

Cell type-specific NRBF2 orchestrates autophagic flux and adult hippocampal neurogenesis in chronic stress-induced depression.

Dysfunctional autophagy and impairment of adult hippocampal neurogenesis (AHN) each contribute to the pathogenesis of major depressive disorder (MDD). However, whether dysfunctional autophagy is linked to aberrant AHN underlying MDD remains unclear. Here we demonstrate that the expression of nuclear receptor binding factor 2 (NRBF2), a component of autophagy-associated PIK3C3/VPS34-containing phosphatidylinositol 3-kinase complex, is attenuated in the dentate gyrus (DG) under chronic stress. NRBF2 deficiency inhibits the activity of the VPS34 complex and impairs autophagic flux in adult neural stem cells (aNSCs). Moreover, loss of NRBF2 disrupts the neurogenesis-related protein network and causes exhaustion of aNSC pool, leading to the depression-like phenotype. Strikingly, overexpressing NRBF2 in aNSCs of the DG is sufficient to rescue impaired AHN and depression-like phenotype of mice. Our findings reveal a significant role of NRBF2-dependent autophagy in preventing chronic stress-induced AHN impairment and suggest the therapeutic potential of targeting NRBF2 in MDD treatment.

Dopamine D2 receptor on CD4+ T cells is protective against inflammatory responses and signs in a mouse model of rheumatoid arthritis.

BACKGROUND: Dopamine is a neurotransmitter and has been found to regulate lymphocytes by acting on dopamine receptors (DRs). CD4+ T cells express all the five subtypes of DRs, D1R to D5R. Although CD4+ T cells have been involved in pathogenesis of rheumatoid arthritis (RA), roles of DRs expressed on these cells in RA are poorly understood. This study determined whether D2R expressed on CD4+ T cells regulates inflammatory responses and signs in collagen type II (CII)-induced arthritis (CIA), a mouse model of RA. METHODS: DBA/1 mice and C57BL/6 mice with global D1r or D2r deficiency (D1r-/- or D2r-/-) or CD4+ T cell-specific D2r deletion (D2rfl/fl/CD4Cre) were used to prepare CIA model by intradermal injection of CII. D2R agonist sumanirole was intraperitoneally administered in CIA mice. CD4+ T cells obtained from CIA mice were exposed to sumanirole or/and D2R antagonist L-741,626 in vitro. Arthritic symptoms were assessed by clinical arthritis scores. Flow cytometric assay measured frequencies of CD4+ T cell subsets (Th1, Th2, Th17 and Treg cells). Expression of specific transcription factors for the CD4+ T cell subsets was tested by Western blot. Cytokine production was estimated by quantitative PCR and ELISA. RESULTS: CIA mice manifested a bias of CD4+ T cells towards Th1 and Th17 cells. D2r-/- CIA mice showed a stronger bias towards Th1 and Th17 phenotypes than CIA mice, while D1r-/- CIA mice did not show the changes. CD4+ T cell-specific D2r deletion exacerbated both the polarization towards Th1 and Th17 cells and the symptoms of arthritis. Sumanirole administration in CIA mice ameliorated the bias of CD4+ T cells towards Th1 and Th17 phenotypes as well as arthritic symptoms. Sumanirole treatment of in vitro CD4+ T cells obtained from CIA mice promoted the shift to Treg cells, and the effect of sumanirole was blocked by L-741,626. CONCLUSIONS: D2R expressed on CD4+ T cells is protective against imbalance between pro-inflammatory and anti-inflammatory T cells and arthritic symptoms in CIA.

Myeloperoxidase-Sensitive Magnetic Resonance Imaging Assesses Inflammatory Activation State in Experimental Mouse Acute Gout.

BACKGROUND: A novel myeloperoxidase-activatable manganese-based (MPO-Mn) MRI probe may enable the activation state of inflammatory foci to be detected and monitored noninvasively. PURPOSE: To evaluate the inflammatory response in a mouse model of acute gout using MPO as an imaging biomarker and a potential therapeutic target. STUDY TYPE: Prospective. ANIMAL MODEL: A total of 40 male Swiss mice with monosodium urate crystals induced acute gout. FIELD STRENGTH/SEQUENCE: A 3.0 T/T1-weighted imaging with 2D fast spoiled gradient recalled echo and T2-weighted imaging with fast recovery fast spin-echo sequences. ASSESSMENT: The difference in contrast-to-noise ratio between left hind limb (lesion) and right hind limb (internal reference) (ΔCNR), and normalized signal-to-noise ratio (nSNR) on the right hind limb were calculated and compared. The expression level and activity of myeloperoxidase (MPO) were analyzed using western blotting and spectrophotometric quantitation activity assay. MPO-positive cell infiltration and lesion volume were evaluated using immunofluorescence staining and T2-weighted images, respectively. STATISTICAL TESTS: Student's t test. A P-value less than 0.05 was considered to be statistically significant. RESULTS: MPO-Mn resulted in a significantly higher ΔCNR than Gd-DTPA (22.54 ± 1.86 vs. 13.90 ± 2.22) but lower nSNR on the reference right hind limb (1.08 ± 0.07 vs. 1.21 ± 0.08). Compared to the nontreatment group, MPO-inhibition resulted in a significantly reduced contrast enhancement at the lesion (17.81 ± 1.58 vs. 22.96 ± 3.12), which was consistent with a remission of the inflammatory response, as evidenced by a substantial reduction of lesion volume (0.55 ± 0.16 mm3 /g vs. 1.14 ± 0.15 mm3 /g), myeloperoxidase expression level (0.98 ± 0.09 vs. 1.48 ± 0.19) and activity (0.75 ± 0.12 vs. 1.12 ± 0.07), and inflammatory cell recruitment. DATA CONCLUSION: MPO-Mn MRI has potential to evaluate the activation state of inflammatory foci in the experimental model of acute gout. EVIDENCE LEVEL: 1. TECHNICAL EFFICACY: Stage 1.

α-MSH-catabolic enzyme prolylcarboxypeptidase in nucleus accumbens shell ameliorates stress susceptibility in mice through regulating synaptic plasticity.

Emerging evidence demonstrates the vital role of synaptic transmission and structural remodeling in major depressive disorder. Activation of melanocortin receptors facilitates stress-induced emotional behavior. Prolylcarboxypeptidase (PRCP) is a serine protease, which splits the C-terminal amino acid of α-MSH and inactivates it. In this study, we asked whether PRCP, the endogenous enzyme of melanocortin system, might play a role in stress susceptibility via regulating synaptic adaptations. Mice were subjected to chronic social defeat stress (CSDS) or subthreshold social defeat stress (SSDS). Depressive-like behavior was assessed in SIT, SPT, TST and FST. Based on to behavioral assessments, mice were divided into the susceptible (SUS) and resilient (RES) groups. After social defeat stress, drug infusion or viral expression and behavioral tests, morphological and electrophysiological analysis were conducted in PFX-fixed and fresh brain slices containing the nucleus accumbens shell (NAcsh). We showed that PRCP was downregulated in NAcsh of susceptible mice. Administration of fluoxetine (20 mg·kg-1·d-1, i.p., for 2 weeks) ameliorated the depressive-like behavior, and restored the expression levels of PRCP in NAcsh of susceptible mice. Pharmacological or genetic inhibition of PRCP in NAcsh by microinjection of N-benzyloxycarbonyl-L-prolyl-L-prolinal (ZPP) or LV-shPRCP enhanced the excitatory synaptic transmission in NAcsh, facilitating stress susceptibility via central melanocortin receptors. On the contrary, overexpression of PRCP in NAcsh by microinjection of AAV-PRCP alleviated the depressive-like behavior and reversed the enhanced excitatory synaptic transmission, abnormal dendritogenesis and spinogenesis in NAcsh induced by chronic stress. Furthermore, chronic stress increased the level of CaMKIIα, a kinase closely related to synaptic plasticity, in NAcsh. The elevated level of CaMKIIα was reversed by overexpression of PRCP in NAcsh. Pharmacological inhibition of CaMKIIα in NAcsh alleviated stress susceptibility induced by PRCP knockdown. This study has revealed the essential role of PRCP in relieving stress susceptibility through melanocortin signaling-mediated synaptic plasticity in NAcsh.

Li-S Chemistry of Manganese Phosphides Nanoparticles With Optimized Phase.

The targeted synthesis of manganese phosphides with target phase remains a huge challenge because of their various stoichiometries and phase-dependent physicochemical properties. In this study, phosphorus-rich MnP, manganese-rich Mn2 P, and their heterostructure MnP-Mn2 P nanoparticles evenly dispersed on porous carbon are accurately synthesized by a convenient one-pot heat treatment of phosphate resin combined with Mn2+ . Moreover, their electrochemical properties are systematically investigated as sulfur hosts in lithium-sulfur batteries. Density functional theory calculations demonstrate the superior adsorption, catalysis capabilities, and electrical conductivity of MnP-Mn2 P/C, compared with MnP/C and Mn2 P/C. The MnP-Mn2 P/C@S exhibits an excellent capacity of 763.3 mAh g-1 at 5 C with a capacity decay rate of only 0.013% after 2000 cycles. A phase evolution product (MnS) of MnP-Mn2 P/C@S is detected during the catalysis of MnP-Mn2 P/C with polysulfides redox through in situ X-ray diffraction and Raman spectroscopy. At a sulfur loading of up to 8 mg cm-2 , the MnP-Mn2 P/C@S achieves an area capacity of 6.4 mAh cm-2 at 0.2 C. A pouch cell with the MnP-Mn2 P/C@S cathode exhibits an initial energy density of 360 Wh kg-1 .

Comparison between pre- and post-contrast cardiac MRI cine images: the impact on ventricular volume and strain measurement.

To explore whether contrast agent administration will affect ventricular volume and strain parameters measured on cardiac magnetic resonance cine images. This prospective study enrolled 88 patients, including 32 patients with cardiac amyloidosis (CA), 32 patients with hypertrophic cardiomyopathy (HCM), and 24 control participants, to perform steady-state free precession (SSFP)-cine imaging twice, respectively before and after contrast agent injection. Indexed left and right ventricular (LV and RV) volume and LV strain parameters (peak radial strain [PRS], peak circumferential strain [PCS], peak longitudinal strain [PLS]) were analyzed and compared between the pre- and post-contrast cine groups. Compared to the group of pre-contrast cine, the end-diastolic volume index (EDVi) and end-systolic volume index (ESVi) significantly increased in the group using post-contrast cine images (all p < 0.05), especially in the right ventricle. After contrast injection, the right ventricular ejection fraction (RVEF) decreased significantly (p < 0.05), while the left ventricular ejection fraction (LVEF) only reduced for patients with HCM (p < 0.05). The PRS (37.1 ± 15.2 vs. 32.0 ± 15.4, p < 0.001) and PCS (- 14.9 ± 4.3 vs. - 14.0 ± 4.1, p < 0.001) derived from post-contrast cine images reduced significantly in all patients and this tendency remained in subgroup analysis except for PCS in the control group. The administration of a contrast agent may influence the measurements of ventricular volume and strain. Acquiring pre-contrast cine images were suggested for patients who required more accurate right ventricle evaluation or precise strain assessment.

A thalamic circuit facilitates stress susceptibility via melanocortin 4 receptor-mediated activation of nucleus accumbens shell.

AIMS: Central melanocortin 4 receptor (MC4R) has been reported to induce anhedonia via eliciting dysfunction of excitatory synapses. It is evident that metabolic signals are closely related to chronic stress-induced depression. Here, we investigated that a neural circuit is involved in melanocortin signaling contributing to susceptibility to stress. METHODS: Chronic social defeat stress (CSDS) was used to develop depressive-like behavior. Electrophysiologic and chemogenetic approaches were performed to evaluate the role of paraventricular thalamus (PVT) glutamatergic to nucleus accumbens shell (NAcsh) circuit in stress susceptibility. Pharmacological and genetic manipulations were applied to investigate the molecular mechanisms of melanocortin signaling in the circuit. RESULTS: CSDS increases the excitatory neurotransmission in NAcsh through MC4R signaling. The enhanced excitatory synaptic input in NAcsh is projected from PVT glutamatergic neurons. Moreover, chemogenetic manipulation of PVTGlu -NAcsh projection mediates the susceptibility to stress, which is dependent on MC4R signaling. Overall, these results reveal that the strengthened excitatory neurotransmission in NAcsh originates from PVT glutamatergic neurons, facilitating the susceptibility to stress through melanocortin signaling. CONCLUSIONS: Our results make a strong case for harnessing a thalamic circuit to reorganize excitatory synaptic transmission in relieving stress susceptibility and provide insights gained on metabolic underpinnings of protection against stress-induced depressive-like behavior.

Receptor and Ionic Mechanism of Histamine on Mouse Dorsolateral Striatal Neurons.

The dorsolateral striatum (DLS) is the critical neural substrate that plays a role in motor control and motor learning. Our past study revealed a direct histaminergic projection from the tuberomammillary nucleus (TMN) of the hypothalamus to the rat striatum. However, the afferent of histaminergic fibers in the mouse DLS, the effect of histamine on DLS neurons, and the underlying receptor and ionic mechanisms remain unclear. Here, we demonstrated a direct histaminergic innervation from the TMN in the mouse DLS, and histamine excited both the direct-pathway spiny projection neurons (d-SPNs) and the indirect-pathway spiny projection neurons (i-SPNs) of DLS via activation of postsynaptic H1R and H2R, albeit activation of presynaptic H3R suppressed neuronal activity by inhibiting glutamatergic synaptic transmission on d-SPNs and i-SPNs in DLS. Moreover, sodium-calcium exchanger 3 (NCX3), potassium-leak channels linked to H1R, and hyperpolarization-activated cyclic nucleotide-gated channel 2 (HCN2) coupled to H2R co-mediated the excitatory effect induced by histamine on d-SPNs and i-SPNs in DLS. These results demonstrated the pre- and postsynaptic receptors and their downstream multiple ionic mechanisms underlying the inhibitory and excitatory effects of histamine on d-SPNs and i-SPNs in DLS, suggesting a potential modulatory effect of the central histaminergic system on the DLS as well as its related motor control and motor learning.

Lenticulostriate artery length and middle cerebral artery plaque as predictors of early neurological deterioration in single subcortical infarction.

BACKGROUND: Early neurological deterioration (END) is not a rare phenomenon in single subcortical infarction (SSI; traditionally known as lacunar infarction) patients. Predictors of END in SSI patients are uncertain. AIMS: We aimed to investigate the association between infarct lesion characteristics, penetrating artery morphology, carrier artery plaque features and END using whole-brain vessel-wall imaging. METHODS: We prospectively collected data from SSI patients without stenosis of the corresponding carrier artery. The infarct lesion size and location, lenticulostriate artery (LSA) morphological characteristics, and features of the middle cerebral artery (MCA) plaques involving M1 segment adjacent to LSA origin on the symptomatic side were compared between patients with or without END. RESULTS: A total of 74 participants were enrolled, of whom 23 cases (31.1%) showed END. Multivariable logistic regression analysis adjusted for baseline National Institutes of Health Stroke Scale score and axial maximal diameter of infarct lesion revealed that the patients with MCA plaques adjacent to the LSA origin were more likely to develop END (odds ratio (OR) = 3.87, 95% confidence interval (CI) = 1.21-12.33), while with longer average length of LSAs were less likely to occur END (OR = 0.21, 95% CI = 0.05-0.92). CONCLUSION: MCA plaques located adjacent to the LSA origin and average length of LSAs on the symptomatic side were independent predictors of END in SSI patients. This finding might provide new insights into the mechanisms of the neurological progression in SSI and facilitate therapeutic interventions.

Single-factor analysis of Ni-B-AC-catalyzed ß-pinene hydrogenation based on hierarchical analysis.

In the choice of catalysts for the hydrogenation of pinene, nickel-based catalysts show intriguing activity. Here, a Ni-B catalyst supported on activated carbon with Ni as an active component was synthesized by the titration reduction co-impregnation method. The mechanism of such heterogeneous systems has not yet been articulated, and the industrial applications of the potassium borohydride reduction of nickel-based catalysts are limited by their easy agglomeration and poor stability. The materials were analyzed by hierarchical and DFT studies, in situ XPS, BET, XRD, and SEM, which provided insights into the kind of signals in Ni2+ reduction to Ni0. The hierarchical analysis indicated that Ni/AC (0.4876) and reaction pressure (0.6066) influenced the catalyst preparation and process efficiency changes, respectively. Activated carbon was shown to provide a favorable basis for the stability of the Ni-B activity. In addition, the hierarchical analysis method provides new insights into the data analysis for chemical experiments.

Identification of genetic polymorphisms in unexplained recurrent spontaneous abortion based on whole exome sequencing.

Background: The precise etiology of approximately 50% of patients with recurrent spontaneous abortion (RSA) is unclear, known as unexplained recurrent spontaneous abortion (URSA). This study identified the genetic polymorphisms in patients with URSA. Methods: Genomic DNA was extracted from 30 couples with URSA and 9 couples with normal reproductive history for whole exome sequencing. Variations in annotation, filtering, and prediction of harmfulness and pathogenicity were examined. Furthermore, predictions of the effects of changes in protein structure, Sanger validation, and functional enrichment analyses were performed. The missense mutated genes with significant changes in protein function, and genes with mutations of premature stop, splice site, frameshift, and in-frame indel were selected as candidate mutated genes related to URSA. Results: In 30 unrelated couples with URSA, 50%, 20%, and 30% had 2, 3, and more than 4 miscarriages, respectively. Totally, 971 maternal and 954 paternal mutations were found to be pathogenic or possibly pathogenic after preliminary filtering. Total variations were not associated with age nor the number of miscarriages. In 28 patients (involving 23 couples), 22 pathogenic or possibly pathogenic variants of 19 genes were found to be strongly associated with URSA, with an abnormality rate of 76.67%. Among these, 12 missense variants showed obvious changes in protein functions, including ANXA5 (c.949G>C; p.G317R), APP (c.1530G>C; p.K510N), DNMT1 (c.2626G>A; p.G876R), FN1 (c.5621T>C; p.M1874T), MSH2 (c.1168G>A; p.L390F), THBS1 (c.2099A>G; p.N700S), KDR (c.2440G>A; p.D814N), POLR2B (c.406G>T; p.G136C), ITGB1 (c.655T>C; p.Y219H), PLK1 (c.1210G>T; p.A404S), COL4A2 (c.4808 A>C; p.H1603P), and LAMA4 (c.3158A>G; p.D1053G). Six other genes with mutations of premature stop, splice site, frameshift, and in-frame indel were also identified, including BUB1B (c.1648C>T; p.R550*) and MMP2 (c.1462_1464delTTC; p.F488del) from the father, and mutations from mother and/or father including BPTF (c.396_398delGGA; p.E138 del and c.429_431GGA; p.E148del), MECP2 (c.21_23delCGC; p.A7del), LAMA2 (HGVS: NA; Exon: NA; SPLICE_SITE, DONOR), and SOX21 (c.640 _641insT; p. A214fs, c.644dupC; p. A215fs and c.644_645ins ACGCGTCTTCTTCCCGCAGTC; p. A215dup). Conclusions: These pathogenic or potentially pathogenic mutated genes may be potential biomarkers for URSA and may play an auxiliary role in the treatment of URSA.

Statistical changes of lung morphology in patients with adolescent idiopathic scoliosis after spinal fusion surgery-a prospective nonrandomized study based on low-dose biplanar X-ray imaging.

Background: Adolescent idiopathic scoliosis (AIS) patients suffer from restrictive impairment of pulmonary function (PF) as a consequence of spinal and ribcage deformity. Statistic modelling of scoliotic geometry has been well-established based on low-dose biplanar X-ray device (EOS) imaging. However, the postoperative lung morphology change derived from EOS has not yet been studied adequately till now. Methods: Twenty-five female AIS patients with severe right-sided major thoracic curve (aged 13-31 years; Cobb angle 45°-92°) underwent posterior spinal fusion (PSF) were prospectively recruited for standing EOS imaging at preoperative, postoperative, and 1-year follow-up (1Y-FU) stages. EOS-based lung morphology at frontal and lateral view was measured respectively to assess serial statistical changes in area and height. Results: At frontal view, left lung area significantly increased postoperatively (104.7 vs. 125.1 cm2; P<0.001) but without continuous increase at 1Y-FU (125.1 vs. 124.5 cm2; P=0.084), whereas right lung area showed a slight but insignificant interval increase (median: 143.8, 146.5, 148.4 cm2 at preoperative, postoperative, 1Y-FU stage, respectively; all P>0.05). At lateral view, the increase in left lung area was slight without statistically difference (median: 175.8, 178.4, 182.5 cm2 at preoperative, postoperative, 1Y-FU stage, respectively; all P>0.05), while right lung area did not significantly change postoperatively (median: 209.9, 206.7, 212.4 cm2 at preoperative, postoperative, 1Y-FU stage, respectively; all P>0.05). At both frontal and lateral view, left lung height significantly improved at both postoperative and 1Y-FU stage (all P<0.05), while preoperative right lung height was not significantly different from postoperative and 1Y-FU value (all P>0.05). Conclusions: EOS imaging demonstrates that left lung area in severe AIS may improve after PSF surgery. EOS may provide useful information about lung morphology change after PSF in severe AIS.

[Feasibility of Single-Breath-Hold Compressed Sensing Real-Time Cine Imaging for Assessment of Ventricular Function and Left Ventricular Strain in Cardiac Magnetic Resonance].

Objective: To explore the feasibility of single-breath-hold compressed sensing real-time cine imaging (CS-cine) in the assessment of ventricular function and left ventricular (LV) strain. Methods: A total of 70 subjects were enrolled prospectively, and all subjects underwent cardiac magnetic resonance imaging (cardiac MRI) using both the standard steady-state free procession cine (sta-cine) acquisition and a prototype CS-cine sequence. For both CS-cine and sta-cine imaging, continuous short-axis cine images were acquired from the base to the apex to cover the entire left ventricle, and long-axis cine images including two-, three-, and four-chamber views were also acquired. The scanning range, number of slices, slice thickness and intervals were kept identical for the two cine images of the same participant. Subjective evaluation of the image quality was performed on all cine images. For both sequences, the conventional function parameters of the left and the right ventricles and LV strain values were assessed with post-processing software analysis. The cine image quality, conventional ventricular function parameters, and LV strain values were compared between the two cine groups and the differences were examined. Inter- and intraobserver agreements for CS-cine images were measured using intraclass correlation coefficient ( ICC). Bland-Altman analysis was performed to assess reproducibility between the two cine methods. Results: The median scanning time of CS-cine was 21 s versus 272 s for sta-cine ( P<0.001). The median image quality scores of two groups were significantly different, 4 points for sta-cine and 2 points for CS-cine ( P<0.001). Bi-ventricular end-diastolic volumes (EDV), stroke volume (SV) and ejection fraction (EF) were significantly smaller in CS-cine ( P<0.001). Nevertheless, no significant differences between the two groups in bi-ventricular ESV or LV mass were observed ( P>0.05). LV strain parameters, including the peak radial strain, peak circumferential strain and peak longitudinal strain derived from LV mid-ventricular slice, were significantly different in the two sequences ( P<0.001). Moreover, CS-cine-derived functional parameters and strain measurements have a good correlation with those of sta-cine (for RV function parameters, and left ventricular PLS, PCS values, more than 95% points fell within the limits of agreement [ LoA]; meanwhile, more than 91% points fell within the LoA for other parameters) and inter- and intraobserver agreements were strong ( ICC=0.88 to 0.99) for CS-cine. Conclusion: CS-cine can well realize the rapid acquisition of cine images for quantitative analysis of cardiac function, and the conventional ventricular function parameters and LV globalized strain values obtained from CS-cine imaging have good reproducibility.

Repeated vagus nerve stimulation produces anxiolytic effects via upregulation of AMPAR function in centrolateral amygdala of male rats.

Repeated vagus nerve stimulation (rVNS) exerts anxiolytic effect by activation of noradrenergic pathway. Centrolateral amygdala (CeL), a lateral subdivision of central amygdala, receives noradrenergic inputs, and its neuronal activity is positively correlated to anxiolytic effect of benzodiazepines. The activation of ß-adrenergic receptors (ß-ARs) could enhance glutamatergic transmission in CeL. However, it is unclear whether the neurobiological mechanism of noradrenergic system in CeL mediates the anxiolytic effect induced by rVNS. Here, we find that rVNS treatment produces an anxiolytic effect in male rats by increasing the neuronal activity of CeL. Electrophysiology recording reveals that rVNS treatment enhances the alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionic acid receptor (AMPAR)-mediated excitatory neurotransmission in CeL, which is mimicked by ß-ARs agonist isoproterenol or blocked by ß-ARs antagonist propranolol. Moreover, chemogenetic inhibition of CeL neurons or pharmacological inhibition of ß-ARs in CeL intercepts both enhanced glutamatergic neurotransmission and the anxiolytic effects by rVNS treatment. These results suggest that the amplified AMPAR trafficking in CeL via activation of ß-ARs is critical for the anxiolytic effects induced by rVNS treatment.