Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 11 de 11
Filtrar
Mais filtros











Base de dados
Intervalo de ano de publicação
1.
Front Bioeng Biotechnol ; 12: 1415645, 2024.
Artigo em Inglês | MEDLINE | ID: mdl-39205857

RESUMO

Objectives: This study determines gender variation, comparing the significance level between men and women related to functional ambulation characteristics after hip arthroplasty. The study focuses on the broader female pelvis and how it affects the rehabilitation regimen following total hip arthroplasty. Materials and Methods: In this cross-sectional study, 20 cases of right hip arthroplasty were divided into 10 male and 10 female cases, aged 40-65 years. The functional ambulation parameters (walking cadence, gait speed, stride length, and gait cycle time) were acquired from the GAITRite device, as well as kinematic values for hip frontal plane displacement and kinetic parameters for ground response force in the medial-lateral direction. Results: An independent t-test showed a significant difference in the kinematic parameter variables for the anterior superior iliac spine, more significant trochanter displacement, and hip abduction angle between the operated and non-operated limbs for each group separately. Regarding the functional ambulation parameters, there was a significant difference in the walking cadence between the operated and non-operated limbs of both male and female groups. Moreover, the output variables of ground reaction force measures revealed significant differences between their operated and non-operated limbs. The linear regression model used was consistent with the current results, demonstrating a weak negative correlation between the abduction angle of the operated hip and gait speed for both male and female groups. Conclusion: Based on the findings, we draw the conclusion that improving a rehabilitated physical therapy program for the abductors of both male and female patients' operated and non-operated limbs is essential for normalizing the ground reaction force value, avoiding focus on the operated hip, and reducing the amount of time that the operated hip's abductors must perform. This involves exposing the surgically repaired limb to the risk of post-operative displacement or dislocation, particularly in female patients.

2.
Tissue Cell ; 88: 102420, 2024 Jun.
Artigo em Inglês | MEDLINE | ID: mdl-38795506

RESUMO

Peripheral and central neuropathies frequently complicate worldwide diabetes. Compared to peripheral neuropathy, central neuropathy didn`t gain a major research interest. Angiotensin II is reported to be involved in diabetic neuropathic pain but its role in the central pathological changes in the spinal cord is not clear. Here, we study the role of Losartan; an Angiotensin II receptor 1 (AT1) antagonist in suppression of the diabetes-induced changes in the spinal cord. Three groups of rats were applied; a negative control group, a streptozotocin (STZ) diabetic group, and a group receiving STZ and Losartan. After two months, the pathological alteration in the spinal cord was investigated, and an immunohistochemical study was performed for neuronal, astrocytic, and microglial markers; nuclear protein (NeuN), Glial fibrillary acidic protein (GFAP), and Ionized calcium-binding adaptor molecule 1 (Iba1), respectively, and for an apoptosis marker; caspase-3, and the inflammatory marker; nuclear factor kappa B (NF-kB) signaling, heme oxygenase-1 (HO-1) and nuclear factor erythroid 2-related factor 2 (Nrf2); physiological antioxidant system. The results showed that Losartan caused recovery of spinal cord changes, by inhibiting the microglial and astrocytic activation, suppressing neuronal apoptosis and NF-kB expression with activation of Nrf2/HO-1 (P<0.0005). It is suggested, herein, that Losartan can suppress diabetes-induced glial activation, inflammation, neuronal apoptosis, and oxidative stress in the spinal cord; the mechanisms that may underlie the role of AT1 antagonism in suppressing diabetic neuropathic pain.


Assuntos
Bloqueadores do Receptor Tipo 1 de Angiotensina II , Diabetes Mellitus Experimental , Losartan , Fator 2 Relacionado a NF-E2 , Medula Espinal , Animais , Medula Espinal/patologia , Medula Espinal/metabolismo , Medula Espinal/efeitos dos fármacos , Diabetes Mellitus Experimental/patologia , Diabetes Mellitus Experimental/metabolismo , Diabetes Mellitus Experimental/tratamento farmacológico , Diabetes Mellitus Experimental/complicações , Fator 2 Relacionado a NF-E2/metabolismo , Bloqueadores do Receptor Tipo 1 de Angiotensina II/farmacologia , Ratos , Masculino , Losartan/farmacologia , Heme Oxigenase-1/metabolismo , Neuropatias Diabéticas/patologia , Neuropatias Diabéticas/metabolismo , Neuropatias Diabéticas/tratamento farmacológico , Transdução de Sinais/efeitos dos fármacos , Ratos Wistar , Apoptose/efeitos dos fármacos , NF-kappa B/metabolismo , Estresse Oxidativo/efeitos dos fármacos
3.
Tissue Cell ; 88: 102385, 2024 Jun.
Artigo em Inglês | MEDLINE | ID: mdl-38678740

RESUMO

BACKGROUND: Metabolic syndrome (MetS) is commonly associated with increased risk of cardiac disease that affects a large number of world populations. OBJECTIVE: This research attempted to investigate the efficacy of fennel seeds extract (FSE) in preventing development of cardiac dysfunction in rats on fructose enriched diet for 3 months, as a model of MetS. MATERIALS & METHODS: Thirty adult Wistar male rats (160-170 g) were assigned into 5 groups including control, vehicle, FSE (200 mg/kg BW) and fructose (60%) fed rats with and without FSE. Following the last treatment, blood pressure, ECG and heart rate were measured. Next, blood and cardiac tissues were taken for biochemical and histological investigations. RESULTS: Feeding fructose exhibited characteristic features of MetS involving, hypertension, abnormal ECG, elevated heart rate, serum glucose, insulin, lipids and insulin resistance, accompanied by abdominal obesity, cardiac hypertrophy and hyperuricemia. Fructose fed rats also showed significant reduction in cardiac antioxidants (GSH, SOD, CAT) with elevation in oxidative stress indices (NADPH oxidase, O2.-, H2O2, MDA, PCO), NF-κß, pro-inflammatory cytokines (TNF-α, IL-1ß, IL-6), adhesion molecules (ICAM-1, VCAM-1) and serum cardiac biomarkers (AST, LDH, CK-MB, cTn-I). Histopathological changes evidenced by destruction of cardiac myofibrils, cytoplasmic vacuolization, and aggregation of inflammatory cells were also detected. Consumption of FSE showed high ability to alleviate fructose-induced hypertension, ECG abnormalities, cardiac hypertrophy, metabolic alterations, oxidative stress, inflammation and histological injury. CONCLUSION: Findings could suggest FSE as a complementary supplement for preventing MetS and associated cardiac outcomes. However, well controlled clinical studies are still needed.


Assuntos
Modelos Animais de Doenças , Foeniculum , Frutose , Hiperuricemia , Inflamação , Síndrome Metabólica , NF-kappa B , Extratos Vegetais , Ratos Wistar , Sementes , Animais , Síndrome Metabólica/metabolismo , Síndrome Metabólica/patologia , Síndrome Metabólica/induzido quimicamente , Síndrome Metabólica/tratamento farmacológico , Frutose/efeitos adversos , Extratos Vegetais/farmacologia , Masculino , NF-kappa B/metabolismo , Sementes/química , Ratos , Hiperuricemia/induzido quimicamente , Hiperuricemia/tratamento farmacológico , Foeniculum/química , Inflamação/patologia , Inflamação/metabolismo , Estresse Oxidativo/efeitos dos fármacos , Transdução de Sinais/efeitos dos fármacos
4.
Front Neuroanat ; 17: 1094301, 2023.
Artigo em Inglês | MEDLINE | ID: mdl-36968023

RESUMO

Introduction: Diabetes is a global disease, commonly complicated by neuropathy. The spinal cord reacts to diabetes by neuronal apoptosis, microglial activation, and astrocytosis, with a disturbance in neuronal and glial Nuclear factor erythroid 2-related factor/Heme oxygenase-1 (Nrf2/HO-1) and Nuclear factor kappa-light-chain-enhancer of activated B cells (NF-kB) signaling. Curcumin, a bioactive natural substance, showed neuroprotective role in many diseases. However, its role in the treatment of the diabetic central neuropathy of spinal cord and the underlying mechanisms still need clarification. The present study tried to evaluate the role of curcumin in diabetes-induced central neuropathy of the spinal cord in rats. Methods: Twenty rats were divided into three groups; group 1: a negative control group; group 2: received streptozotocin (STZ) to induce type I diabetes, and group 3: received STZ + Curcumin (150 mg/kg/day) for eight weeks. The spinal cords were examined for histopathological changes, and immunohistochemical staining for Glia fibrillary acidic protein (GFAP); an astrocyte marker, Ionized calcium-binding adaptor molecule 1 (Iba1), a microglial marker, neuronal nuclear protein (NeuN); a neuronal marker, caspase-3; an apoptosis marker, Nrf2/HO-1, NF-kB, and oxidative stress markers were assessed. Results: Curcumin could improve spinal cord changes, suppress the expression of Iba1, GFAP, caspase-3, and NF-kB, and could increase the expression of NeuN and restore the Nrf2/HO-1 signaling. Discussion: Curcumin could suppress diabetic spinal cord central neuropathy, glial activation, and neuronal apoptosis with the regulation of Nrf2/HO-1 and NF-kB signaling.

5.
Int J Mol Sci ; 23(21)2022 Oct 24.
Artigo em Inglês | MEDLINE | ID: mdl-36361584

RESUMO

Methotrexate (MTX) is a potent anti-cancer drug, commonly associated with nephrotoxicity via the induction of oxidative stress and apoptosis with alteration of renal water channel proteins, namely aquaporins (AQPs). Omega-3 long-chain polyunsaturated fatty acids (LC-PUFA) have shown cytoprotective effects through their anti-oxidant and antiapoptotic activities. The present study aims for the first time to explore the role of LC-PUFA against MTX-induced nephrotoxicity. Rats were divided into the following groups: saline control, LC-PUFA control, MTX, MTX + LC-PUFA (150 mg/kg), or MTX + LC-PUFA (300 mg/kg). Then, H&E staining and immunohistochemical staining for the anti-apoptosis marker B-cell lymphoma 2 (BCL-2), the apoptosis marker BCL2-Associated X Protein (BAX), the proinflammatory marker Nuclear factor kappa B (NF-kB), AQPs 1 and 2 were performed in kidney sections with an assessment of renal oxidative stress. The MTX caused a renal histopathological alteration, upregulated renal BAX and NF-kB, downregulated Bcl-2 and AQP1, altered the distribution of AQP2, and caused oxidative stress. The LC-PUFA attenuated the pathological changes and decreased renal BAX and NF-kB, increased BCL-2 and AQP1, restored the normal distribution of AQP2, and decreased the oxidative stress. Therefore, LC-PUFA is a good adjuvant to MTX to prevent its adverse effects on kidneys through its antiapoptotic, antioxidant, and anti-inflammatory effect and its role in the restoration of the expression of AQPs 1 and 2.


Assuntos
Ácidos Graxos Ômega-3 , Metotrexato , Ratos , Animais , Metotrexato/metabolismo , Proteína X Associada a bcl-2/genética , Proteína X Associada a bcl-2/metabolismo , NF-kappa B/metabolismo , Aquaporina 2/metabolismo , Estresse Oxidativo , Rim/metabolismo , Antioxidantes/farmacologia , Antioxidantes/metabolismo , Proteínas Proto-Oncogênicas c-bcl-2/genética , Proteínas Proto-Oncogênicas c-bcl-2/metabolismo , Ácidos Graxos Ômega-3/farmacologia , Ácidos Graxos Ômega-3/metabolismo , Suplementos Nutricionais
6.
Front Cell Neurosci ; 16: 967813, 2022.
Artigo em Inglês | MEDLINE | ID: mdl-36187296

RESUMO

Parkinson's disease (PD) is the second most common neurodegenerative disease. Treatment of PD is challenging, as current treatment strategies are only symptomatic and do not stop disease development. Recent studies reported neuroprotective effects of calcitriol in PD through its antioxidant and anti-inflammatory properties. The exact pathomechanisms of PD are not yet fully understood. So, investigation of different molecular pathways is challenging. Sirtuin-1 (Sirt1) modulates multiple physiological processes, including programmed cell death, DNA repair, and inflammation. Furthermore, defective autophagy is considered a key pathomechanism in PD as it eliminates protein aggregation and dysfunctional cell organelles. The present study investigated the involvement of autophagy and Sirt1/NF-κB molecular pathway in rotenone-induced PD and explored the protective and restorative effects of calcitriol through these mechanisms. Therefore, behavioral tests were used to test the effect of calcitriol on motor disability and equilibrium. Furthermore, the histological and neuronal architecture was assessed. The expression of genes encoding neuroinflammation and autophagy markers was determined by qPCR while their protein levels were determined by Western blot analysis and immune-histochemical staining. Our results indicate that behavioral impairments and dopaminergic neuron depletion in the rotenone-induced PD model were improved by calcitriol administration. Furthermore, calcitriol attenuated rotenone-induced neuroinflammation and autophagy dysfunction in PD rats through up-regulation of Sirt1 and LC3 and down-regulation of P62 and NF-κB expression levels. Thus, calcitriol could induce a neuro-protective and restorative effect in the rotenone-induced PD model by modulating autophagy and Sirt1/NF-κB pathway.

7.
Cells ; 11(16)2022 08 11.
Artigo em Inglês | MEDLINE | ID: mdl-36010575

RESUMO

Long-term use of Glucocorticoids produces skeletal muscle atrophy and microvascular rarefaction. Hydrogen sulfide (H2S) has a potential role in skeletal muscle regeneration. However, the mechanisms still need to be elucidated. This is the first study to explore the effect of Sodium hydrosulfide (NaHS) H2S donor, against Dexamethasone (Dex)-induced soleus muscle atrophy and microvascular rarefaction and on muscle endothelial progenitors and M2 macrophages. Rats received either; saline, Dex (0.6 mg/Kg/day), Dex + NaHS (5 mg/Kg/day), or Dex + Aminooxyacetic acid (AOAA), a blocker of H2S (10 mg/Kg/day) for two weeks. The soleus muscle was examined for contractile properties. mRNA expression for Myostatin, Mechano-growth factor (MGF) and NADPH oxidase (NOX4), HE staining, and immunohistochemical staining for caspase-3, CD34 (Endothelial progenitor marker), vascular endothelial growth factor (VEGF), CD31 (endothelial marker), and CD163 (M2 macrophage marker) was performed. NaHS could improve the contractile properties and decrease oxidative stress, muscle atrophy, and the expression of NOX4, caspase-3, Myostatin, VEGF, and CD31 and could increase the capillary density and expression of MGF with a significant increase in expression of CD34 and CD163 as compared to Dex group. However, AOAA worsened the studied parameters. Therefore, H2S can be a promising target to attenuate muscle atrophy and microvascular rarefaction.


Assuntos
Sulfeto de Hidrogênio , Rarefação Microvascular , Animais , Caspase 3 , Dexametasona/efeitos adversos , Sulfeto de Hidrogênio/metabolismo , Sulfeto de Hidrogênio/farmacologia , Macrófagos/metabolismo , Atrofia Muscular , Miostatina , NADPH Oxidase 4 , NADPH Oxidases , Ratos , Fator A de Crescimento do Endotélio Vascular
8.
Ann Med ; 54(1): 1938-1951, 2022 12.
Artigo em Inglês | MEDLINE | ID: mdl-35801810

RESUMO

BACKGROUND: Epilepsy is a heterogeneous complex condition that involve the human brain. Genetic predisposition to epilepsy is a fundamental factor of the disorder aetiology. The sodium voltage-gated channel (SCN) genes variants are critical biomarker for the epilepsy development and progression. In this study, we aimed to investigate the association of several SNCs genetic polymorphisms with epilepsy risk and their intrudance of the disease prognosis. METHODS: Blood samples were withdrawn from 296 Epilepsy patients in addition to 293 healthy matched participants prior to DNA extraction. PCR-sequencing was used for genotyping analysis. Genotyping outputs were then statistically analysed for genotype/phenotype evaluation. RESULTS: Within SCN1A gene we found that the rs6432861 (p = 0.014) was in correlation with the risk of epilepsy. In addition, both rs4667485 and rs1469649 of SCN2A gene were significantly correlated to epilepsy risk for both allelic (4e-4 and 1e-3) and genotypic (1e-3 and 5e-3). Moreover, the haplotype analysis showed that the GATGCTCGGTTTCGCTACGCA haplotype of SCN2A gene was significantly related to epilepsy increased risk, p = 6e-3, OR (CI) = 2.02 (1.23-3.31). In relevant to our finding, many of the investigated SCNs variants in the current study were related to several clinical features of epilepsy. CONCLUSION: In light of our results, we infer that SCN genes polymorphisms are strong candidates for epilepsy development and progression. Furthermore, these variant are essential for the disorder prognosis and medications outcomes.Key MessagesGenetic polymorphisms of sodium channels SCN1A, SCN2A and SCN3A were found to be associated with the risk of epilepsy.SCN1B polymorphisms were found to be correlated to epilepsy reduced risk.SCNs variants are involved in the epilepsy prognosis and response to treatment.


Assuntos
Epilepsia , Canal de Sódio Disparado por Voltagem NAV1.1 , Epilepsia/tratamento farmacológico , Epilepsia/genética , Humanos , Canal de Sódio Disparado por Voltagem NAV1.1/genética , Canal de Sódio Disparado por Voltagem NAV1.2/genética , Canal de Sódio Disparado por Voltagem NAV1.3/genética , Polimorfismo Genético , Prognóstico , Arábia Saudita , Canais de Sódio/genética , Subunidade beta-1 do Canal de Sódio Disparado por Voltagem/genética
9.
Cells ; 10(9)2021 09 18.
Artigo em Inglês | MEDLINE | ID: mdl-34572126

RESUMO

Autophagy is a key metabolic process where cells can recycle its proteins and organelles to regenerate its own cellular building blocks. Chemotherapy is indispensable for cancer treatment but associated with various side-effects, including organ damage. Stem cell-based therapy is a promising approach for reducing chemotherapeutic side effects, however, one of its main culprits is the poor survival of transplanted stem cells in damaged tissues. Here, we aimed to test the effects of activating autophagy in adipose-derived mesenchymal stem/stromal cells (ADSCs) on the survival of ADSCs, and their therapeutic value in cisplatin-induced liver injury model. Autophagy was activated in ADSCs by rapamycin (50 nM/L) for two hours before transplantation and were compared to non-preconditioned ADSCs. Rapamycin preconditioning resulted in activated autophagy and improved survival of ADSCs achieved by increased autophagosomes, upregulated autophagy-specific LC3-II gene, decreased protein degradation/ubiquitination by downregulated p62 gene, downregulated mTOR gene, and finally, upregulated antiapoptotic BCL-2 gene. In addition, autophagic ADSCs transplantation in the cisplatin liver injury model, liver biochemical parameters (AST, ALT and albumin), lipid peroxidation (MDA), antioxidant profile (SOD and GPX) and histopathological picture were improved, approaching near-normal conditions. These promising autophagic ADSCs effects were achieved by modulation of components in TGF-ß1/Smad and PI3K-AKT signaling pathways, besides reducing NF-κB gene expression (marker for inflammation), reducing TGF-ß1 levels (marker for fibrosis) and increasing SDF-1 levels (liver regeneration marker) in liver. Therefore, current results highlight the importance of autophagy in augmenting the therapeutic potential of stem cell therapy in alleviating cisplatin-associated liver damage and opens the path for improved cell-based therapies, in general, and with chemotherapeutics, in particular.


Assuntos
Autofagia , Doença Hepática Crônica Induzida por Substâncias e Drogas/prevenção & controle , Células-Tronco Mesenquimais/citologia , Fosfatidilinositol 3-Quinases/metabolismo , Proteínas Proto-Oncogênicas c-akt/metabolismo , Proteínas Smad/metabolismo , Transplante de Células-Tronco/métodos , Fator de Crescimento Transformador beta1/metabolismo , Animais , Antineoplásicos/toxicidade , Doença Hepática Crônica Induzida por Substâncias e Drogas/etiologia , Doença Hepática Crônica Induzida por Substâncias e Drogas/metabolismo , Doença Hepática Crônica Induzida por Substâncias e Drogas/patologia , Cisplatino/toxicidade , Feminino , Masculino , Fosfatidilinositol 3-Quinases/genética , Proteínas Proto-Oncogênicas c-akt/genética , Ratos , Ratos Sprague-Dawley , Proteínas Smad/genética , Fator de Crescimento Transformador beta1/genética
10.
J Mol Histol ; 52(4): 781-798, 2021 Aug.
Artigo em Inglês | MEDLINE | ID: mdl-34046766

RESUMO

Vigabatrin is the drug of choice in resistant epilepsy and infantile spasms. Ataxia, tremors, and abnormal gait have been frequently reported following its use indicating cerebellar involvement. This study aimed, for the first time, to investigate the involvement of necroptosis and apoptosis in the VG-induced cerebellar cell loss and the possible protective role of combined omega-3 and vitamin B12 supplementation. Fifty Sprague-Dawley adult male rats (160-200 g) were divided into equal five groups: the control group received normal saline, VG200 and VG400 groups received VG (200 mg or 400 mg/kg, respectively), VG200 + OB and VG400 + OB groups received combined VG (200 mg or 400 mg/kg, respectively), vitamin B12 (1 mg/kg), and omega-3 (1 g/kg). All medications were given daily by gavage for four weeks. Histopathological changes were examined in H&E and luxol fast blue (LFB) stained sections. Immunohistochemical staining for caspase-3 and receptor-interacting serine/threonine-protein kinase-1 (RIPK1) as well as quantitative real-time polymerase chain reaction (qRT-PCR) for myelin basic protein (MBP), caspase-3, and receptor-interacting serine/threonine-protein kinase-3 (RIPK3) genes were performed. VG caused a decrease in the granular layer thickness and Purkinje cell number, vacuolations, demyelination, suppression of MBP gene expression, and induction of caspases-3, RIPK1, and RIPK3 in a dose-related manner. Combined supplementation with B12 and omega-3 improved the cerebellar histology, increased MBP, and decreased apoptotic and necroptotic markers. In conclusion, VG-induced neuronal cell loss is dose-dependent and related to both apoptosis and necroptosis. This could either be ameliorated (in low-dose VG) or reduced (in high-dose VG) by combined supplementation with B12 and omega-3.


Assuntos
Anticonvulsivantes/efeitos adversos , Caspase 3/metabolismo , Doenças Cerebelares/induzido quimicamente , Proteína Serina-Treonina Quinases de Interação com Receptores/metabolismo , Vigabatrina/efeitos adversos , Animais , Apoptose , Caspase 3/genética , Doenças Cerebelares/tratamento farmacológico , Doenças Cerebelares/metabolismo , Doenças Cerebelares/patologia , Relação Dose-Resposta a Droga , Ácidos Graxos Ômega-3/administração & dosagem , Regulação da Expressão Gênica/fisiologia , Masculino , Proteína Básica da Mielina/genética , Necroptose , RNA Mensageiro/genética , Ratos , Ratos Sprague-Dawley , Reação em Cadeia da Polimerase em Tempo Real , Proteína Serina-Treonina Quinases de Interação com Receptores/genética , Vitamina B 12/administração & dosagem
11.
Life Sci ; 273: 119297, 2021 May 15.
Artigo em Inglês | MEDLINE | ID: mdl-33689686

RESUMO

Stress-induced gastritis is a common problem in the intensive care unit. Zeaxanthin (ZE), a non-provitamin A carotenoid has been known to exert antioxidant and anti-inflammatory effects. In this study, we examined the effect of ZE on water avoidance stress (WAS)-induced gastritis in rats. 24 Sprague' Dawley male rats were divided into four groups; control, ZE, WAS and WAS+ZE. In the stressed rats, treatment with ZE effectively downregulated the gastric levels of total oxidant status (TOS), myeloperoxidase (MPO) and malondialdehyde (MDA), with significant upregulation of the antioxidant enzymes' activities and gastric levels of prostagladin-E2 (PGE2) as compared to the untreated stressed one. As noticed in the present study, ZE significantly decrease the gastric levels of interleukin-1 ß (IL-1ß) and IL-6 as well as suppression of nuclear transcription factor kappa-B (NF-κB) immunohistochemical expression together with upregulation of trefoil factor-1 (TFF-1) gene expression. Moreover, in the untreated WAS-induced gastritis group, gastrin and corticosterone levels were significantly increased together with upregulation of the gene expression of hypoxia inducible factor-1α (HIF-1α), matrix metalloproteinase-9 (MMP-9), PI3K, Akt and JNK in the gastric tissues, which significantly improved by ZE administration. These all positive effects of ZE reflected on reduction of microscopic gastric mucosal damage and inflammatory cell infiltration with improvement of ulcer score. Our results discover that ZE has a new gastroprotective effect against stress-induced gastritis in rats, primarily through its antioxidative and anti-inflammatory effects, which are expressed in the regulation of the MMP-9 and HIF-1α signaling pathways.


Assuntos
Biomarcadores/análise , Gastrite/tratamento farmacológico , Regulação da Expressão Gênica/efeitos dos fármacos , Substâncias Protetoras/farmacologia , Estresse Fisiológico , Zeaxantinas/farmacologia , Animais , Antioxidantes/metabolismo , Citocinas/metabolismo , Gastrite/etiologia , Gastrite/metabolismo , Gastrite/patologia , Subunidade alfa do Fator 1 Induzível por Hipóxia/genética , Subunidade alfa do Fator 1 Induzível por Hipóxia/metabolismo , MAP Quinase Quinase 4/genética , MAP Quinase Quinase 4/metabolismo , Masculino , Metaloproteinase 9 da Matriz/genética , Metaloproteinase 9 da Matriz/metabolismo , Estresse Oxidativo , Fosfatidilinositol 3-Quinases/genética , Fosfatidilinositol 3-Quinases/metabolismo , Proteínas Proto-Oncogênicas c-akt/genética , Proteínas Proto-Oncogênicas c-akt/metabolismo , Ratos , Ratos Sprague-Dawley , Fator Trefoil-1/genética , Fator Trefoil-1/metabolismo
SELEÇÃO DE REFERÊNCIAS
DETALHE DA PESQUISA