Group-by-Treatment Interaction Effects in Comparative Bioavailability Studies.

Comparative bioavailability studies often involve multiple groups of subjects for a variety of reasons, such as clinical capacity limitations. This raises questions about the validity of pooling data from these groups in the statistical analysis and whether a group-by-treatment interaction should be evaluated. We investigated the presence or absence of group-by-treatment interactions through both simulation techniques and a meta-study of well-controlled trials. Our findings reveal that the test falsely detects an interaction when no true group-by-treatment interaction exists. Conversely, when a true group-by-treatment interaction does exist, it often goes undetected. In our meta-study, the detected group-by-treatment interactions were observed at approximately the level of the test and, thus, can be considered false positives. Testing for a group-by-treatment interaction is both misleading and uninformative. It often falsely identifies an interaction when none exists and fails to detect a real one. This occurs because the test is performed between subjects in crossover designs, and studies are powered to compare treatments within subjects. This work demonstrates a lack of utility for including a group-by-treatment interaction in the model when assessing single-site comparative bioavailability studies, and the clinical trial study structure is divided into groups.

Two for One: Merging Continuing Professional Development and Faculty Development in the CATE Curriculum for Pharmacy Preceptors.

Background: Continuing professional development (CPD) and faculty development (FD) are not traditionally combined, although there is evidence that integrating them enhances knowledge acquisition. Objective: To explore preceptors' perceptions and the effectiveness of CATE (Clinical And Teaching Education), an education model that blends clinical content with the application of that clinical knowledge through a specified teaching technique. Methods: Thirty-five hospital and community pharmacy preceptors from the Leslie Dan Faculty of Pharmacy, University of Toronto, participated in CATE, which consisted of a 2-hour synchronous, online workshop integrating clinical content about depression with the "One-Minute Preceptor" (OMP) teaching skill. Qualitative and quantitative data were collected longitudinally using surveys and semistructured interviews. Participant and process outcomes were explored through descriptive and thematic analysis using a modified Kirkpatrick framework. Results: Participants valued the incorporation of educational theory and opportunities to practise the OMP using scripted role plays based on the depression-related content. The combination of FD and CPD was appealing, although participants wanted more clarity about their integration. The CATE model positively influenced their approaches to serving as preceptors, and using the OMP helped to reveal learners' knowledge gaps. There was a desire to share the teaching technique with colleagues to provide a more cohesive approach to teaching. Conclusions: Integrating CPD and FD in a synchronous, online environment was feasible and well received, and it helped to solidify preceptors' roles as educators. Combining CPD and FD represents an effective strategy to build the clinical and educational expertise of preceptors, which in turn has the potential to improve the quality of experiential learning for pharmacy students. This novel method of fostering the pedagogical growth of preceptors could be a model for other health professions.

Contexte: Le développement professionnel continu (DPC) et le développement professoral (DP) ne sont pas traditionnellement combinés, même s'il existe des éléments probants indiquant que leur intégration renforce l'acquisition des connaissances. Objectif: Examiner les perceptions des précepteurs et l'efficacité du CATE (Clinical And Teaching Education): un modèle pédagogique qui allie le contenu clinique à l'application de ces connaissances cliniques grâce à une technique d'enseignement spécifiée. Méthodologie: Trente-cinq précepteurs de pharmacies d'hôpitaux et communautaires de la Faculté de pharmacie Leslie Dan de l'Université de Toronto ont participé au CATE, qui consistait en un atelier en ligne synchrone de deux heures intégrant un contenu clinique sur la dépression avec la compétence pédagogique « précepteur-minute ¼. Les données qualitatives et quantitatives ont été recueillies longitudinalement à l'aide d'enquêtes et d'entretiens semi-structurés. Les résultats des participants et du processus ont été étudiés au moyen d'une analyse descriptive et thématique utilisant un cadre de Kirkpatrick modifié. Résultats: Les participants ont apprécié l'intégration de la théorie pédagogique et des occasions de pratiquer la compétence du précepteur-minute à l'aide de jeux de rôle scénarisés basés sur le contenu lié à la dépression. La combinaison du DP et du DPC était attrayante, même si les participants souhaitaient plus de clarté sur leur intégration. Le modèle CATE a influencé positivement leurs approches en matière de préceptorat, et l'utilisation de la technique précepteur-minute a contribué à révéler les lacunes des connaissances des apprenants. Il y avait une volonté de partager la technique d'enseignement avec des collègues pour offrir une approche plus cohérente de l'enseignement. Conclusions: L'intégration du DPC et du DP dans un environnement en ligne synchrone était réalisable et a été bien accueillie; elle a contribué à consolider le rôle des précepteurs en tant qu'éducateurs. La combinaison du DPC et du DP constitue une stratégie efficace pour développer l'expertise clinique et pédagogique des précepteurs, ce qui, à son tour, a le potentiel d'améliorer la qualité de l'apprentissage expérientiel des étudiants en pharmacie. Cette nouvelle méthode visant à favoriser la croissance pédagogique des précepteurs pourrait constituer un modèle pour d'autres professions de la santé.

Dissecting knowledge, guessing, and blunder in multiple choice assessments.

Multiple choice results are inherently probabilistic outcomes, as correct responses reflect a combination of knowledge and guessing, while incorrect responses additionally reflect blunder, a confidently committed mistake. To objectively resolve knowledge from responses in an MC test structure, we evaluated probabilistic models that explicitly account for guessing, knowledge and blunder using eight assessments (>9,000 responses) from an undergraduate biotechnology curriculum. A Bayesian implementation of the models, aimed at assessing their robustness to prior beliefs in examinee knowledge, showed that explicit estimators of knowledge are markedly sensitive to prior beliefs with scores as sole input. To overcome this limitation, we examined self-ranked confidence as a proxy knowledge indicator. For our test set, three levels of confidence resolved test performance. Responses rated as least confident were correct more frequently than expected from random selection, reflecting partial knowledge, but were balanced by blunder among the most confident responses. By translating evidence-based guessing and blunder rates to pass marks that statistically qualify a desired level of examinee knowledge, our approach finds practical utility in test analysis and design.

Development and pharmacokinetic evaluation of a self-nanoemulsifying drug delivery system for the oral delivery of cannabidiol.

The number of lipophilic drug candidates in pharmaceutical discovery pipelines has increased in recent years. These drugs often possess physicochemical properties that result in poor oral bioavailability, and their clinical potential may be limited without adequate formulation strategies. Cannabidiol (CBD) is an excellent example of a highly lipophilic compound with poor oral bioavailability, due to low water solubility and extensive first-pass metabolism. An approach that may overcome these limitations is formulation of the drug in self-nanoemulsifying drug delivery systems (SNEDDS). Herein, CBD-SNEDDS formulations were prepared and evaluated in vitro. Promising formulations (F2, F4) were administered to healthy female Sprague-Dawley rats via oral gavage (20 mg/kg CBD). Resulting pharmacokinetic parameters of CBD were compared to those obtained following administration of CBD in two oil-based formulations: a medium-chain triglyceride oil vehicle (MCT-CBD), and a sesame oil-based formulation similar in composition to an FDA-approved formulation of CBD, Epidiolex® (SO-CBD). Compared to MCT-CBD, administration of the SNEDDS formulations led to more rapid absorption of CBD (median Tmax values: 0.5 h (F2), 1 h (F4), 6 h (MCT-CBD)). Administration of F2 and F4 formulations also improved the systemic exposure to CBD by 2.2 and 2.8-fold compared to MCT-CBD; however, no improvement was found compared to SO-CBD.

Volumetric Interplay between the Conformational States Adopted by Guanine-Rich DNA from the c-MYC Promoter.

The kinetic and thermodynamic stabilities of G-quadruplex structures have been extensively studied. In contrast, systematic investigations of the volumetric properties of G-quadruplexes determining their pressure stability are still relatively scarce. The G-rich strand from the promoter region of the c-MYC oncogene (G-strand) is known to adopt a range of conformational states including the duplex, G-quadruplex, and coil states depending on the presence of the complementary C-rich strand (C-strand) and solution conditions. In this work, we report changes in volume, ΔV, and adiabatic compressibility, ΔKS, accompanying interconversions of G-strand between the G-quadruplex, duplex, and coil conformations in the presence and absence of C-strand. We rationalize these volumetric characteristics in terms of the hydration and intrinsic properties of the DNA in each of the sampled conformational states. We further use our volumetric results in conjunction with the reported data on changes in expansibility, ΔE, and heat capacity, ΔCP, associated with G-quadruplex-to-coil transitions to construct the pressure-temperature phase diagram describing the stability of the G-quadruplex. The phase diagram is elliptic in shape, resembling the classical elliptic phase diagram of a globular protein, and is distinct from the phase diagram for duplex DNA. The observed similarity of the pressure-temperature phase diagrams of G-quadruplexes and globular proteins stems from their shared structural and hydration features that, in turn, result in the similarity of their volumetric properties. To the best of our knowledge, this is the first pressure-temperature stability diagram reported for a G-quadruplex.

Cage-lid hanging behavior as a translationally relevant measure of pain in mice.

ABSTRACT: The development of new analgesic drugs has been hampered by the inability to translate preclinical findings to humans. This failure is due in part to the weak connection between commonly used pain outcome measures in rodents and the clinical symptoms of chronic pain. Most rodent studies rely on the use of experimenter-evoked measures of pain and assess behavior under ethologically unnatural conditions, which limits the translational potential of preclinical research. Here, we addressed this problem by conducting an unbiased, prospective study of behavioral changes in mice within a natural homecage environment using conventional preclinical pain assays. Unexpectedly, we observed that cage-lid hanging, a species-specific elective behavior, was the only homecage behavior reliably impacted by pain assays. Noxious stimuli reduced hanging behavior in an intensity-dependent manner, and the reduction in hanging could be restored by analgesics. Finally, we developed an automated approach to assess hanging behavior. Collectively, our results indicate that the depression of hanging behavior is a novel, ethologically valid, and translationally relevant pain outcome measure in mice that could facilitate the study of pain and analgesic development.

Heat-activated drug delivery increases tumor accumulation of synergistic chemotherapies.

Doxorubicin is a clinically important anthracycline chemotherapeutic agent that is used to treat many cancers. Nanomedicine formulations including Doxil® and ThermoDox® have been developed to mitigate doxorubicin cardiotoxicity. Doxil is used clinically to treat ovarian cancer, AIDS-related Kaposi's sarcoma, and multiple myeloma, but there is evidence that therapeutic efficacy is hampered by lack of drug release. ThermoDox is a lipid-based heat-activated formulation of doxorubicin that relies on externally applied energy to increase tissue temperatures and efficiently trigger drug release, thereby affording therapeutic advantages compared to Doxil. However, elevating tissue temperatures is a complex treatment process requiring significant time, cost, and expertise compared to standard intravenous chemotherapy. This work endeavors to develop a companion therapeutic to ThermoDox that also relies on heat-triggered release in order to increase the therapeutic index of doxorubicin. To this end, a thermosensitive liposome formulation of the heat shock protein 90 inhibitor alvespimycin has been developed and characterized. This research demonstrates that both doxorubicin and alvespimycin are potent anti-cancer agents and that heat amplifies their cytotoxic effects. Furthermore, the two drugs are proven to act synergistically when cancer cells are treated with the drugs in combination. The formulation of alvespimycin was rationally designed to exhibit similar pharmacokinetics and drug release kinetics compared to ThermoDox, enabling the two drugs to be delivered to heated tumors at similar efficiencies resulting in control of a particular synergistic ratio of drugs. In vivo measurements demonstrated effective heat-mediated triggering of doxorubicin and alvespimycin release from thermosensitive liposomes within tumor vasculature. This treatment strategy resulted in a ~10-fold increase in drug concentration within tumors compared to free drug administered without tumor heating.

Binding of l-Argininamide to a DNA Aptamer: A Volumetric Study.

We use a combination of volumetric and spectroscopic techniques to characterize the binding of l-argininamide to its aptamer, the 24-base DNA hairpin 5'-d(GATCGAAACGTAGCGCCTTCGATC)-3'. The binding causes increases in volume, Δ V, and adiabatic compressibility, Δ KS, of 12 ± 7 cm3 mol-1 bar and (73 ± 8) × 10-4 cm3 mol-1 bar-1, respectively. These volumetric results combined with structural data reveal that the binding is accompanied by release of 73 ± 27 waters from the hydration shells of the interacting molecules to the bulk. We use the estimated change in hydration to estimate the hydration, Δ Shyd, and configurational, Δ Sconf, contributions to the binding entropy. The large and unfavorable change in configurational entropy, Δ Sconf, is nearly compensated by a favorable change in the hydration contribution, Δ Shyd.

Factors Controlling Drug Release in Cross-linked Poly(valerolactone) Based Matrices.

There is keen interest in the development of biocompatible and biodegradable implantable delivery systems (IDDS) that provide sustained drug release for prolonged periods in humans. These systems have the potential to enhance therapeutic outcomes, reduce systemic toxicity, and improve patient compliance. Herein, we report the preparation and physicochemical characterization of cross-linked polymeric matrices from poly(valerolactone)- co-poly(allyl-δ-valerolactone) (PVL- co-PAVL) copolymers for use in drug delivery. A series of well-defined PVL- co-PAVL copolymers (PDI < 1.5) that vary in terms of MW and AVL content were prepared by ring opening polymerization catalyzed by 1,5,7-triazabicyclo[4.4.0]dec-5-ene. A subsequent cross-linking reaction using 1,6-hexanedithiol led to solid cylindrical amorphous or semicrystalline matrices as potential IDDS. High loading levels (up to 20% (w/w)) of several model drugs that vary in physicochemical properties, including paclitaxel, triamcinolone acetonide and hexacetonide, curcumin, and acetaminophen, were achieved using a postloading method in organic solvent. Drug-IDDS interactions were evaluated via the group contribution method and X-ray diffraction as well as calorimetric, spectroscopic, and microscopic techniques. Results indicate superior drug-matrix compatibility for drugs bearing phenyl groups. In vitro release studies under distinct sink conditions highlight the key factors (i.e., state and loading level of drug, solubility of drug in external media, and composition of release media) that impact drug release.

The role of loops and cation on the volume of unfolding of G-quadruplexes related to HTel.

In aqueous solutions containing sodium or potassium cations, oligodeoxyribonucleotides (ODNs) rich in guanine form four-stranded DNA structures called G-quadruplexes (G4s). These structures are destabilized by elevated hydrostatic pressure. Here, we use pressure to investigate the volumetric changes arising from the formation of G4 structures. G4s display a great deal of structural heterogeneity that depends on the stabilizing cation as well as the oligonucleotide sequence. Using UV thermal unfolding at different pressures, we have investigated the volume change of the helix-coil equilibrium of a series of ODNs whose sequences are related to the G-rich ODN HTel (d[A(GGGTTA)3GGG]), which contains four repeats of the human telomeric sequence. The experiments are conducted in aqueous buffers containing either 100mM NaCl or KCl at pH7.4. The G4s stabilized by Na+ are less sensitive to pressure perturbation than those stabilized by K+. The overall molar volume changes (ΔVtot) of the unfolding transition for all of the G4s are large and negative. A large fraction of the measured ΔVtot value arises from the re-hydration of the cations released from the interior of the folded structure. However, the differences in the measured ΔVtot values demonstrate that variations in the structure of G4s formed by each ODN, arising from differences in the sequence of the loops, contribute significantly to ΔVtot and presumably the hydration of the folded structures. Depending on the sequence of the loops, the magnitude of the measured ΔVtot can be larger or smaller than that of HTel in solutions containing sodium. However, the magnitude of ΔVtot is smaller than HTel for the unfolding of all G4s that are stabilized by potassium ions.

Diffusion of Innovations model helps interpret the comparative uptake of two methodological innovations: co-authorship network analysis and recommendations for the integration of novel methods in practice.

OBJECTIVE: The objective of this study was to characterize the diffusion of methodological innovation. STUDY DESIGN AND SETTING: Comparative case study analysis of the diffusion of two methods that summarize confounder information into a single score: disease risk score (DRS) and high-dimensional propensity score (hdPS). We completed systematic searches to identify DRS and hdPS papers in the field of pharmacoepidemiology through to the end of 2013, plotted the number of papers and unique authors over time, and created sociograms and animations to visualize co-authorship networks. First and last author affiliations were used to ascribe institutional contributions to each paper and network. RESULTS: We identified 43 DRS papers by 153 authors since 1981, reflecting slow uptake during initial periods of uncertainty and broader diffusion since 2001 linked to early adopters from Vanderbilt. We identified 44 hdPS papers by 147 authors since 2009, reflecting rapid and integrated diffusion, likely facilitated by opinion leaders, early presentation at conferences, easily accessible statistical code, and improvement in funding. Most contributions (87% DRS, 96% hdPS) were from North America. CONCLUSION: When proposing new methods, authors are encouraged to consider innovation attributes and early evaluation to improve knowledge translation of their innovations for integration into practice, and we provide recommendations for consideration.

Single-Molecule Analysis of the Supramolecular Organization of the M2 Muscarinic Receptor and the Gαi1 Protein.

G protein-coupled receptors constitute the largest family of transmembrane signaling proteins and the largest pool of drug targets, yet their mechanism of action remains obscure. That uncertainty relates to unresolved questions regarding the supramolecular nature of the signaling complex formed by receptor and G protein. We therefore have characterized the oligomeric status of eGFP-tagged M2 muscarinic receptor (M2R) and Gi1 by single-particle photobleaching of immobilized complexes. The method was calibrated with multiplexed controls comprising 1-4 copies of fused eGFP. The photobleaching patterns of eGFP-M2R were indicative of a tetramer and unaffected by muscarinic ligands; those of eGFP-Gi1 were indicative of a hexamer and unaffected by GTPγS. A complex of M2R and Gi1 was tetrameric in both, and activation by a full agonist plus GTPγS reduced the oligomeric size of Gi1 without affecting that of the receptor. A similar reduction was observed upon activation of eGFP-Gαi1 by the receptor-mimic mastoparan plus GTPγS, and constitutively active eGFP-Gαi1 was predominantly dimeric. The oligomeric nature of Gi1 in live CHO cells was demonstrated by means of Förster resonance energy transfer and dual-color fluorescence correlation spectroscopy in studies with eGFP- and mCherry-labeled Gαi1; stochastic FRET was ruled out by means of non-interacting pairs. These results suggest that the complex between M2R and holo-Gi1 is an octamer comprising four copies of each, and that activation is accompanied by a decrease in the oligomeric size of Gi1. The structural feasibility of such a complex was demonstrated in molecular dynamics simulations.

Ionic Effects on VEGF G-Quadruplex Stability.

In a potassium solution, a modified 22-meric DNA sequence Pu22-T12T13 from a region proximal to the transcription initiation site of the human VEGF gene adopts a single parallel-stranded G-quadruplex conformation with a 1:4:1 loop-size arrangement. We measured the thermal stability, TM, of the K(+)-stabilized Pu22-T12T13 G-quadruplex as a function of stabilizing K(+) ions and nonstabilizing Cs(+) and TMA(+) ions. The thermal stability, TM, of the Pu22-T12T13 G-quadruplex increases with the concentration of the stabilizing potassium ions, while it sharply decreases upon the addition of the nonstabilizing cations. We interpret these results as underscoring the opposing effects of internal binding and counterion condensation on the stability of the Pu22-T12T13 G-quadruplex. While centrally bound ions stabilize the G-quadruplex conformation, counterion condensation destabilizes it, favoring the coil conformation. From the initial slopes of the dependences of TM on the concentration of Cs(+) and TMA(+) cations, we estimate that the deleterious effect of counterion condensation stems from roughly one extra counterion associated with the coil relative to the G-quadruplex state of Pu22-T12T13. The reduced accumulation of counterions around the G-quadruplex state of Pu22-T12T13 relative to its coil state is due to the low surface charge density of the G-quadruplex reflecting its structural characteristics. On the basis of the analysis of our data along with the results of a previous study, we propose that the differential effect of internally (stabilizing) and externally (destabilizing) bound cations may be a general feature of parallel intramolecular G-quadruplexes.

Effects of Salt on the Stability of a G-Quadruplex from the Human c-MYC Promoter.

In an atmosphere of potassium ions, a modified c-MYC NHE III1 sequence with two G-to-T mutations (MYC22-G14T/G23T) forms a highly stable parallel-stranded G-quadruplex. The G-quadruplex exhibits a steady increase in its melting temperature, T(M), with an increase in the concentration of the stabilizing cation K(+). On the other hand, an increase in the concentration of nonstabilizing Cs(+) or TMA(+) cations at a constant concentration of K(+) causes a sharp decline in T(M) followed by a leveling off at ∼200 mM Cs(+) or TMA(+). At 51 °C and 600 µM K(+), an increase in Cs(+) concentration from 0 to 800 mM leads to a complete unfolding of the G-quadruplex. These observations are consistent with the picture in which more counterions accumulate in the vicinity of the unfolded state of MYC22-G14T/G23T (nonspecific ion binding) than in that of the G-quadruplex state. We estimate that the unfolded state condenses one extra counterion compared to the G-quadruplex state. Taken together with our earlier results, our data suggest that sodium or potassium cations sequestered inside the central cavity stabilize the G-quadruplex conformation acting as specifically bound ligands. Nonspecifically bound (condensed) counterions may slightly stabilize, exert no influence (human telomeric G-quadruplexes), or strongly destabilize (MYC22-G14T/G23T) the G-quadruplex conformation. We offer a structural rationalization for the enhanced thermal stability of the MYC22-G14T/G23T G-quadruplex.

Hydration changes accompanying helix-to-coil DNA transitions.

We applied ultrasonic velocimetric and high-precision densimetric measurements to characterizing the helix-to-coil transition of the GGCATTACGG/CCGTAATGCC decameric DNA duplex. The transition was induced either by temperature or by mixing the two complementary single strands at isothermal conditions. The duplex dissociation causes increases in volume and expansibility while resulting in a decrease in compressibility. Our volumetric data in conjunction with computer-generated structural information are consistent with the picture in which the duplex dissociation is accompanied by an uptake of ∼180 water molecules from the bulk phase into the hydration shell of the DNA. Analysis of our compressibility and expansibility data reveals that the single-stranded conformation is likely to exist as a heterogeneous mixture of nearly isoenergetic subspecies differing in volume and enthalpy. We use our estimate of the change in hydration to evaluate the hydration and configurational contributions to the helix-to-coil transition entropy. The duplex dissociation is accompanied by an increase in configurational entropy, ΔSconf, of ∼23 cal mol(-1) K(-1) per nucleotide, which signifies liberation of manifold frozen degrees of freedom involved in maintaining the conformational stability of the duplex and the related stiffening of the heterocyclic bases and the sugar-phosphate backbone. To the best of our knowledge, this is the first experimental estimate of the change in configurational entropy associated with the helix-to-coil transition of a DNA.

Folding thermodynamics of the hybrid-1 type intramolecular human telomeric G-quadruplex.

Guanine-rich DNA sequences that may form G-quadruplexes are located in strategic DNA loci with the ability to regulate biological events. G-quadruplexes have been under intensive scrutiny owing to their potential to serve as novel drug targets in emerging anticancer strategies. Thermodynamic characterization of G-quadruplexes is an important and necessary step in developing predictive algorithms for evaluating the conformational preferences of G-rich sequences in the presence or the absence of their complementary C-rich strands. We use a combination of spectroscopic, calorimetric, and volumetric techniques to characterize the folding/unfolding transitions of the 26-meric human telomeric sequence d[A3G3(T2AG3)3A2]. In the presence of K+ ions, the latter adopts the hybrid-1 G-quadruplex conformation, a tightly packed structure with an unusually small number of solvent-exposed atomic groups. The K+-induced folding of the G-quadruplex at room temperature is a slow process that involves significant accumulation of an intermediate at the early stages of the transition. The G-quadruplex state of the oligomeric sequence is characterized by a larger volume and compressibility and a smaller expansibility than the coil state. These results are in qualitative agreement with each other all suggesting significant dehydration to accompany the G-quadruplex formation. Based on our volume data, 432±19 water molecules become released to the bulk upon the G-quadruplex formation. This large number is consistent with a picture in which DNA dehydration is not limited to water molecules in direct contact with the regions that become buried but involves a general decrease in solute-solvent interactions all over the surface of the folded structure.

Ultrasonic and densimetric characterization of the association of cyclic AMP with the cAMP-binding domain of the exchange protein EPAC1.

We employed a combination of densimetric and ultrasonic velocimetric techniques to characterize the volumetric properties of the association of the cAMP-binding domain (CBD) of EPAC1 with cAMP at 25 °C in a pH 7.6 buffer. The binding of cAMP to the CBD of EPAC1 is accompanied by changes in volume, ΔV, and adiabatic compressibility, ΔKS, of -59 ± 4 cm(3) mol(-1) and (34 ± 9) × 10(-4) cm(3) mol(-1) bar(-1), respectively. We use these volumetric results in conjunction with the structural data to estimate a change in hydration, Δnh, accompanying the binding. We calculate that approximately 103 water molecules are released to the bulk from the associating surfaces of the protein and the ligand. This number is ∼30% larger than the number of water molecules in direct contact with the associating surfaces while also being within the error of our Δnh determination. Therefore, we conclude that cAMP binding to EPAC1 may involve, in addition to the waters from within the first coordination sphere, also some waters from the second coordination sphere of the protein and cAMP. Our analysis of the compressibility data reveals that the protein becomes more rigid and less dynamic upon the cAMP binding as reflected in a 4 ± 0.5% decrease in its intrinsic coefficient of adiabatic compressibility. Finally, we estimate the hydration, ΔShyd, and configurational, ΔSconf, contributions to the binding entropy, ΔSb. We find that the binding entropy is determined by the fine balance between the ΔShyd and ΔSconf terms. In general, we discuss insights that are derived from a combination of volumetric and structural properties, in particular, emphasizing how measured changes in volume and compressibility can be interpreted in terms of hydration and dynamic properties of EPAC1 in its apo- and holo-forms.

Concentration-dependent structural transitions of human telomeric DNA sequences.

Oligodeoxyribonucleotides (ODNs) that have four repeats of the human telomeric sequence d(TTAGGG)(n) can assume multiple monomolecular G-quadruplex topologies. These are determined by the cation species present, the bases at the 5' or 3' end, and the sample preparation technique. In this work, we report our studies of the concentration dependence of the circular dichroism (CD) and the vibrational modes probed by Raman scattering of three previously characterized monomolecular G-quadruplexes: H-Tel, d[5'-A(GGGTTA)(3)GGG-3']; hybrid-1, d[5'-AAA(GGGTTA)(3)GGGAA-3']; and hybrid-2, d[5'-TTA(GGGTTA)(3)GGGTT-3']. At high (millimolar) ODN concentrations, we observed a transformation of the CD spectrum of H-Tel, with a relaxation time on the order of 10 h. Analysis of the kinetics of this process is consistent with the formation of an aggregated complex of folded H-Tel monomers. Upon dilution, the aggregates dissociate rapidly, yielding spectra identical to those of monomeric H-Tel. Both hybrid sequences undergo a similar transition under high-salt (1 M) conditions. The measurements suggest that for these ODN concentrations, which are typically used in high-resolution spectroscopies, the monomolecular G-quadruplex structures undergo a transition to multimolecular structures at room temperature. Guided by our findings, we propose that the terminal bases of the hybrid-1 and hybrid-2 ODNs impede the formation of these aggregates; however, in solutions containing 1 M salt, the hybrid oligonucleotides aggregate.

Volumetric characterization of tri-N-acetylglucosamine binding to lysozyme.

Volumetric characteristics of protein recognition events determine the direction of pressure-induced shifts in the recognition reaction, while also providing insights into the structural, dynamic, and hydration changes. We report changes in volume, ΔV, and adiabatic compressibility, ΔK(S), accompanying the binding of tri-N-acetylglucosamine [(GlcNAc)(3)] to lysozyme at 25 °C in a pH 5.5 sodium acetate buffer. We interpret our measured changes in volume and compressibility in terms of changes in hydration and dynamic properties of the protein. On the basis of our ΔV data, we find that 79 ± 44 water molecules are released to the bulk from the hydration shells of the protein and the ligand. Our ΔK(S) data suggest a 4 ± 2% decrease in the mean-square fluctuations of the intrinsic volume of the protein, <δV(M)(2)> (or a 2% decrease in δV(M)). Thus, the trisaccharide-bound state of the enzyme is less hydrated, more rigid, and less dynamic compared to the unbound state. In general, we discuss the importance of volumetric insights into the molecular origins of protein recognition events.