Conserved untranslated regions of multipartite viruses: Natural markers of novel viral genomic components and tags of viral evolution.

Viruses with split genomes are classified as being either segmented or multipartite based on whether their genomic segments occur within a single virion or across different virions. Despite variations in number and sequence during evolution, the genomic segments of many viruses are conserved within the untranslated regions (UTRs). In this study, we present a methodology that combines RNA sequencing with iterative BLASTn of UTRs (https://github.com/qq371260/Iterative-blast-v.1.0) to identify new viral genomic segments. Some novel multipartite-like viruses related to the phylum Kitrinoviricota were annotated using sequencing data from field plant samples and public databases. We identified potentially plant-infecting jingmen-related viruses (order Amarillovirales) and jivi-related viruses (order Martellivirales) with at least six genomic components. The number of RNA molecules associated with a genome of the novel viruses in the families Closteroviridae, Kitaviridae, and Virgaviridae within the order Martellivirales reached five. Several of these viruses seem to represent new taxa at the subgenus, genus, and family levels. The diversity of novel genomic components and the multiple duplication of proteins or protein domains within single or multiple genomic components emphasize the evolutionary roles of genetic recombination (horizontal gene transfer), reassortment, and deletion. The relatively conserved UTRs at the genome level might explain the relationships between monopartite and multipartite viruses, as well as how subviral agents such as defective RNAs and satellite viruses can coexist with their helper viruses.

Identification and complete genome sequence of a novel sadwavirus discovered in chrysanthemum (Chrysanthemum morifolium Ramat.).

The complete genome sequence of a putative novel member of the genus Sadwavirus was determined by high-throughput sequencing of a chrysanthemum from an orchard of the Tongxiang Agricultural Science Institute in Tongxiang, Zhejiang province. The complete genome sequence was confirmed using RT-PCR and the rapid amplification of cDNA ends (RACE) method. The predicted genome of the putative virus is composed of two RNA molecules, 7016 and 6772 nucleotides in length, excluding their poly-A tails. The new virus was tentatively named "chrysanthemum sadwavirus" (ChSV). The Pro-Pol region of RNA1 and the CP region of RNA2 of ChSV shared the highest amino acid sequence identity (53.01% and 36.40%, respectively) with the corresponding sequences of lettuce secovirus 1 (LSV-1). Phylogenetic analysis showed that ChSV clustered with members of the subgenus Stramovirus (genus Sadwavirus). Taken together, these results suggest that ChSV is a new member of the genus Sadwavirus.

First report of grapevine asteroid mosaic-associated virus in grapevines in China.

Grapevine asteroid mosaic-associated virus (GAMaV), a member of the genus Marafivirus of the family Tymoviridae, was first described to infect grapevines in California (Abou Ghanem-Sabanadzovic et al. 2003). Since then, GAMaV has been reported from Greece, Japan, Canada, Uruguay, France, Hungary, Italy, Spain, Switzerland and Russia, and also in some free-living grapevines in North America (Kyriakopoulou, 1991; Morán et al., 2021; Reynard et al., 2022; Shvets et al., 2022; Thompson et al., 2021). GAMaV may be associated with grapevine asteroid mosaic disease (Martelli 2014). In August 2022, a grapevine cv. Cabernet Sauvignon exhibiting chlorotic mottling was collected in Ningxia, China. Total RNAs were extracted using RNAprep Pure Plant Plus Kit (DP441, TIANGEN BIOTECH, Beijing), and the ribosomal RNA were removed by the Epicentre Ribo-Zero rRNA Removal Kit (Epicentre, Madison, WI, USA). The ribosomal RNA-depleted RNAs were then used to construct a cDNA library using a TruSeq RNA Sample Prep Kit (Illumina, San Diego, CA, USA), which was sequenced on an Illumina NovaSeq 6000 platform (Biomarker Biology Technology), resulting in 39,297,567 paired-end clean reads (150 nt × 2). Reads mapping to the grapevine genome (GenBank accession no PN40024) were removed using hisat2 2.1.0 software. The 15,003,158 unmapped reads were de novo assembled into 70,512 contigs using the rnaviralSPAdes method in the SPAdes v3.15.3 software with default parameters and analyzed through BLASTn and BLASTx analysis. Five viruses and two viroids were identified: GAMaV (5 contigs), grapevine Pinot gris virus (3 contigs), grapevine berry inner necrosis virus (3 contigs) , grapevine rupestris stem pitting-associated virus (4 contigs), grapevine red globe virus (2 contigs), grapevine yellow speckle 1 viroid (4 contigs) and hop stunt viroid (3 contigs). The five contigs of GAMaV were 352 nt~2, 224 nt in length, which were assembled from 3, 308 reads and shared 85.56%~91.81% nt identity with the genome of the GAMaV isolate GV30 (KX354202) with 93.3% coverage. To further confirm the infection of GAMaV, we designed two pairs of primers, GAMaV-mel1a/1b (5'-CACCTCGCCCCCTACCTTGAC-3'/5'-AAGAGGACGCCTTTGCGGGAG-3') and GAMaV-cp1a/1b (5'-CTAGCGACGACCGCACTGATC-3'/5'-GTCGGTGTACGAGATTTGGTC-3'), which were used to amplify the 329-bp and 440-bp fragments in the helicase (Hel) domain and coat protein (CP) gene of GAMaV genome in RT-PCR, respectively. The amplified PCR products were cloned and sequenced and the two sequences (OQ676951 and OQ676958) showed 91.2% and 93.4% nt identity with the isolate GV30, respectively. Furthermore, 429 grapevine samples of 71 cultivars were collected from 21 provinces and tested by RT-PCR using the above primer pairs. The results showed that 1.4% (6/429) of the samples tested positive, including one 'Autumn seedless' grapevine (Liaoning province), two 'Dawuhezi' (Liaoning), one 'Cabernet Gernischt' (Liaoning) and two 'Cabernet Sauvignon' (Tianjing and Shandong respectively). The partial sequences of the Hel domain (OQ676952-57) and CP gene (OQ676959-61) obtained from the positive samples by sequencing showed 89.1% to 84.5% and 93.6% to 93.9% nt identity with the isolate GV30, respectively. Because these GAMaV-positive grapevines did not show distinct symptoms, GAMaV pathogenicity remains challenging to confirm. This is the first report of GAMaV in grapevines in China, extending the information on its geographical distribution.

Maternal Plasma RNA in First Trimester Nullipara for the Prediction of Spontaneous Preterm Birth ≤ 32 Weeks: Validation Study.

The first-trimester prediction of spontaneous preterm birth (sPTB) has been elusive, and current screening is heavily dependent on obstetric history. However, nullipara lack a relevant history and are at higher risk for spontaneous (s)PTB ≤ 32 weeks compared to multipara. No available objective first-trimester screening test has proven a fair predictor of sPTB ≤ 32 weeks. We questioned whether a panel of maternal plasma cell-free (PCF) RNAs (PSME2, NAMPT, APOA1, APOA4, and Hsa-Let-7g) previously validated at 16-20 weeks for the prediction of sPTB ≤ 32 weeks might be useful in first-trimester nullipara. Sixty (60) nulliparous women (40 with sPTB ≤ 32 weeks) who were free of comorbidities were randomly selected from the King's College Fetal Medicine Research Institute biobank. Total PCF RNA was extracted and the expression of panel RNAs was quantitated by qRT-PCR. The analysis employed, primarily, multiple regression with the main outcome being the prediction of subsequent sPTB ≤ 32 weeks. The test performance was judged by the area under the curve (AUC) using a single threshold cut point with observed detection rates (DRs) at three fixed false positive rates (FPR). The mean gestation was 12.9 ± 0.5 weeks (range 12.0-14.1 weeks). Two RNAs were differentially expressed in women destined for sPTB ≤ 32 weeks: APOA1 (p < 0.001) and PSME2 (p = 0.05). APOA1 testing at 11-14 weeks predicted sPTB ≤ 32 weeks with fair to good accuracy. The best predictive model generated an AUC of 0.79 (95% CI 0.66-0.91) with observed DRs of 41%, 61%, and 79% for FPRs of 10%, 20%, and 30%, including crown-rump length, maternal weight, race, tobacco use, and age.

Integrated Transcriptome and Metabolome Dissecting Interaction between Vitis vinifera L. and Grapevine Fabavirus.

Grapevine fabavirus (GFabV) is a novel member of the Fabavirus genus associated with chlorotic mottling and deformation symptoms in grapevines. To gain insights into the interaction between GFabV and grapevines, V. vinifera cv. 'Summer Black' infected with GFabV was investigated under field conditions through physiological, agronomic, and multi-omics approaches. GFabV induced significant symptoms on 'Summer Black', and caused a moderate decrease in physiological efficiency. In GFabV-infected plants, alterations in carbohydrate- and photosynthesis-related genes might trigger some defense responses. In addition, secondary metabolism involved in plant defense was progressively induced by GFabV. Jasmonic acid and ethylene signaling were down-regulated in GFabV-infected leaves and berries along with the expression of proteins related to LRR and protein kinases, suggesting that GFabV can block the defense in healthy leaves and berries. Furthermore, this study provided biomarkers for early monitoring of GFabV infection in grapevines, and contributed to a better understanding of the complex grapevine-virus interaction.

Effect of In Vitro Culture of Long Shoot Tip on Variant Structure and Titer of Grapevine Viruses.

Shoot tip culture is a very effective approach for studying plant viruses. In this study, we evaluated the numbers, diversity, and titer of grapevine viruses in in vitro grapevine plants after long shoot tip culture. Six virus-infected grapevine cultivars (Cabernet Franc, Cabernet Gernischt, Cabernet Sauvignon, Wink, Victoria, and Merlot) collected from six regions of China were used as the research materials. Approximately 1.5 cm long shoot tips were used for meristem culture. The average survival rate of the six grapevine cultivars was 45.7%. Merlot collected from Beijing showed the highest survival rate (80.0%). Regeneration was not achieved in Cabernet Gernischt collected from Liaoning province and Cabernet Sauvignon from Tianjin due to bacterial and fungal contamination. Virus detection conducted in the surviving regenerated plants showed that the virus infection status, including the viral numbers and the species present in plants grown in vitro, was the same as that in corresponding in vivo plants. Moreover, the analysis of sequence diversity and the mutation frequency in grapevine viruses in vitro indicated that the structure of grapevine viruses was stable in long shoot tip culture after four sub-culture passages. Further, the relative viral titer of in vitro grapevine plants was much higher than that of in vivo plants. These results aid in the investigation of viruses in woody plants.

Evaluation of a Maternal Plasma RNA Panel Predicting Spontaneous Preterm Birth and Its Expansion to the Prediction of Preeclampsia.

Preterm birth is the principal contributor to neonatal death and morbidity worldwide. We previously described a plasma cell-free RNA panel that between 16 and 20 weeks of pregnancy had potential to predict spontaneous preterm birth (sPTB) ≤ 32 weeks caused by preterm labor (PTL) or preterm premature rupture of membranes (PPROM). The present study had three objectives: (1) estimate the RNA panel prognostic accuracy for PTL/PPROM ≤ 32 weeks in a larger series; (2) improve accuracy by adding clinical characteristics to the predictive model; and (3) examine the association of the RNA panel with preeclampsia. We studied 289 women from Memphis TN prospectively sampled 16.0-20.7 weeks and found: (1) PSME2 and Hsa-Let 7g were differentially expressed in cases of PTL/PPROM ≤ 32 weeks and together provided fair predictive accuracy with AUC of 0.76; (2) combining the two RNAs with clinical characteristics improved good predictive accuracy for PTL/PPROM ≤ 32 weeks (AUC 0.83); (3) NAMPT and APOA1 were differentially expressed in women with 'early-onset preeclampsia' (EOP) and together provided good predictive accuracy with AUC of 0.89; and (4) combining the two RNAs with clinical characteristics provided excellent predictive accuracy (AUC 0.96). Our findings suggest an underlying common pathophysiological relationship between PTL/PPROM ≤ 32 weeks and EOP and open inroads for the prognostication of high-risk pregnancies.

Detection of Embryonic Trisomy 21 in the First Trimester Using Maternal Plasma Cell-Free RNA.

Prenatal trisomy 21 (T21) screening commonly involves testing a maternal blood sample for fetal DNA aneuploidy. It is reliable but poses a cost barrier to universal screening. We hypothesized maternal plasma RNA screening might provide similar reliability but at a lower cost. Discovery experiments used plasma cell-free RNA from 20 women 11−13 weeks tested by RNA and miRNA microarrays followed by qRT-PCR. Thirty-six mRNAs and 18 small RNAs of the discovery cDNA were identified by qPCR as potential markers of embryonic T21. The second objective was validation of the RNA predictors in 998 independent pregnancies at 11−13 weeks including 50 T21. Initial analyses identified 9−15 differentially expressed RNA with modest predictive power (AUC < 0.70). The 54 RNAs were then subjected to machine learning. Eleven algorithms were trained on one partition and tested on an independent partition. The three best algorithms were identified by Kappa score and the effects of training/testing partition size and dataset class imbalance on prediction were evaluated. Six to ten RNAs predicted T21 with AUCs up to 1.00. The findings suggest that maternal plasma collected at 11−13 weeks, tested by qRT-PCR, and classified by machine learning, may accurately predict T21 for a lower cost than plasma DNA, thus opening the door to universal screening.

Genetic diversity analysis of grapevine rupestris stem pitting-associated virus from grapevine by colony PCR-SSCP and -RFLP.

We have developed methods for detecting the genetic diversity of grapevine rupestris stem pitting-associated virus (GRSPaV) based on restriction fragment length polymorphism (RFLP) and single stranded conformational polymorphism (SSCP) in the 905 nt 3' sequence. The amplicons were cloned from six grapevine cultivars, and colony polymerase chain reaction (colony PCR) using recombination bacteria was subsequently analyzed by RFLP and SSCP. Four haplotypes of SSCP and six haplotypes of Sac I RFLPs were defined. The two methods had a 40% discrepancy rate in showing the degree of diversity. All clones were sequenced and were used to construct a phylogenetic tree with seven previously reported GRSPaV sequences. In the tree, all the newly acquired sequences were divided into three clusters, I, II, and III, which corresponded to haplotypes I, II, and III of SSCP, respectively. Haplotype IV of SSCP was grouped into cluster II. A recombination analysis showed that haplotype IV has undergone a recombination event. Together, these results indicate that the SSCP assay is useful for the rapid identification of genetic diversity of GRSPaV. This is the first report of an analysis of the large fragment of GRSPaV by colony PCR-SSCP. Keywords: grapevine; grapevine rupestris stem pitting-associated virus (GRSPaV); RFLP; SSCP; genetic diversity analysis.

First report of Vitis cryptic virus from grapevines in China.

Vitis cryptic virus (VCV) was recently identified on wild Vitis coignetiae in Japan in 2021, and was tentatively classified as a new member of the genus Deltapartitivirus, which is consistent with the two-segmented genome encoding RdRp and CP (Nabeshima et al., 2021). In June 2020, a grapevine cv. Jinhuanghou in a vineyard exhibiting chlorotic mottling (Figure S1) was collected in Xingcheng, Liaoning province of China. Total RNAs were extracted using RNAprep Pure Plant Plus Kit (DP441, TIANGEN BIOTECH, Beijing), and the ribosomal RNA were removed by the Epicentre Ribo-Zero rRNA Removal Kit (Epicentre, Madison, WI, USA). The ribosomal RNA-depleted RNA was then used to construct a cDNA library using a TruSeq RNA Sample Prep Kit (Illumina, San Diego, CA, USA), which was sequenced on an Illumina NovaSeq 6000 platform (Biomarker Biology Technology), resulting 60,208,348 paired-end clean reads (150 nt × 2). Reads mapping to the grapevine genome (PN40024 assembly 12X) were removed by hierarchical indexing using hisat2 2.1.0 software (Kim et al., 2019). The unmapped reads were de novo assembled into 116,809 contigs using the rnaviralSPAdes method in the SPAdes v3.15.3 software with default parameters (Prjibelski et al., 2020) and analyzed through BLAST analysis. Two viruses and two viroids were identified: VCV (2 contigs), grapevine emaravirus A (GEVA; 5 contigs), grapevine yellow speckle viroid 1 (GYSVd1; 1 contig) and hop stunt viroid (HSVd; 1 contig). The two contigs of VCV had lengths of 1575 nt and 1563 nt, and shared 95% and 90% nt identity with RNA1 and RNA2 genomes of the VCV isolate H1 (GenBank accession nos. LC602838-39) with 99% and 96% coverage respectively. To further confirm the infection of VCV, we designed two pairs of primers VCV-RP1a/1b (5'- TGGTCGAGAAGTTACTATACTCG -3'/5'- AGACCACAATATTGCTTTGGCTC -3') and VCV-CP1a/1b (5'-TTACGAAGTCCGCACTATTGC-3'/5'- AGCATACGGATAGCTCCTGAC-3'), which were to amplify the 297-bp and 279-bp fragments in the RdRp and CP gene encoded by RNA1 and RNA2 genomes of VCV respectively. The amplified PCR products were cloned and sequenced and the two sequences (OM460075-76) showed 93% and 91% nt identity with the genomic segments of the VCV isolate H1 respectively. The graft transmissibility of VCV was assessed in July 2021 by grafting the VCV-infected grapevine buds onto 2-year-old VCV-free 'Beta'grapevine seedlings with four replicates, the leaves of the first bud below the grafting site behaved chlorotic mottling symptoms (Figure S2) and tested positive for VCV two months after grafting. To further determine the incidence and distribution of VCV in China, 470 grapevine samples of 71 cultivars were collected from 21 provinces and tested by RT-PCR using primers VCV-RP1a/1b and VCV-CP1a/1b. The results showed that 2.6% (12/470) of the samples tested positive with both primers, including 10 'Jinhuanghou' grapevines (Jilin province), 1 'Zuoyouhong' (Jilin province) and 1 'Куртсет' grapevine (Liaoning province). This is the second report of VCV in the world, and confirm the graft transmissibility of VCV for the first time. Given the VCV infectivity in the two important cultivars in Jilin province and strong graft transmissibility, it is necessary to further study its pathogenicity and its effect on grapes. Unveiling the presence of VCV in China contributes to understanding the occurrence of the virus and developing management measures should they become necessary.

High-Throughput Sequencing Indicates a Novel Marafivirus in Grapevine Showing Vein-Clearing Symptoms.

A putative new marafivirus was identified in a 'Jumeigui' grapevine exhibitting obvious vein-clearing symptoms by high-throughput sequencing, which tentatively named grapevine-associated marafivirus (GaMV). The nearly complete genomic sequence of GaMV was amplified by reverse transcription PCR, and the terminal sequences were determined using the rapid amplification of cDNA ends method. The nearly complete genome of GaMV is 6346 bp long, excluding the poly(A) tail, and shows 51.2-62.3% nucleotide identity with other members of the genera Marafivirus, Maculavirus and Tymovirus in the family Tymoviridae. Additionally, it includes five functional domains homologous to those found in members of these genera. A phylogenetic analysis showed that GaMV clustered with other species-related marafiviruses. These data support GaMV being a representative member of a novel species in the genus Marafivirus. Furthermore, GaMV was graft-transmissible and 26 of 516 (5.04%) grapevine samples from five provinces in China tested positive by reverse transcription PCR. The coat protein of GaMV isolates shared 91.7-100% and 96.7-100% identities at the nt and aa levels, respectively. The coat protein-based phylogenetic trees revealed three well-defined clusters.

First Report of Grapevine Kizil Sapak Virus in Grapevine in China.

Grapevine Kizil Sapak virus (GKSV) is a novel member of the family Betaflexiviridae classified into the proposed genus Fivivirus within the subfamily Trivirinae. It was first discovered in USA from a grapevine originating from Turkmenistan (Al Rwahnih et al. 2019) and later in France from a grapevine accession from Iran (Marais et al. 2020). In October 2019, an asymptomatic grapevine cv. 'Crimson Seedless' (native to USA) was collected from Xinjiang province in China and analyzed by high-throughput sequencing (HTS). Ribosome-depleted RNA preparations were used for library synthesis followed by HTS on an Illumina HiSeq X-ten platform. A total of 29,141,024 cleaned reads were obtained, and 7,878 contigs were generated using CLC Genomics Workbench 9.5 (QIAGEN). One long contig (7,328 bp) showed 88.2% nucleotide (nt) identity with the sequence of GKSV-127 (MN172165) via Blastx, with an average coverage of 284-X. Bioinformatic analysis of the remaining contigs showed the presence of Grapevine leafroll-associated virus 4, Grapevine rupestris vein feathering virus, Grapevine fabavirus, grapevine yellow speckle viroid-1 (GYSVd-1), GYSVd-2 and Hop stunt viroid in the sample. The presence of GKSV was checked by RT-PCR using the primer GKSV-F/R (Al Rwahnih et al. 2019); the 1,240 bp PCR product was cloned using a pTOPO-T vector (Aidlab, China) and sequenced. In pairwise comparison, the obtained nt sequences shared 92.6 to 95.2% identity to the corresponding HTS sequence, confirming the presence of GKSV in the sample. The complete GKSV genome sequence was obtained as two pieces of overlapping DNA sequence using primers GKSV-20A/20B (5'-TAGTCTGGATTTCCCTACCT/5'-CTCCCTAAACTGATTTGATG) and GKSV-25A/25B (5'-GCCACTGGTGAATGAAAAGA/5'-CTAAATGAATGGGCAGGTAT) designed based on the HTS-generated sequence. The 5' and 3' termini were determined by rapid amplification of cDNA ends using SMARTer RACE 5'/3' Kit (Takara, Dalian, China). The complete genome of GKSV isolate CS (MW582898) comprised 7,604 nt (without the polyA tail) and shared 77.8 to 89.2% identities with the other nine reported GKSV isolates, among which it shared the highest nt identity (89.2%) with GKSV-127. In phylogenetic analysis based on complete or nearly complete genome sequences of representative members of Betaflexiviridae, GKSV-CS clustered with the nine known GKSV isolates, forming a subclade with GKSV-127 (Supplementary Fig. 1). To determine the incidence and distribution of GKSV in China, 476 grapevine samples of 75 cultivars were collected from 20 provinces and tested by RT-PCR using primers GKSV-F/R (Al Rwahnih et al. 2019) and Vini-F1/R1 (Marais et al. 2020). The results showed that 0.42% (2 of 476) of the samples tested positive with both primers, including samples GKSV-CS and a 'Black Monukka' grape (native to India) also sampled from Xinjiang. Both PCR products of 'Black Monukka' were cloned and sequenced (MZ311588 to MZ311602) and they showed 85.1 to 88.9% nt identities to the GKSV-CS sequence. This is the first report of GKSV infecting grapevine in China. Although the pathogenicity of GKSV is yet to be determined, it has been found in several countries such as USA (Al Rwahnih et al. 2019), France (Marais et al. 2020) and China (this study). Both positive samples in this study were collected from Nanjiang region in Xinjiang province, indicating the sporadic occurrence of GKSV in this area.

Identification and Characterization of a Novel Emaravirus From Grapevine Showing Chlorotic Mottling Symptoms.

A novel negative-sense, single-stranded (ss) RNA virus was identified in a "Shennong Jinhuanghou" (SJ) grapevine showing severe chlorotic mottling symptoms by integrating high-throughput sequencing (HTS) and conventional Sanger sequencing of reverse transcription polymerase chain reaction (RT-PCR) products. The virus was provisionally named as "grapevine emaravirus A" (GEVA). GEVA had a genome comprising five genomic RNA segments, each containing a single open reading frame on the viral complementary strand and two untranslated regions with complementary 13- nt stretches at the 5' and 3' terminal ends. RNA1 (7,090 nt), RNA2 (2,097 nt), RNA3 (1,615 nt), and RNA4 (1,640 nt) encoded putative proteins P1-P4 that, based on their conserved motifs, were identified as the RNA-dependent RNA polymerase, glycoprotein, nucleocapsid protein, and movement protein, respectively. However, the functional role of protein P5 encoded by RNA5 (1,308 nt) could not be determined. Phylogenetic trees constructed based on amino acids of P1 to P4, allocated GEVA in clade I, together with other species-related emaraviruses. These data support the proposal that GEVA is a representative member of a novel species in the genus Emaravirus of the family Fimoviridae. Moreover, when GEVA was graft-transmitted to SJ and "Beta" grapevines, all grafted plants showed the same symptoms, similar to those observed in the source of the inoculum. This is the first report to our knowledge of an emaravirus infecting grapevine and its possible association with chlorotic mottling symptoms.

First report of apple rubbery wood virus 1 in apple in China.

More than 30 viral and subviral pathogens infect apple (Malus domestica, an important fruit crop in China) trees and rootstocks, posing a threat to its production. With advances in diagnostic technologies, new viruses including apple rubbery wood virus 1 (ARWV-1), apple rubbery wood virus 2 (ARWV-2), apple luteovirus 1 (ALV), and citrus virus A (CiVA) have been detected (Beatriz et al. 2018; Rott et al. 2018; Hu et al. 2021). ARWV-1 (family Phenuiviridae) is a negative-sense single-stranded RNA virus with three RNA segments (large [L], medium [M], and small [S]). It causes apple rubbery wood disease (Rott et al. 2018) and is found in apple rootstocks, causing leaf yellowing and mottle symptoms in Korea (Lim et al. 2018). To determine virus prevalence in apple trees in China, 200 apple leaf and shoot samples were collected from orchards in Hebei (n = 26), Liaoning (n = 40), Shandong (n = 100), Yunnan (n = 25), Shanxi (n = 4) and Inner Mongolia (5) in 2020. Total RNA was extracted from the shoot phloem or leaf tissues (Hu et al., 2015) and subjected to reverse transcription (RT)-PCR to detect apple chlorotic leaf spot virus (ACLSV), apple stem pitting virus (ASPV), apple stem grooving virus (ASGV), apple necrotic mosaic virus (ApNMV), apple scar skin viroid (ASSVd), ARWV-2, ARWV-1, ALVand CiVA using primers specific to respective viruses (Supplementary Table 1). The prevalence of ACLSV, ASPV, ASGV, ApNMV, ASSVd, ARWV-2, ARWV-1, ALV and CiVA was found to be 75.5%, 85.5%, 86.0%, 43.0%, 4.0%, 48.5%, 10.5%, 0% and 0%, respectively (Supplementary Table 2). Among the 21 positive samples for ARWV-1, three, five and 13 samples were from Hebei, Liaoning and Shandong, respectively. Five ARWV-1-positive samples (cultivars Xinhongjiangjun, Xiangfu-1, Xiangfu-2 and Tianhong) showed leaf mosaic symptoms. To confirm the RT-PCR assay, the projected ARWV-1 amplicons from cvs. Xiangfu-1 and Tianhong were cloned into the pMD18-T vector (Takara, Dalian, China), and three clones of each sample were sequenced. BLASTn analyses demonstrated that the sequences (accession nos. MW507810-MW507811) shared 96.9%-98.9% identity withARWV-1 sequences (MH714536, MF062127, and MF062138) in GenBank. An lncRNA library was prepared for high-throughput sequencing (HTS) with the Illumina HiSeq platform using Xiangfu-1 RNA. A total of 71,613,294 reads were obtained. De novo assembly of the reads revealed 135 viral sequence contigs of ACLSV, ASGV, ASPV, ApNMV, ARWV-1, and ARWV-2. The sequences of contig-100_88981 (302 nt) and contig-100_25701 (834 nt) (accession nos. MW507821 and MW507820) matched those of segment S from ARWV-1, whereas the sequences of contig-100_6542 (1,660 nt) and contig-100_27 (7,364 nt) (accession nos. MW507819 and MW507818) matched those of segments M and L, respectively. To confirm the HTS results, fragments of segments L (744 bp), M (747 bp), and S (554 bp) from Xiangfu-1 and Tianhong were amplified (Supplementary Table 1) and sequenced. The sequences (accession nos. MW507812-MW507817) showed 94.8%-99.9% nucleotide identity with the corresponding segments of ARWV-1. Co-infection of ARWV-1 with ApNMV and/or ARWV-2 was confirmed in 17/21 ARWV-1-positive samples. The prevalence of ARWV-1/ApNMV, ARWV-1/ARWV-2, and ARWV-1/ApNMV/ARWV-2 infections was 61.9%, 71.4%, and 52.4%, respectively. To our knowledge, this is the first report of ARWV-1 infecting apple trees in China. Further research is needed to determine whether and how ARWV-1 affects apple yield and quality.

Development of a Full-Length Infectious cDNA Clone of the Grapevine Berry Inner Necrosis Virus.

Grapevine berry inner necrosis virus (GINV) belongs to the genus Trichovirus in the family Betaflexiviridae. The GINV isolate LN_BETA_RS was obtained from a "Beta" grapevine (Vitis riparia × Vitis labrusca) exhibiting chlorotic mottling and ring spot in Xingcheng, Liaoning Province, China. To verify the correlation between GINV and grapevine chlorotic mottling and ring spot disease, we constructed an infectious cDNA clone of GINV isolate LN_BETA_RS using the seamless assembly approach. Applied treatments of agroinfiltration infectious cDNA confirmed systemic GINV infection of the Nicotianaoccidentalis 37B by reverse transcription polymerase chain reaction (RT-PCR) and transmission electron microscopy, exhibiting chlorotic mottling symptoms on leaves. Infectious cDNA was also transmitted to new healthy N. occidentalis plants through rub-inoculation. Moreover, the cDNA clone was agroinfiltrated into "Beta" and "Thompson Seedless" grapevine plantlets, and the inoculated grapevines exhibited leaf chlorotic mottling and ringspot during the two years of observation. GINV-inoculated "Beta" grapevines had serious leaf chlorotic mottling and ringspot symptoms on the whole plant, while relatively few symptoms were observed on the leaves of agroinoculated "Thompson Seedless" grapevines in early spring and only weak ring spot gradually appeared later in the top young leaves. Our experiments fulfilled Koch's postulates and revealed the causative role of GINV in grapevine chlorotic mottling and ring spot disease.

First report of apple rubbery wood virus 2 infection of apples in China.

Apple (Malus) is one of the most widely grown fruit trees worldwide, and viral diseases can severely inhibit its growth and development. Apple rubbery wood virus 2 (ARWV-2, family Phenuiviridae) is a negative-sense single-stranded RNA virus whose genome comprises three RNA segments (large: L, medium: M, and small: S) (Rott et al. 2018). This virus is associated with apple rubbery wood disease (Rott et al. 2018) and has previously been found in pear (Pyrus spp.) in China (Wang et al. 2019). In autumn 2019, six trees (one each of cvs. Honglu, Hongzhengzhu, Jinxiuhaitang, Liquanduanfu, Huahong-1, and Huahong-2) showing mosaic disease-like symptoms in the leaves and two trees (one each of cvs. Qingming-1 and Qingming-2) showing rusty skin symptoms (i.e., a large number of irregular rust spots on the peel's surface) in the fruits were found in Xingcheng, Liaoning province, China. Shoots of the diseased plants were collected, and total RNA was extracted from the phloem of the samples as described by Hu et al. (2015). Reverse transcription (RT)-PCR was used to detect various viruses including apple chlorotic leaf spot virus (ACLSV), apple stem pitting virus (ASPV), apple stem grooving virus (ASGV), apple necrotic mosaic virus (ApNMV), and ARWV-2 as well as apple scar skin viroid (ASSVd) using their respective primers (Supplementary Table 1). ACLSV, ASPV and ASGV were detected in all samples. ApNMV was detected in the six trees with leaf mosaic symptoms and ASSVd was detected in the two trees with apple rusty skin symptoms. Moreover, five trees (cvs. Honglu, Hongzhengzhu, Jinxiuhaitang, Qingming-1, and Qingming-2) tested positive for ARWV-2 in the RT-PCR assay. The PCR products of ARWV-2 from Honglu and Qingming-2 were cloned into the pMD18-T vector (Takara, Dalian, China), and one clone of each of the samples was sequenced. BLASTn analyses showed that they shared 98.2%-99.2% nt identity with ARWV-2 sequences (MT901298-MT901299) deposited in the GenBank database. A small RNAs (sRNAs) library was prepared for high-throughput sequencing (HTS) with the Solexa-Illumina platform using phloem tissue collected from a Qingming-2 tree in which apples with rusty skin symptoms were observed. A total of 3,7746,671 reads were obtained from the library. De novo assembly of the reads yielded 1,378 viral sequence contigs. Of those, 20 contigs with lengths ranging from 82 to 387 nt were mapped to the reference genome of ARWV-2 (accession nos. MT733339-MT733344, MT901300-MT901313). In addition, contigs of ACLSV, ASPV, ASGV, ApNMV and ASSVd were detected. To further confirm the HTS results, partial length fragments of segments L (717 bp), M (645 bp), and S (657 bp) of the ARWV-2 genome were amplified from Qingming-2 using primers (Supplementary Table 1) and sequenced. The resulting sequences, which have been deposited in GenBank under the accession numbers MT364372-MT364374, showed 97.2%, 97.8%, and 98.0% nt identity, respectively, with the corresponding segments of ARWV-2 isolate R7 (accession nos. MF062144-MF062146). To understand the infection status of apple trees in China with regard to ARWV-2, 116 apple shoot samples were randomly collected from commercial orchards in Liaoning, Shanxi, and Shandong provinces and subjected to RT-PCR to detect ARWV-2, ACLSV, ASGV, ASPV, ASSVd and ApNMV. In total, 49 (42.2%) of the 116 samples tested positive for ARWV-2, suggesting that this virus is wide spread in apple trees in China (Supplementary Table 2). The mixed-infection rates of ARWV-2/ApNMV and ARWV-2/ASSVd were 18.1% (21/116) and 3.4% (4/116), respectively. Among the 46 ARWV-2-positive samples, seven had mosaic disease-like symptoms in the leaves and three had rusty skin symptoms in the fruits. To our knowledge, this is the first report of ARWV-2 infection in apples showing rusty skin symptoms, as well as the first report of ARWV-2 infection in domestic apples in China. Further research is needed to understand the distribution of ARWV-2 in apple orchards throughout China, to confirm the relationship of ARWV-2 with different symptoms and to evaluate how ARWV-2 affects the performance and quality of apple.

Accuracy of 3-T MRI for Preoperative T Staging of Esophageal Cancer After Neoadjuvant Chemotherapy, With Histopathologic Correlation.

OBJECTIVE: The purpose of this study was to explore the value of 3-T MRI for evaluating the preoperative T staging of esophageal cancer (EC) treated with neoadjuvant chemotherapy (NAC), with histopathologic confirmation. SUBJECTS AND METHODS: This prospective study enrolled patients for whom endoscopic biopsy showed EC and pretreatment CT showed stage cT1N+M0 or cT2-T4aN0-N3M0. All patients received two cycles of NAC (paclitaxel and nedaplatin protocol) followed by 3-T MRI and surgical resection. Readers assigned a T category on MRI, and postoperative pathologic confirmation was considered the reference standard. Interreader agreement, the diagnostic accuracy of T staging on T2-weighted turbo spin-echo (TSE) BLADE (Siemens Healthcare), contrast-enhanced StarVIBE (Siemens Healthcare), high-resolution delayed phase StarVIBE, and the combination of the three sequences were analyzed and compared with postoperative pathologic T staging. RESULTS: The study included 79 patients. Mean time between NAC and MRI was 23 days. Interreader agreements of T category assignment were excellent for T2-weighted TSE BLADE (κ = 0.810, p < 0.0001), contrast-enhanced StarVIBE (κ = 0.845, p < 0.0001), high-resolution delayed phase StarVIBE (κ = 0.897, p < 0.0001), and the combination of the three sequences (κ = 0.880, p < 0.0001). The highest accuracy for T0, T1, T2, and T4a lesions was on high-resolution delayed phase StarVIBE (96.2%, 92.4%, 91.1%, and 91.1% for reader 1; 94.9%, 89.9%, 91.1%, and 94.9% for reader 2), and the highest accuracy for T3 lesions was on T2-weighted TSE BLADE (92.4% and 94.9% for reader 1 and reader 2, respectively). Diagnostic accuracy of the combination of the three sequences was not improved compared with individual sequences. CONCLUSION: High-resolution delayed phase StarVIBE had the highest diagnostic accuracy in staging EC after NAC for all T categories except T3, for which T2-weighted TSE BLADE had the highest accuracy. Combining all three sequences did not improve diagnostic accuracy.

Author Correction: Differentiated surface fungal communities at point of harvest on apple fruits from rural and peri-urban orchards.

A correction to this article has been published and is linked from the HTML and PDF versions of this paper. The error has not been fixed in the paper.

Differentiated surface fungal communities at point of harvest on apple fruits from rural and peri-urban orchards.

The diverse fungal communities that colonize fruit surfaces are closely associated with fruit development, preservation and quality control. However, the overall fungi adhering to the fruit surface and the inference of environmental factors are still unknown. Here, we characterized the fungal signatures on apple surfaces by sequencing internal transcribed spacer 1 (ITS1) region. We collected the surface fungal communities from apple fruits cultivated in rural and peri-urban orchards. A total of 111 fungal genera belonging to 4 phyla were identified, showing remarkable fungal diversity on the apple surface. Comparative analysis of rural samples harboured higher fungal diversity than those from peri-urban orchards. In addition, fungal composition varied significantly across apple samples. At the genus level, the protective genera Coniothyrium, Paraphaeosphaeria and Periconia were enriched in rural samples. The pathogenic genera Acremonium, Aspergillus, Penicillium and Tilletiposis were enriched in peri-urban samples. Our findings indicate that rural samples maintained more diverse fungal communities on apple surfaces, whereas peri-urban-planted apple carried potential pathogenic risks. This study sheds light on ways to improve fruit cultivation and disease prevention practices.

Comparison between free-breathing radial VIBE on 3-T MRI and endoscopic ultrasound for preoperative T staging of resectable oesophageal cancer, with histopathological correlation.

OBJECTIVES: To compare the T staging of resectable oesophageal cancer (OC) using radial VIBE (r-VIBE) and endoscopic ultrasound (EUS) with pathological confirmation of the T stage. METHODS: Forty-three patients with endoscopically proven OC and indeterminate T1/T2/T3/T4a stage by computed tomography (CT) and EUS were imaged on a 3-T magnetic resonance imaging (MRI) scanner. T stage was scored on MRI and EUS by two independent radiologists and one endoscopist, respectively, and compared with postoperative pathological findings. T staging agreement between r-VIBE and EUS with postoperative pathological T staging was analysed by a kappa test. RESULTS: EUS and pathological T staging showed agreement of 69.8% (30/43). Radial VIBE and pathological T staging agreement was 86.0% (37/43) and 90.7% (39/43) for readers 1 and 2, respectively. High accuracy for T1/T2 stage was obtained for both r-VIBE readers (90.5% and 100% for reader 1 and reader 2, respectively) and EUS reader (100%). For T3/T4, r-VIBE showed accuracy of 81.8% and 90.9% for reader 1 and reader 2, respectively, while for EUS, accuracy was only 68.2% compared with pathological T staging. CONCLUSIONS: Contrast-enhanced r-VIBE is comparable to EUS in T staging of resectable OC with stage of T1/T2, and is superior to EUS in staging of T3/T4 lesions. KEY POINTS: • Radial VIBE may be useful in preoperative T staging of OC • Accuracy of staging on r-VIBE is higher in T1/2 than in T3/4 • Accuracy of EUS was 100% and 68.2% for T1/T2 and T3/T4 stage • Inter-reader agreement of T staging for r-VIBE was good.