IgM in human immunity to Plasmodium falciparum malaria.

Most studies on human immunity to malaria have focused on the roles of immunoglobulin G (IgG), whereas the roles of IgM remain undefined. Analyzing multiple human cohorts to assess the dynamics of malaria-specific IgM during experimentally induced and naturally acquired malaria, we identified IgM activity against blood-stage parasites. We found that merozoite-specific IgM appears rapidly in Plasmodium falciparum infection and is prominent during malaria in children and adults with lifetime exposure, together with IgG. Unexpectedly, IgM persisted for extended periods of time; we found no difference in decay of merozoite-specific IgM over time compared to that of IgG. IgM blocked merozoite invasion of red blood cells in a complement-dependent manner. IgM was also associated with significantly reduced risk of clinical malaria in a longitudinal cohort of children. These findings suggest that merozoite-specific IgM is an important functional and long-lived antibody response targeting blood-stage malaria parasites that contributes to malaria immunity.

The Australasian contribution to malaria vaccine development.

Malaria remains a major threat to public health worldwide, despite intense research efforts spanning decades. Much of this work has been directed towards developing an effective malaria vaccine, and scientists from Australasia have made significant contributions to progress in this area. Herein, we review the research undertaken in Australasia and summarize some of the important roles that Australasian researchers have played in malaria vaccine development that has occurred outside the region.

Massive transfusion--evaluation of current clinical practice and outcome in two large teaching hospital trusts in Northern England.

BACKGROUND AND OBJECTIVES: Although numerous guidelines exist for the management of massive blood loss, there have been few data confirming whether these guidelines are observed in practice or whether compliance results in improved outcome. We have performed a retrospective audit of cases of massive transfusion in two major teaching hospital trusts in Northern England to investigate the use of blood components and patient outcome. MATERIALS AND METHODS: The massive transfusion population was electronically derived from a list of all blood component transfusions in 2006. Data from the intensive care and patient administration databases established hospital outcome. Factors independently predictive of survival were identified by logistic regression. Data are presented as medians and interquartile ranges. Odds ratios (OR) are given with 95% confidence intervals. RESULTS: Two hundred and four patients had a massive transfusion. Although only 1.3% of all transfused patients, the massive transfusion group used 10% of the total blood products. Their mortality rate was 34%. Factors independently predictive of survival were: a ratio of fresh frozen plasma: red blood cells > 1.1, OR 7.22 (1.95-26.68), and elective surgery, OR 4.56 (1.88-11.05). Factors independently predictive of death were: age (per year), OR 0.97 (0.95-0.99), liver disease, OR 0.25 (0.09-0.70), male gender, OR 0.41 (0.19-0.89), vascular surgery, OR 0.34 (0.12-0.96) and number of adult packs of platelets transfused, OR 0.69 (0.57-0.83). CONCLUSION: Massive transfusion occurs rarely but has a high mortality and requires a disproportionate amount of blood products. An increased ratio of fresh frozen plasma to red blood cells was associated with improved outcome.

Meta-analysis of immune epitope data for all Plasmodia: overview and applications for malarial immunobiology and vaccine-related issues.

We present a comprehensive meta-analysis of more than 500 references, describing nearly 5000 unique B cell and T cell epitopes derived from the Plasmodium genus, and detailing thousands of immunological assays. This is the first inventory of epitope data related to malaria-specific immunology, plasmodial pathogenesis, and vaccine performance. The survey included host and pathogen species distribution of epitopes, the number of antibody vs. CD4(+) and CD8(+) T cell epitopes, the genomic distribution of recognized epitopes, variance among epitopes from different parasite strains, and the characterization of protective epitopes and of epitopes associated with parasite evasion of the host immune response. The results identify knowledge gaps and areas for further investigation. This information has relevance to issues, such as the identification of epitopes and antigens associated with protective immunity, the design and development of candidate malaria vaccines, and characterization of immune response to strain polymorphisms.

Identification of minimal CD8+ and CD4+ T cell epitopes in the Plasmodium yoelii hepatocyte erythrocyte protein 17kDa.

Immunization of mice with subunit vaccines based on the Plasmodium yoelii 17kDa hepatocyte erythrocyte protein (PyHEP17), orthologue of Plasmodium falciparum exported protein 1 (PfExp1), induces antigen-specific immune responses and protects against sporozoite challenge. To aid in the characterization of candidate subunit vaccines based on this antigen, we have mapped the immunodominant and subdominant CD8+ and CD4+ T cell epitopes on PyHEP17. Using a panel of 29 15-mer synthetic peptides representing the complete sequence of PyHEP17 (amino acids 1-153), and overlapping each other by 10 residues, we identified an immunogenic region between amino acids 61-85. To define the minimal CD4+ and CD8+ T cell epitopes within this region, we synthesized 25 9-mer peptides overlapping each other by one residue. We screened the capacity of the 15-mer and 9-mer peptides to be recognized by splenocytes and lymph node cells from mice immunized with PyHEP17 plasmid DNA or peptides in Freund's adjuvant, as assessed by cytokine secretion, lymphoproliferation, and cytotoxicity. The profile of response to the T cell epitopes varied depending upon the immunization regimen. Antigen-specific T cell responses were detected to three 15-mer peptides (residues 61-75, 66-80 and 71-85) representing two 10-mer epitopes mapping to residues 66-75 (LTKNKKSLRK) and 71-80 (KSLRKINVAL). IFN-gamma responses after DNA immunization predominantly mapped to two overlapping 9-mer peptides (residues 73-81 and 74-82) sharing an eight amino acid overlap (residues 74-81, RKINVALA), whereas CTL responses predominantly mapped to four 9-mer peptides (residues 61-69, 70-78, 76-84, and 84-92). In addition, a subdominant 10-mer CD8+ T cell epitope recognized by peptide immunization but not DNA immunization mapped to residues 31-40 (GKYGSQNVIK). The identification of these epitopes will allow the evaluation of delivery systems for malaria vaccine candidates as well as the delineation of protective immune mechanisms.

Mutating the anchor residues associated with MHC binding inhibits and deviates CD8+ T cell mediated protective immunity against malaria.

We investigated whether immune responses induced by immunization with plasmid DNA are restricted predominantly to immunodominant CD8+ T cell epitopes, or are raised against a breadth of epitopes including subdominant CD8+ and CD4+ T cell epitopes. Site-directed mutagenesis was used to change one or more primary anchor residues of the immunodominant CD8+ T cell epitope on the Plasmodium yoelii circumsporozoite protein, and in vivo protective efficacy and immune responses against defined PyCSP CD8+ and/or CD4+ epitopes were determined. Mutation of the P2 but not P9 or P10 anchor residues decreased protection and completely abrogated the antigen-specific CD8+ CTL activity and CD8+ dependent IFN-gamma responses to the immunodominant CD8+ epitope and overlapping CD8+/CD4+ epitope. Moreover, mutation deviated the immune response towards a CD4+ T cell IFN-gamma dependent profile, with enhanced lymphoproliferative responses to the immunodominant and subdominant CD4+ epitopes and enhanced antibody responses. Responses to the subdominant CD8+ epitope were not induced. Our data demonstrate that protective immunity induced by PyCSP DNA vaccination is directed predominantly against the single immunodominant CD8+ epitope, and that although responses can be induced against other epitopes, these are mediated by CD4+ T cells and are not capable of conferring optimal protection against challenge.

Immune response to pre-erythrocytic stages of malaria parasites.

Immunization with radiation-attenuated Plasmodium spp. sporozoites induces sterile protective immunity against parasite challenge. This immunity is targeted primarily against the intrahepatic parasite and appears to be sustained long term even in the absence of sporozoite exposure. It is mediated by multifactorial mechanisms, including T cells directed against parasite antigens expressed in the liver stage of the parasite life cycle and antibodies directed against sporozoite surface proteins. In rodent models, CD8+ T cells have been implicated as the principal effector cells, and IFN-gamma as a critical effector molecule. IL-4 secreting CD4+ T cells are required for induction of the CD8+ T cell responses, and Th1 CD4+ T cells provide help for optimal CD8+ T cell effector activity. Components of the innate immune system, including gamma-delta T cells, natural killer cells and natural killer T cells, also play a role. The precise nature of pre-erythrocytic stage immunity in humans, including the contribution of these immune responses to the age-dependent immunity naturally acquired by residents of malaria endemic areas, is still poorly defined. The importance of immune effector targets at the pre-erythrocytic stage of the parasite life cycle is highlighted by the fact that infection-blocking immunity in humans rarely, if ever, occurs under natural conditions. Herein, we review our current understanding of the molecular and cellular aspects of pre-erythrocytic stage immunity.

Utilization of genomic sequence information to develop malaria vaccines.

Recent advances in the fields of genomics, proteomics and molecular immunology offer tremendous opportunities for the development of novel interventions against public health threats, including malaria. However, there is currently no algorithm that can effectively identify the targets of protective T cell or antibody responses from genomic data. Furthermore, the identification of antigens that will stimulate the most effective immunity against the target pathogen is problematic, particularly if the genome is large. Malaria is an attractive model for the development and validation of approaches to translate genomic information to vaccine development because of the critical need for effective anti-malarial interventions and because the Plasmodium parasite is a complex multistage pathogen targeted by multiple immune responses. Sterile protective immunity can be achieved by immunization with radiation-attenuated sporozoites, and anti-disease immunity can be induced in residents in malaria-endemic areas. However, the 23 Mb Plasmodium falciparum genome encodes more than 5,300 proteins, each of which is a potential target of protective immune responses. The current generation of subunit vaccines is based on a single or few antigens and therefore might elicit too narrow a breadth of response. We are working towards the development of a new generation vaccine based on the presumption that duplicating the protection induced by the whole organism may require a vaccine nearly as complex as the organism itself. Here, we present our strategy to exploit the genomic sequence of P. falciparum for malaria vaccine development.

Determining liver stage parasite burden by real time quantitative PCR as a method for evaluating pre-erythrocytic malaria vaccine efficacy.

The detection and quantitation of blood stage parasitaemia is typically used as a surrogate endpoint for estimating the efficacy of vaccines targeted against the hepatic stage, as well as the erythrocytic stage, of the parasite. However, this does not provide an adequate means of evaluating the efficacy of vaccines, which may be only partially effective at the liver-stage. This is a particular concern for effective evaluation of immune enhancement strategies for candidate pre-erythrocytic stage vaccines. Here, we have developed and validated a method for detecting and quantitating liver stage parasites, using the TaqMan fluorescent real-time quantitative PCR system (PE Applied Biosystems). This method uses TaqMan primers designed to the Plasmodium yoelii 18S rRNA gene and rodent GAPDH to amplify products from infected mouse liver cDNA. The technique is highly reproducible as demonstrated with plasmid controls and capable of efficiently quantitating liver-stage parasite burden following a range of sporozoite challenge doses in strains of mice, which differ in their susceptibility to sporozoite infection. We have further demonstrated the capacity of this technique to evaluate the efficacy of a range of pre-erythrocytic stage vaccines. Our data establish this quantitative real-time PCR assay to be a fast and reproducible way of accurately assessing liver stage parasite burden and vaccine efficacy in rodent malaria models.

Expression of the chemokine MIG is a sensitive and predictive marker for antigen-specific, genetically restricted IFN-gamma production and IFN-gamma-secreting cells.

The evaluation of antigen-specific immune responses is critical for understanding the mechanisms of immune protection and for establishing the efficacy of candidate vaccines. Here, we describe a novel assay for IFN-gamma activity which is based on the flow cytometric detection of the chemokine, monokine induced by gamma interferon (MIG) as a sensitive and predictive measure of IFN-gamma-mediated effector function, and a surrogate marker for IFN-gamma-producing cells. Upregulation of MIG expression was demonstrated following in vitro activation of peripheral blood mononuclear cells (PBMCs) with defined CD8+ T-cell epitopes derived from influenza virus, cytomegalovirus (CMV), or Epstein-Barr virus (EBV) and was antigen-specific, genetically restricted and dependent on both CD8+ T cells and IFN-gamma. Furthermore, antigen-specific MIG expression was also demonstrated with Plasmodium falciparum circumsporozoite protein (CSP) peptides, using PBMCs from volunteers immunized with irradiated P. falciparum sporozoites. In multiple parallel experiments, the MIG assay was compared to conventional IFN-gamma ELISPOT, IFN-gamma ELISA, MIG ELISA and intracellular cytokine staining assays. The level of MIG expression was shown to be directly associated with the number of IFN-gamma spot-forming cells (SFCs) detected by ELISPOT (r2=0.94). Moreover, in all instances where cultures were considered positive by ELISPOT, a higher stimulation index was noted with the MIG assay as compared with the ELISPOT assay (on average at least threefold higher) and, in some cases, responses as detected by the MIG assay were significant, but the corresponding response as measured by ELISPOT was not significant. Finally, the flow-based MIG assay offers a number of practical and technical advantages over the ELISPOT assay. Our data validate this novel method for the detection of low as well as high levels of antigen-specific and genetically restricted IFN-gamma activity.

Induction of CD4(+) T cell-dependent CD8(+) type 1 responses in humans by a malaria DNA vaccine.

We assessed immunogenicity of a malaria DNA vaccine administered by needle i.m. or needleless jet injection [i.m. or i.m./intradermally (i.d.)] in 14 volunteers. Antigen-specific IFN-gamma responses were detected by enzyme-linked immunospot (ELISPOT) assays in all subjects to multiple 9- to 23-aa peptides containing class I and/or class II restricted epitopes, and were dependent on both CD8(+) and CD4(+) T cells. Overall, frequency of response was significantly greater after i.m. jet injection. CD8(+)-dependent cytotoxic T lymphocytes (CTL) were detected in 8/14 volunteers. Demonstration in humans of elicitation of the class I restricted IFN-gamma responses we believe necessary for protection against the liver stage of malaria parasites brings us closer to an effective malaria vaccine.

DNA-based vaccines against malaria: status and promise of the Multi-Stage Malaria DNA Vaccine Operation.

The introduction of DNA vaccine technology has facilitated an unprecedented multi-antigen approach to developing an effective vaccine against complex pathogens such as the Plasmodium spp. parasites that cause malaria. We have established the capacity of DNA vaccines encoding Plasmodium antigens to induce CD8(+) cytotoxic T lymphocyte and interferon-gamma responses in mice, monkeys and humans. However, like others, we have found that the first or second generation DNA vaccines on their own are not optimal, and have demonstrated the potential of heterologous prime/boost immunisation strategies involving priming with DNA and boosting with poxvirus or recombinant protein in adjuvant. In this review, we summarise the current status and promise of our programmatic efforts to develop a DNA-based vaccine against malaria, our Multi-Stage Malaria DNA Vaccine Operation, and illustrate the transition of promising developments in the laboratory to clinical assessment in humans.

Interleukin-12- and gamma interferon-dependent protection against malaria conferred by CpG oligodeoxynucleotide in mice.

Unmethylated CpG dinucleotides in bacterial DNA or synthetic oligodeoxynucleotides (ODNs) cause B-cell proliferation and immunoglobulin secretion, monocyte cytokine secretion, and activation of natural killer (NK) cell lytic activity and gamma interferon (IFN-gamma) secretion in vivo and in vitro. The potent Th1-like immune activation by CpG ODNs suggests a possible utility for enhancing innate immunity against infectious pathogens. We therefore investigated whether the innate immune response could protect against malaria. Treatment of mice with CpG ODN 1826 (TCCATGACGTTCCTGACGTT, with the CpG dinucleotides underlined) or 1585 (ggGGTCAACGTTGAgggggG, with g representing diester linkages and phosphorothioate linkages being to the right of lowercase letters) in the absence of antigen 1 to 2 days prior to challenge with Plasmodium yoelii sporozoites conferred sterile protection against infection. A higher level of protection was consistently induced by CpG ODN 1826 compared with CpG ODN 1585. The protective effects of both CpG ODNs were dependent on interleukin-12, as well as IFN-gamma. Moreover, CD8+ T cells (but not CD4+ T cells), NK cells, and nitric oxide were implicated in the CpG ODN 1585-induced protection. These data establish that the protective mechanism induced by administration of CpG ODN 1585 in the absence of parasite antigen is similar in nature to the mechanism induced by immunization with radiation-attenuated P. yoelii sporozoites or with plasmid DNA encoding preerythrocytic-stage P. yoelii antigens. We were unable to confirm whether CD8+ T cells, NK cells, or nitric oxide were required for the CpG ODN 1826-induced protection, but this may reflect differences in the potency of the ODNs rather than a real difference in the mechanism of action of the two ODNs. This is the first report that stimulation of the innate immune system by CpG immunostimulatory motifs can confer sterile protection against malaria.

Research note: HLA degenerate T-cell epitopes from Plasmodium falciparum liver stage-specific antigen 1 (LSA-1) are highly conserved in isolates from geographically distinct areas.

Considerable effort is directed at the development of a malaria vaccine that elicits antigen-specific T-cell responses against pre-erythrocytic antigens of Plasmodium falciparum. Genetic restriction of host T-cell responses and polymorphism of target epitopes on parasite antigens pose obstacles to the development of such a vaccine. Liver stage-specific antigen-1 (LSA-1) is a prime candidate vaccine antigen and five T-cell epitopes that are degenerately restricted by HLA molecules common in most populations have been identified on LSA-1. To define the extent of polymorphism within these T-cell epitopes, the N-terminal non-repetitive region of the LSA-1 gene from Malaysian P. falciparum field isolates was sequenced and compared with data of isolates from Brazil, Kenya and Papua New Guinea. Three of the T-cell epitopes were completely conserved while the remaining two were highly conserved in the isolates examined. Our findings underscore the potential of including these HLA-degenerate T-cell epitopes of LSA-1 in a subunit vaccine.

HLA-DR-promiscuous T cell epitopes from Plasmodium falciparum pre-erythrocytic-stage antigens restricted by multiple HLA class II alleles.

Previously, we identified and established the antigenicity of 17 CD8+ T cell epitopes from five P. falciparum Ags that are restricted by multiple common HLA class I alleles. Here, we report the identification of 11 peptides from the same Ags, cicumsporozoite protein, sporozoite surface protein 2, exported protein-1, and liver-stage Ag-1, that bind between at least five and up to 11 different HLA-DR molecules representative of the most common HLA-DR Ags worldwide. These peptides recall lymphoproliferative and cytokine responses in immune individuals experimentally immunized with radiation-attenuated Plasmodium falciparum sporozoites (irradiated sporozoites) or semi-immune individuals naturally exposed to malaria in Irian Jaya or Kenya. We establish that all peptides are recognized by individuals of each of the three populations, and that the frequency and magnitude of helper T lymphocyte responses to each peptide is influenced by the intensity of exposure to P. falciparum sporozoites. Mean frequencies of lymphoproliferative responses are 53.2% (irradiated sporozoites) vs 22.4% (Kenyan) vs 5.8% (Javanese), and mean frequencies of IFN-gamma responses are 66.3% (irradiated sporozoites) vs 27.3% (Kenyan) vs 8. 7% (Javanese). The identification of HLA class II degenerate T cell epitopes from P. falciparum validates our predictive strategy in a biologically relevant system and supports the potential for developing a broadly efficacious epitope-based vaccine against malaria focused on a limited number of peptide specificities.

The complexity of protective immunity against liver-stage malaria.

Sterile protective immunity against challenge with Plasmodium spp. sporozoites can be induced in multiple model systems and humans by immunization with radiation-attenuated Plasmodium spp. sporozoites. The infected hepatocyte has been established as the primary target of this protection, but the underlying mechanisms have not been completely defined. Abs, CD8+ T cells, CD4+ T cells, cytokines (including IFN-gamma and IL-12), and NO have all been implicated as critical effectors. Here, we have investigated the mechanisms of protective immunity induced by immunization with different vaccine delivery systems (irradiated sporozoites, plasmid DNA, synthetic peptide/adjuvant, and multiple Ag peptide) in genetically distinct inbred strains, genetically modified mice, and outbred mice. We establish that there is a marked diversity of T cell-dependent immune responses that mediate sterile protective immunity against liver-stage malaria. Furthermore, we demonstrate that distinct mechanisms of protection are induced in different strains of inbred mice by a single method of immunization, and in the same strain by different methods of immunization. These data underscore the complexity of the murine host response to a parasitic infection and suggest that an outbred human population may behave similarly. Data nevertheless suggest that a pre-erythrocytic-stage vaccine should be designed to induce CD8+ T cell- and IFN-gamma-mediated immune responses and that IFN-gamma responses may represent an in vitro correlate of pre-erythrocytic-stage protective immunity.

Safety, tolerability and humoral immune responses after intramuscular administration of a malaria DNA vaccine to healthy adult volunteers.

DNA-based vaccines are considered to be potentially revolutionary due to their ease of production, low cost, long shelf life, lack of requirement for a cold chain and ability to induce good T-cell responses. Twenty healthy adult volunteers were enrolled in a Phase I safety and tolerability clinical study of a DNA vaccine encoding a malaria antigen. Volunteers received 3 intramuscular injections of one of four different dosages (20, 100, 500 and 2500 microg) of the Plasmodium falciparum circumsporozoite protein (PfCSP) plasmid DNA at monthly intervals and were followed for up to twelve months. Local reactogenicity and systemic symptoms were few and mild. There were no severe or serious adverse events, clinically significant biochemical or hematologic changes, or detectable anti-dsDNA antibodies. Despite induction of excellent CTL responses, intramuscular DNA vaccination via needle injection failed to induce detectable antigen-specific antibodies in any of the volunteers.

Can malaria DNA vaccines on their own be as immunogenic and protective as prime-boost approaches to immunization?

To develop a multi-stage, multi-antigen, multi-immune response-inducing vaccine against malaria we have focused on DNA vaccines because of their simplicity of construction and modification, ease of mixing, and effectiveness in inducing CD8+ T cell responses. DNA malaria vaccines induce CD8+ T cell dependent protection in mice and CD8+ CTL in rhesus monkeys and humans after intramuscular needle administration. Clinical trials in normal, healthy humans are in progress or planned, assessing alternative methods and routes of administration, and the capacity of a plasmid expressing human GM-CSF to enhance the protective efficacy of a five-gene liver-stage malaria vaccine. In mice, we have demonstrated that priming with the combination of DNA plasmids encoding a Plasmodium yoelii protein and murine GM-CSF and boosting with recombinant poxvirus expressing the same P. yoelii protein induces a 30-fold increase in antigen-specific antibodies, a 10-fold increase in antigen-specific IFN-gamma spot forming cells, a significant (p<0.05) increase in protection, and the capacity to reduce the dosage of DNA by 10-100 fold, compared to immunizing with DNA alone. In Aotus monkeys priming with DNA and boosting with recombinant protein in adjuvant is more protective than homologous priming and boosting with either DNA or recombinant protein in adjuvant. Clinical trials are now planned using these immunization strategies. Because of the complexity and cost of the heterologous regimens, we are working to make DNA vaccination alone as immunogenic and protective as the prime-boost approach. Our most encouraging findings have resulted from altering codon usage from the highly A+T rich P. falciparum native sequence to that more closely resembling mammalian sequences. Although much progress is required for the development of a vaccine that provides sustainable protective immunity against malaria, a strategy using DNA vaccine technology as a core component of such a vaccine is promising.