After chromatin is SWItched-on can it be RUSHed?

Repressive chromatin must be remodeled to allow for transcriptional activation of genes in eukaryotic cells. Factors that alter chromatin structure to permit access of transcriptional activators, RNA polymerase II and the polymerase-associated general transcription factors to nucleosomal promoter sequences are as highly conserved as the basic mechanism of transcription. One group of promoter restructuring factors that perturbs chromatin in an ATP-dependent manner includes NURF, CHRAC, ACF, the SWI/SNF complex, and SWI/SNF-related proteins. Each member of this group contains a subunit homologous to the DNA-dependent ATPase; however, their individual mechanisms of action are unique. The small amount of SWI/SNF complex (100-200 copies/cell), its affiliation with a select number of inducible genes, and its interaction with the glucocorticoid and estrogen receptors, suggests the SWI/SNF complex might be preferentially targeted to active promoters. The SWI/SNF-related family of RUSH proteins which includes RUSH-1alpha and beta, hHLTF, HIP116, Zbu1, P113, and the transcription factor RUSH-1alpha isolog has been implicated as a highly conserved DNA binding site-specific ATPase.

Adipose expression of the phosphoenolpyruvate carboxykinase promoter requires peroxisome proliferator-activated receptor gamma and 9-cis-retinoic acid receptor binding to an adipocyte-specific enhancer in vivo.

A putative adipocyte-specific enhancer has been mapped to approximately 1 kilobase pair upstream of the cytosolic phosphoenolpyruvate carboxykinase (PEPCK) gene. In the present study, we used transgenic mice to identify and characterize the 413-base pair (bp) region between -1242 and -828 bp as a bona fide adipocyte-specific enhancer in vivo. This enhancer functioned most efficiently in the context of the PEPCK promoter. The nuclear receptors peroxisome proliferator-activated receptor gamma (PPARgamma) and 9-cis-retinoic acid receptor (RXR) are required for enhancer function in vivo because: 1) a 3-bp mutation in the PPARgamma-/RXR-binding element centered at -992 bp, PCK2, completely abolished transgene expression in adipose tissue; and 2) electrophoretic mobility supershift experiments with specific antibodies indicated that PPARgamma and RXR are the only factors in adipocyte nuclear extracts which bind PCK2. In contrast, a second PPARgamma/RXR-binding element centered at -446 bp, PCK1, is not involved in adipocyte specificity because inactivation of this site did not affect transgene expression. Moreover, electrophoretic mobility shift experiments indicated that, unlike PCK2, PCK1 is not selective for PPARgamma/RXR binding. To characterize the enhancer further, the rat and human PEPCK 5'-flanking DNA sequences were compared by computer and found to have significant similarities in the enhancer region. This high level of conservation suggests that additional transcription factors are probably involved in enhancer function. A putative human PCK2 element was identified by this sequence comparison. The human and rat PCK2 elements bound PPARgamma/RXR with the same affinities. This work provides the first in vivo evidence that the binding of PPARgamma to its target sequences is absolutely required for adipocyte-specific gene expression.

Dysplasia epiphysealis hemimelica in an elderly patient.

We report a case of dysplasia epiphysealis hemimelica in an 87-year-old woman, the oldest patient, to our knowledge, who has presented with symptoms from this disease. Whereas the classic presentation is marked by painless swelling and/or deformity, our patient was found to be diffusely tender without effusion or gross deformity. Plain radiographs showed severe degenerative changes in her right knee with loss of joint space and osteophyte formation, along with an intra-articular osteochondroma. The intra-articular osteochondroma was removed, and an arthroplasty was performed without complication and with full relief of symptoms.

Luciferase from the east European firefly Luciola mingrelica: cloning and nucleotide sequence of the cDNA, overexpression in Escherichia coli and purification of the enzyme.

We have cloned cDNA encoding luciferase in Luciola mingrelica, fireflies living near the Black Sea in southern Russia, and obtained high level expression of the cloned sequences in Escherichia coli. The nucleotide sequences of two isolated clones were determined; five single base differences were observed, but none resulted in a change in the encoded amino acid residue. The cDNA encoded a protein of 548 amino acid residues. The overall amino acid sequence identity with the luciferase from Photinus pyralis, the North American firefly, was 67%, while comparison of the L. mingrelica luciferase with L. cruciata and L. lateralis, both indigenous to Japan, showed about 80% of the residues were strictly conserved. A novel overexpression system which employs the regulatory genes of the luminous bacterium Vibrio fischeri allowed growth of cultures to high cell density and high luciferase content, facilitating purification of the enzyme. Luciferase was purified to homogeneity in good yield from lysates of recombinant E. coli by ammonium sulfate fractionation and chromatography on columns of DEAE Sephadex and Blue Sepharose. The physicochemical properties of the luciferases from the available recombinant sources are significantly different and should allow detailed investigations into the mechanism of the bioluminescence reaction and the physical basis of the differences in the color of light emitted from the various enzymes.

Use of bacterial and firefly luciferases as reporter genes in DEAE-dextran-mediated transfection of mammalian cells.

The aim of this study was to compare three different luciferase genes by placing them in a single reporter vector and expressing them in the same mammalian cell type. The luciferase genes investigated were the luc genes from the fireflies Photinus pyralis (PP) and Luciola mingrelica (LM) and the lux AB5 gene, a translational fusion of the two subunits of the bacterial luciferase from Vibrio harveyi (VH). The chloramphenicol acetyltransferase (CAT) gene was also included in this study for comparison. The performances of the assay methods of the corresponding enzymes were evaluated using reference materials and the results of the expressed enzymes following transfection were calculated using calibration curves. All of the bioluminescent assays possess high reproducibility both within and between the batches (less than 15%). The comparison of the assay methods shows that firefly luciferases have the highest detection sensitivity (0.05 and 0.08 amol for PP and LM, respectively) whereas the VH bacterial luciferase has 5 amol and CAT 100 amol. On the other hand, the transfection of the various plasmids shows that the content of the expressed enzyme within the cells is much higher for CAT than for the other luciferase genes. VH luciferase is expressed at very low levels in mammalian cells due to the relatively high temperature of growing of the mammalian cells that seems to impair the correct folding of the active enzyme. PP and LM luciferases are both expressed at picomolar level but usually 10 to 70 times less in content with respect to CAT within the transfected cells. On the basis of these results the overall improvement in sensitivity related to the use of firefly luciferases as reporter genes in mammalian cells is about 30 to 50 times with respect to that of CAT.

Control of the lux regulon of Vibrio fischeri.

Regulation of expression of bioluminescence from the Vibrio fischeri lux regulon in Escherichia coli is a consequence of a unique form of positive feedback superimposed on a poorly defined cis-acting repression mechanism. The lux regulon consists of two divergently transcribed operons. The leftward operon contains only a single gene, luxR, which encodes a transcriptional activator protein. The rightward operon contains luxI, which together with luxR and the 218 base pairs separating the two operons comprises the primary regulatory circuit, and the five structural genes, luxC, luxD, luxA, luxB and luxE, which are required for the bioluminescence activity. Transcription of luxR from PL is stimulated by binding of the E. coli crp gene product to the sequence TGTGACAAAAATCCAA upstream of the presumed promoter. Binding of pure E. coli CAP protein in a cAMP-dependent reaction to the V. fischeri lux regulatory region has been demonstrated by in vitro footprinting. The luxI gene product is an enzyme which catalyses a condensation reaction of cytoplasmic substrates to yield the autoinducer, N-(3-oxo-hexanoyl) homoserine lactone. Accumulation of autoinducer, which is freely diffusible, results in formation of a complex with LuxR. The complex binds to the sequence ACCTGTAGGATCGTACAGGT upstream of PR to stimulate transcription of the rightward operon. Increased transcription from PR should yield increased levels of LuxI and higher levels of autoinducer which would further activate LuxR. The LuxR binding site is also a LexA binding site, as demonstrated by in vitro footprinting. Basal transcription from both PL and PR is repressed by sequences within the luxR coding region.(ABSTRACT TRUNCATED AT 250 WORDS)

Identification of the operator of the lux regulon from the Vibrio fischeri strain ATCC7744.

Escherichia coli that carry a recombinant plasmid bearing the Vibrio fischeri lux regulon express luminescence that mimics the luminescence of V. fischeri. The lux regulon consists of two divergently transcribed operons, the rightward operon (luxICDABE genes) and the leftward operon (luxR gene). The luxR and luxI genes and the control region separating the two operons supply the primary regulatory control over the lux regulon; the regulatory mechanisms result in a dramatic increase in the rate of luciferase synthesis after induction, apparently due to a unique autoregulatory positive feedback mechanism, and in an enormous difference (greater than 10(4] in levels of luminescence in cells before and after induction. The generally accepted model of primary regulation of bioluminescence in V. fischeri involves the interaction of the product of the luxR gene and N-(3-oxohexanoyl)homoserine lactone, the autoinducer produced by the enzyme encoded by luxI, the first gene of the rightward operon, with an operator sequence within the control region to stimulate transcription of the rightward operon in a positive feedback loop. We have used deletion mapping of a transcription reporter vector to determine the approximate location of the operator. By site-directed mutagenesis of the presumed operator, we have demonstrated that the 20-base-pair inverted repeat ACCTGTAGGA/TCGTA CAGGT (where the vertical line is the center of symmetry), which bears striking similarity to the recognition sequence for the pleiotropic repressor protein LexA, is the operator of the lux regulon. We also found that deletion of sequences upstream of the palindrome leads to increased transcription from the rightward promoter (PR), indicative of a cis-acting element that represses transcription in the absence of the LuxR-autoinducer complex. Modifications of the palindrome that eliminate stimulation by LuxR-autoinducer of transcription from PR have no effect on repression by the cis-acting mechanism(s), suggesting that the palindrome is not necessary for repression of the rightward operon. Thus, it appears that the large increase in transcription upon induction of the lux regulon is the result of at least two independent mechanisms, one positive and the other negative.

Site-directed mutagenesis of bacterial luciferase: analysis of the 'essential' thiol.

It has been appreciated for many years that the luciferase from the luminous marine bacterium Vibrio harveyi has a highly reactive cysteinyl residue which is protected from alkylation by binding of flavin. Alkylation of the reactive thiol, which resides in a hydrophobic pocket, leads to inactivation of the enzyme. To determine conclusively whether the reactive thiol is required for the catalytic mechanism, we have constructed a mutant by oligonucleotide directed site-specific mutagenesis in which the reactive cysteinyl residue, which resides at position 106 of the alpha subunit, has been replaced with a seryl residue. The resulting alpha 106Ser luciferase retains full activity in the bioluminescence reaction, although the mutant enzyme has a ca 100-fold increase in the FMNH2 dissociation constant. The alpha 106Ser luciferase is still inactivated by N-ethylmaleimide, albeit at about 1/10 the rate of the wild-type (alpha 106Cys) enzyme, demonstrating the existence of a second, less reactive, cysteinyl residue that was obscured in the wild-type enzyme by the highly reactive cysteinyl residue at position alpha 106. An alpha 106Ala variant luciferase was also active, but the alpha 106Val mutant enzyme was about 50-fold less active than the wild type. All three variants (Ser, Ala and Val) appeared to have somewhat reduced affinities for the aldehyde substrate, the valine mutant being the most affected. It is interesting to note that the alpha 106 mutant luciferases are much less subject to aldehyde substrate inhibition than is the wild-type V. harveyi luciferase, suggesting that the molecular mechanism of aldehyde substrate inhibition involves the Cys at alpha 106.

The complete nucleotide sequence of the lux regulon of Vibrio fischeri and the luxABN region of Photobacterium leiognathi and the mechanism of control of bacterial bioluminescence.

We have determined the complete nucleotide sequence of a 7622 base pair fragment of DNA from Vibrio fischeri strain ATCC7744 that contains all the information required to confer plasmid-borne, regulated bioluminescence upon strains of Escherichia coli. The lux regulon from V. fischeri consists of two divergently transcribed operons, L (left) and R (right), and at least seven genes, luxR (L operon) and luxICDABE (R operon) and the intervening control region. The luxA and luxB genes encode respectively the alpha and beta subunits of luciferase. The gene order luxCDABE seen in V. fischeri is the same as for V. harveyi. We have determined the sequence of the luxAB and flanking regions from Photobacterium leiognathi and have found upstream sequences homologous with luxC from the Vibrio species, but between luxB and luxE, there is an open reading frame encoding a protein of 227 amino acids (26,229 molecular weight) that is not found in this location in the Vibrio species. The amino terminal amino acid sequence of the encoded protein is nearly identical to that determined by O'Kane and Lee (University of Georgia) for the non-fluorescent flavoprotein from a closely related Photobacterium species (Dr Dennis O'Kane, personal communication). We have therefore designated this gene luxN. There is a 20-base inverted repeat ACCTGTAGGAxTCGTACAGGT, centred between bases 927 and 928 in the region between the two operons of V. fischeri. This region appears to fulfil two functions: it is critical for the LuxR protein to exert its effect and it is a consensus binding site for the E. coli LexA protein, a negative regulatory protein involved with the SOS response. There are sequences within the luxR coding region that appear to function in a cis-acting fashion to repress transcription from both the leftward and rightward promoters in the absence of the respective transcriptional activator proteins, thereby resulting in low basal levels of transcription. It now appears clear that there are multiple levels of control on the lux system allowing for a modulation of the intensity of bioluminescence of over four orders of magnitude.

A plasmid vector and quantitative techniques for the study of transcription termination in Escherichia coli using bacterial luciferase.

We have developed a plasmid expression vector for the study of transcription terminators in Escherichia coli that utilizes the lux genes coding for the enzyme luciferase of the bioluminescent marine bacterium, Vibrio harveyi. The pBR322-derived plasmid, called pHV100, contains the E. coli lac promoter, the polylinker regions from the plasmid vector pUC18, and the V. harveyi lux genes. Insertion of transcription termination sites into the polylinker region results in decreased luciferase expression. Because the bioluminescence genes are not indigenous to E. coli, their expression can be studied in virtually any host strain without the complications of background activity. This facilitates sensitive measurements of terminator efficiency in hosts containing termination factor mutations. Bioluminescence can be easily monitored with high sensitivity, using a rapid photographic technique or a more quantitative photometric assay.