A new geminialphasatellite associated with wheat dwarf virus identified in winter barley in France.

Using a high-throughput sequencing (HTS) approach, we report the discovery of a new alphasatellite identified in a winter barley plant collected in France in 2022 that was also infected by wheat dwarf virus (WDV). The presence of the satellite and of WDV was confirmed by several independent PCR assays, and the complete genome sequence was determined. The circular satellite genome is 1424 nt long and shows typical hallmarks of members of the subfamily Geminialphasatellitinae, including a replication-associated hairpin with a CAGTATTAC sequence and a Rep-encoding open reading frame (ORF). It also possesses a second ORF, embedded in a different frame within the Rep ORF, which is also observed in clecrusatellites and a few other members of the family Alphasatellitidae. Pairwise sequence comparisons and phylogenetic analysis showed that this satellite represents a novel species. Its closest relatives are in the genus Colecusatellite, but it likely represents a new genus given its divergence from other genera of the subfamily Geminialphasatellitinae. Given that WDV was the only virus observed in coinfection with the satellite, the name "wheat dwarf virus-associated alphasatellite" is proposed for this novel agent.

Characterization of the RNA Mycovirome Associated with Grapevine Fungal Pathogens: Analysis of Mycovirus Distribution and Their Genetic Variability within a Collection of Botryosphaeriaceae Isolates.

Botryosphaeriaceae are fungi involved in the decay of various woody species, including the grapevine, leading to significant production losses. This fungal family is largely ubiquitous, and seven species of Botryosphaeriaceae have been identified in French vineyards, with variable levels of aggressiveness, both in vitro and in planta. Mycoviruses can impact the life traits of their fungal hosts, including aggressiveness, and are one of the factors influencing fungal pathogenicity. In this study, the RNA mycovirome of fifteen Botryosphaeriaceae isolates was characterized through the high-throughput sequencing of double-stranded RNA preparations from the respective samples. Eight mycoviruses were detected, including three potential novel species in the Narnaviridae family, as well as in the proposed Mycobunyaviridae and Fusagraviridae families. A large collection of Botryosphaeriaceae isolates was screened using RT-PCR assays specific for 20 Botryosphaeriaceae-infecting mycoviruses. Among the mycoviruses detected, some appeared to be specialists within a single host species, while others infected isolates belonging to multiple Botryosphaeriaceae species. This screening allowed us to conclude that one-third of the Botryosphaeriaceae isolates were infected by at least one mycovirus, and a significant proportion of isolates (43.5%) were found to be coinfected by several viruses, with very complex RNA mycoviromes for some N. parvum isolates.

Comparative Performance Evaluation of Double-Stranded RNA High-Throughput Sequencing for the Detection of Viral Infection in Temperate Fruit Crops.

There is limited information on the compared performances of biological, serological. and molecular assays with high-throughput sequencing (HTS) for viral indexing in temperate fruit crops. Here, using a range of samples of predetermined virological status, we compared two performance criteria (inclusivity and analytical sensitivity) of enzyme-linked immunosorbent assay (ELISA), molecular hybridization, reverse transcription (RT)-PCR, and double-stranded RNA (dsRNA) HTS for the detection of a total of 14 viruses (10 genera) and four viroids (three genera). When undiluted samples from individual plants were used, ELISA had the lowest performance, with an overall detection rate of 68.7%, followed by RT-PCR (82.5%) and HTS (90.7%; 100% if considering only viruses). The lower performance of RT-PCR reflected the inability to amplify some isolates as a consequence of point mutations affecting primer-binding sites. In addition, HTS identified viruses that had not been identified by other assays in nearly two-thirds of the samples. Analysis of serial dilutions of fruit tree samples allowed comparison of analytical sensitivities for various viruses. ELISA showed the lowest analytical sensitivity, but RT-PCR showed higher analytical sensitivity than HTS for most of the samples. Overall, these results confirm the superiority of HTS over biological indexing in terms of speed and inclusivity and show that while the absolute analytical sensitivity of RT-PCR tends to be higher than that of HTS, PCR inclusivity is affected by viral genetic diversity. Taken together, these results make a strong case for the implementation of HTS-based approaches in fruit tree viral testing protocols supporting quarantine and certification programs.

First report of Vitis cryptic virus (VCV) infecting mildew-resistant grapevine interspecific hybrids in France.

Vitis cryptic virus (VCV), a deltapartitivirus identified in Japan in Vitis coignetiae (Nabeshima and Abe, 2021), is known from only two other countries. It was detected in China (Fan et al., 2022) and in Russia, including in a V. labrusca and the Saperavi Severnyi interspecific hybrid (Shvets et al., 2022). There is no information on VCV pathogenicity but deltapartitiviruses are generally not pathogenic. Fan et al. (2022) reported VCV graft transmission and chlorotic mottling symptoms developing on a graft-inoculated vine, in spite of the fact that cryptic viruses are not known to move cell-to-cell or be graft-transmissible. In fall 2022, a few plants of the Prior interspecific hybrid (https://www.vivc.de) showed unusual red blotch and leaf curl in Bordeaux (France), prompting the HTS analysis of two plants using total leaf RNA. Following host genome substraction, the ribodepleted RNASeq data was assembled de novo using CLC Genomics Workbench (Candresse et al., 2018) and contigs annotated by BlastX against the GenBank database. Rupestris stem pitting virus, grapevine pinot gris virus, hop stunt viroid and grapevine yellow speckle viroid 1 were identified. In addition, mycoviral contigs were identified, together with contigs for Rhopalosiphum padi virus and a divergent isolate of barley aphid RNA virus 10 (the later only in one plant), and the two genomic RNAs of VCV. The VCV RNA1 contigs were 1570 and 1574 nucleotides (nt) long, respectively, and 100% identical, showing 97.1% nt identity to a Japanese isolate (LC746759). They integrated 6480 and 4613 reads (0.2 and 0.4% of total substracted reads) for a coverage of 611 and 433x, respectively. The VCV RNA2 contigs were also 100% identical and shared 95.5% identity with a Japanese isolate (LC746761). They were 1518-1519 nt long, integrated 11338 and 9999 reads (0.4 and 0.9% of reads) for a coverage of 1109 and 972x, respectively. The Prior VCV RNAs were deposited in GenBank (OR474475-76). Specific RNA2 primers 5' TTACAGGTTTGATTGGAATCATG 3' and 5' ATAGTAGGTCCAATCACTAATC 3' (Tm 56°C) were used to confirm VCV presence in the original plants as well as in three other asymptomatic Prior vines. Amplicons 100% identical to the contigs were obtained from 4 of 5 plants. Two plants of Bronner, one of Prior parents, also tested positive. The rootstock (Fercal) of a VCV-infected Prior and two plants of another hybrid, Artaban, (sampled in the same plot as Prior) tested negative. BlastN datamining identified VCV reads in RNASeq data from a range of wild grapevines including V. acerifolia (SRX2885763), V. quinquangularis (SRX1496837), V. romanetii (SRR3938616), V. cinerea (SRR10135144), V. davidii (SRR3255926), V. amurensis (SRX13387918) and V. vinifera subsp. sylvestris (HAOE01029819, HAOE01001237). Although not experimentally verified, detection in wild Vitis, including V. amurensis, a Saperavi Severnyi, Bronner and Prior progenitor, suggests VCV might have been introduced in these hybrids through crosses aiming to develop powdery and downy mildew resistant varieties. To the best of our knowledge, this is the first report of VCV infection in grapevine in France. The symptoms that prompted this research have not recurred in 2023 and are not linked to VCV because the virus was also identified in symptomless Prior plants. The risk of introducing VCV in European grapevine through breeding efforts appears limited, but VCV may be present in fungal disease-resistant cultivars in a range of countries.

Carrot populations in France and Spain host a complex virome rich in previously uncharacterized viruses.

High-throughput sequencing (HTS) has proven a powerful tool to uncover the virome of cultivated and wild plants and offers the opportunity to study virus movements across the agroecological interface. The carrot model consisting of cultivated (Daucus carota ssp. sativus) and wild carrot (Daucus carota ssp. carota) populations, is particularly interesting with respect to comparisons of virus communities due to the low genetic barrier to virus flow since both population types belong to the same plant species. Using a highly purified double-stranded RNA-based HTS approach, we analyzed on a large scale the virome of 45 carrot populations including cultivated, wild and off-type carrots (carrots growing within the field and likely representing hybrids between cultivated and wild carrots) in France and six additional carrot populations from central Spain. Globally, we identified a very rich virome comprising 45 viruses of which 25 are novel or tentatively novel. Most of the identified novel viruses showed preferential associations with wild carrots, either occurring exclusively in wild populations or infecting only a small proportion of cultivated populations, indicating the role of wild carrots as reservoir of viral diversity. The carrot virome proved particularly rich in viruses involved in complex mutual interdependencies for aphid transmission such as poleroviruses, umbraviruses and associated satellites, which can be the basis for further investigations of synergistic or antagonistic virus-vector-host relationships.

Diversity and Pathobiology of an Ilarvirus Unexpectedly Detected in Diverse Plants and Global Sequencing Data.

High-throughput sequencing (HTS) and sequence mining tools revolutionized virus detection and discovery in recent years, and implementing them with classical plant virology techniques results in a powerful approach to characterize viruses. An example of a virus discovered through HTS is Solanum nigrum ilarvirus 1 (SnIV1) (Bromoviridae), which was recently reported in various solanaceous plants from France, Slovenia, Greece, and South Africa. It was likewise detected in grapevines (Vitaceae) and several Fabaceae and Rosaceae plant species. Such a diverse set of source organisms is atypical for ilarviruses, thus warranting further investigation. In this study, modern and classical virological tools were combined to accelerate the characterization of SnIV1. Through HTS-based virome surveys, mining of sequence read archive datasets, and a literature search, SnIV1 was further identified from diverse plant and non-plant sources globally. SnIV1 isolates showed relatively low variability compared with other phylogenetically related ilarviruses. Phylogenetic analyses showed a distinct basal clade of isolates from Europe, whereas the rest formed clades of mixed geographic origin. Furthermore, systemic infection of SnIV1 in Solanum villosum and its mechanical and graft transmissibility to solanaceous species were demonstrated. Near-identical SnIV1 genomes from the inoculum (S. villosum) and inoculated Nicotiana benthamiana were sequenced, thus partially fulfilling Koch's postulates. SnIV1 was shown to be seed-transmitted and potentially pollen-borne, has spherical virions, and possibly induces histopathological changes in infected N. benthamiana leaf tissues. Overall, this study provides information to better understand the diversity, global presence, and pathobiology of SnIV1; however, its possible emergence as a destructive pathogen remains uncertain. [Formula: see text] Copyright © 2023 The Author(s). This is an open access article distributed under the CC BY 4.0 International license.

Molecular and Biological Characterization of Novel and Known Family Secoviridae Members Infecting Lettuce.

High-throughput sequencing of two lettuces showing virus-like symptoms in France provided evidence of infection by members of the family Secoviridae. One plant (JG1) had a complex mixed infection that involved, among others, a novel waikavirus (lettuce waikavirus 1) and two isolates of a sequivirus related to lettuce mottle virus (LeMoV). The second lettuce plant (JG2) was singly infected by LeMoV. Complete genomic sequences were obtained for all four isolates and, in addition, near complete genome sequences were obtained for other LeMoV or LeMoV-related isolates (from French cultivated and wild lettuces and from a Brazilian cultivated lettuce) and for two isolates of another family Asteraceae-infecting sequivirus, dandelion yellow mosaic virus (DaYMV). Analysis of these genomic sequences allows the proposal of tentative genome organization for the various viruses and clarification of their phylogenetic relationships. Sequence and host range comparisons point to significant differences between the two sequivirus isolates identified in the JG1 plant and LeMoV isolates from France and Brazil, suggesting they belong to a novel species for which the name lettuce star mosaic virus is proposed.

The Expanding Menagerie of Prunus-Infecting Luteoviruses.

Members of the genus Luteovirus are responsible for economically destructive plant diseases worldwide. Over the past few years, three luteoviruses infecting Prunus trees have been characterized. However, the biological properties, prevalence, and genetic diversity of those viruses have not yet been studied. High-throughput sequencing of samples of various wild, cultivated, and ornamental Prunus species enabled the identification of four novel species in the genus Luteovirus for which we obtained complete or nearly complete genomes. Additionally, we identified another new putative species recovered from Sequence Read Archive data. Furthermore, we conducted a survey on peach-infecting luteoviruses in eight European countries. Analyses of 350 leaf samples collected from germplasm, production orchards, and private gardens showed that peach-associated luteovirus (PaLV), nectarine stem pitting-associated virus (NSPaV), and a novel luteovirus, peach-associated luteovirus 2 (PaLV2), are present in all countries; the most prevalent virus was NSPaV, followed by PaLV. The genetic diversity of these viruses was also analyzed. Moreover, the biological indexing on GF305 peach indicator plants demonstrated that PaLV and PaLV2, like NSPaV, are transmitted by graft at relatively low rates. No clear viral symptoms have been observed in either graft-inoculated GF305 indicators or different peach tree varieties observed in an orchard. The data generated during this study provide a broader overview of the genetic diversity, geographical distribution, and prevalence of peach-infecting luteoviruses and suggest that these viruses are likely asymptomatic in peach under most circumstances.

A new potyvirus from hedge mustard (Sisymbrium officinale (L.) Scop.) sheds light on the evolutionary history of turnip mosaic virus.

A novel potyvirus was identified in symptomatic hedge mustard (Sisymbrium officinale (L.) Scop.) and wild radish (Raphanus raphanistrum L.) in France. The nearly complete genome sequence of hedge mustard mosaic virus (HMMV) was determined, demonstrating that it belongs to a sister species to turnip mosaic virus (TuMV). HMMV readily infected several other members of the family Brassicaceae, including turnip, shepherd's purse (Capsella bursa-pastoris), and arabidopsis. The identification of HMMV as a Brassicaceae-infecting virus closely related to TuMV leads us to question the current scenario of TuMV evolution and suggests a possible alternative one in which transition from a monocot-adapted ancestral lifestyle to a Brassicaceae-adapted one could have occurred earlier than previously recognized.Please check and confirm that the authors and their respective affiliations have been correctly identified and amend if necessary.all OK.

The Molecular Characterization of a New Prunus-Infecting Cheravirus and Complete Genome Sequence of Stocky Prune Virus.

As part of a virome characterization of Prunus species, a novel cheravirus was discovered in two wild species, Prunus brigantina and P. mahaleb, and in an apricot (P. armeniaca) accession. The sequence of the two genomic RNAs was completed for two isolates. The Pro-Pol conserved region showed 86% amino acid (aa) identity with the corresponding region of trillium govanianum cheravirus (TgCV), a tentative Cheravirus member, whereas the combined coat proteins (CPs) shared only 40% aa identity with TgCV CPs, well below the species demarcation threshold for the genus. This suggests that the new virus should be considered a new species for which the name alpine wild prunus virus (AWPV) is proposed. In parallel, the complete genome sequence of stocky prune virus (StPV), a poorly known cheravirus for which only partial sequences were available, was determined. A phylogenetic analysis showed that AWPV, TgCV and StPV form a distinct cluster, away from other cheraviruses.

First report of ash shoestring-associated virus (ASaV) infecting European ash (Fraxinus excelsior L.) in France.

Ash shoestring-associated virus (ASaV) is a recently described Emaravirus with five genome segments identified in Germany and Switzerland from European ash (Fraxinus excelsior) or South European flowering ash (F. ornus) trees with chlorotic spots or mosaics and leaf curling or leaf shoestring symptoms [1]. In summer 2021 several European ash trees with severe leaf mosaic and deformation were observed 50 km south east of Bordeaux (France). Double stranded RNAs were purified from the leaves of one of the trees (2021-432) and analyzed by Illumina high throughput sequencing (HTS, 2x150 nt) as described [2]. Following quality trimming, reads were assembled de novo (CLC Genomics Workbench 21, Qiagen) and contigs annotated by BlastX analysis. Contigs homologous to ASaV genomic RNAs 2 to 5 were identified. For ASaV RNA2, four contigs were identified which could be manually assembled to yield a single scaffold while a single contig was obtained for RNAs 3, 4 and 5. The RNA2 scaffold assembled 1,206 reads for an average coverage of 58.2x, while the corresponding values for RNAs 3 to 5 were respectively 21,381 reads (1,529x), 18,146 reads (1,266x) and 1,234 reads (97.4x). While no contig was identified for ASaV RNA1 (or for other viruses), mapping of reads on an RNA1 reference (OU466880) allowed to identify 25 reads for this genomic segment (average coverage 0.4x). In total, ASaV reads represented 3.9% of the ca. 1 million reads obtained from the ash sample. The RNAs 2 to 5 scaffolds for isolate 2021-432 have been deposited in GenBank (OP501824-7). They show between 94.6% and 97.6% nucleotide identity with the corresponding RNAs of a reference isolate (OU466881-4). In order to validate the presence of ASaV in the original tree, PCR primers were designed based on RNAs 1 and 3 sequences. Primers ASaV1-F (5'-ATTATTCACAGTATGAAAGGG-3') and ASaV1-R (5'-GGTGTGGAGAATATCAAACC-3') amplify a 286 nt RNA1 fragment, while primers ASaV3-F (5'-GCTATACCCAGCTGAGGTGC-3') and ASaV3-R (5'-GTGTGCAATTCTATCAGCCTC-3') amplify a 322 nt RNA3 fragment. Amplicons of the expected size were obtained and directly sequenced. The RNA3 amplicon sequence was identical to the corresponding region of the HTS contig, while the RNA1 amplicon was 97.5% identical to the OU466880 reference sequence. The same primer pairs and a third one, ASaV4-F (5'- GAGGTTGCTTTGATGTCAGG -3') and ASaV4-R (5'- TGCCTCTCCGATGGTGATG -3'), amplifying a 411 nt RNA4 fragment, were used to test a European ash (2022-91) showing similar mosaic and shoestring symptoms collected in spring 2022 about 170 km south of Bordeaux. Again, amplifications were positive and the sequences of the amplicons showed 94.3 to 96.5% nt identity with the corresponding regions of the reference ASaV isolate and 93.9 to 94.3% identity with the French 2021-432 isolate. The PCR amplicon sequences for the two French isolates have been deposited in GenBank (OP501828-32). To our knowledge, these results represent the first report of a natural infection of ASaV in European ash in France. Identification of the virus in two ash populations about 150 km apart suggests the virus maybe widespread. The finding of ASaV in an ash tree with severe leaf symptoms and in which no other virus was identified by HTS supports its role as the causal agent of the symptoms observed. Ash trees in Europe are already threatened by the invasive ash dieback agent [3] and ASaV represents a further potential threat that deserves to be evaluated.

A new flavi-like virus identified in populations of wild carrots.

We report the discovery of a new flavi-like virus identified in wild carrots (Daucus carota subsp. carota), using a double-stranded (ds)RNA high-throughput sequencing (HTS) approach. The new virus, tentatively named "carrot flavi-like virus 1" (CtFLV-1), has a large genome of 21.8 kb that harbours a single open reading frame encoding a 7,078-aa polyprotein with conserved RNA helicase (Hel) and RNA-dependent RNA polymerase (RdRp) domains. The new virus is phylogenetically related to recently described flavi-like viruses from arthropods, but its closest relative is a plant-associated virus, gentian Kobu-sho-associated virus (GKSaV). A pairwise comparison showed that these two viruses share 38.4% amino acid (aa) sequence identity in their polyproteins and 73% and 47.8% aa sequence identity in their conserved RdRp and Hel domains, respectively. Based on their similar genome organization and phylogenetic relationship, GKSaV and CtFLV-1 could form the basis for a new genus of plant-associated viruses, possibly within the family Flaviviridae, for which the name "Koshovirus" is proposed.

First report of grapevine red globe virus (GRGV) and grapevine rupestris vein feathering virus (GRVFV) infecting grapevine (Vitis vinifera L.) in Portugal.

Grapevine Red globe virus (GRGV) and grapevine rupestris vein feathering virus (GRVFV) are relatively recently described grape viruses that respectively belong to the genera Maculavirus and Marafivirus in the family Tymoviridae [1]. Owing to their rather recent description, still limited information on their biology, on their molecular variability and on their geographic distribution is available. Both viruses are apparently completely or largely asymptomatic in European grapevine and have likely been overlooked in a wide range of situations (Martelli, 2014). According to sequences in GenBank, GRGV has been identified in Asia (Iran, Japan, China), the Americas (USA, Brazil) and Europe (Spain, France, Slovenia, Hungary, Czech Republic and Germany). GRVFV has been reported from the same countries but also in Oceania (New Zealand, Australia) and from a range of other countries including India, Pakistan and South Korea for Asia, Canada for North America and Switzerland, Slovakia, Italy and Russia for Europe. Evidence for the presence of GRGV and GRVFV in grapevine plants from northern Portugal (variety(ies) unknown) was obtained through the bioinformatic analysis [2] of RNASeq Illumina data obtained from phloem scrapings from five grapevine samples collected in different plots in 2016 [3]. Following grapevine genome substraction, contigs assembly and Blast-based contigs annotation using CLC Genomics Workbench, two plants, #4 and #5b, yielded contigs representing near complete GRGV genomes. The plant #4 contig integrated 474 reads (0.15% of reads for an average coverage of 10.1x) while the corresponding values for the contig for plant #5b are 2185 reads (2.4% of total reads) for a coverage of 47.2x. The two GRGV contigs show 91.4% nucleotide (nt) identity and the closest GRGV full genome sequence in GenBank, MZ451067 from Canada, shares respectively 98.9% and 91.6% nt identity with them. The near complete genome contigs have been deposited in GenBank (ON603917 and ON603918). Simultaneously, two near full length genomic contigs for GRVFV were identified from plant #5b and have also been deposited in GenBank (ON603919 and ON603920). These contigs show 84.4% nt identity to each other and were respectively assembled from 4643 (5.2% of total reads) and 5326 reads (6.0% of total reads) for respective average coverages of 102.3x and 117.3x. The closest full GRVFV genome in GenBank is MZ027155 from the USA, with 84.3-85.3% nt identity. Confirmation of the presence of GRVG and GRVFV in the doubly infected plant #5b was achieved by specific RT-PCR assays. A published assay [4] was used for GRGV and primers GRVFV-Cp-F 5'AAYCCTGTCACHCTCCACTG3' and GRVFV-Cp-R 5'TTCATGGTGGTGCCDGTGAG3' (Tm 55°C) were used for GRVFV. The obtained 447nt GRGV amplicon showed a single difference with the HTS contig while the 218 nt GRVFV amplicon showed 3 mutations as compared to one of the HTS contigs. The different grapevines had initially been sampled because they showed relatively poor and stunted growth but besides GRVFV and/or GRGV the HTS analysis indicated that they were also infected by hop stunt viroid, grapevine yellow speckle viroid 1, grapevine rupestris stem pitting virus, plus respectively a novel nepovirus (plant #4) and grapevine leafroll-associated virus 2 and grapevine Pinot gris virus (plant #5b) so that the results reported here do not shed novel light on the potential pathogenicity of GRGV or GRVFV. To the best of our knowledge, this is the first report of GRGV and GRVFV in Portugal.

Molecular characterization of Cordyline virus 1 isolates infecting yam (Dioscorea spp).

Cordyline virus 1 (CoV1) is a velarivirus that has so far only been reported in ornamental Ti plants (Cordyline fruticosa). Using high-throughput sequencing, we identified CoV1 infection in yam accessions from Vanuatu. Using a specific RT-PCR assay, we found that CoV1 is also present and highly prevalent in Dioscorea alata, D. cayenensis, and D. trifida in Guadeloupe. Phylogenetic analysis showed that CoV1 isolates infecting yam in Guadeloupe display a low level of molecular diversity. These data provide insights into the transmission of CoV1 in yam in Guadeloupe.

Host range and molecular variability of the sadwavirus dioscorea mosaic associated virus.

Dioscorea mosaic associated virus (DMaV) is a member of the genus Sadwavirus, family Secoviridae, that is associated with mosaic symptoms in Dioscorea rotundata in Brazil. The genome of a DMaV isolate detected in D. trifida in Guadeloupe was sequenced by high-throughput sequencing. Using an RT-PCR-based detection assay, we found that DMaV infects D. alata, D. bulbifera, D. cayenensis-rotundata, D. esculenta, and D. trifida accessions conserved in Guadeloupe and Côte d'Ivoire and displays a very high level of molecular diversity in a relatively small region of the genome targeted by the assay. We also provide evidence that DMaV is also present in D. rotundata in Benin and in D. alata in Nigeria.

Identification of Seven Additional Genome Segments of Grapevine-Associated Jivivirus 1.

Jiviruses are a group of recently described viruses characterized with a tripartite genome and having affinities with Virgaviridae (RNA1 and 2) and Flaviviridae (RNA3). Using a combination of high-throughput sequencing, datamining and RT-PCR approaches, we demonstrate here that in grapevine samples infected by grapevine-associated jivivirus 1 (GaJV-1) up to 7 additional molecules can be consistently detected with conserved 5' and 3' non-coding regions in common with the three previously identified GaJV-1 genomic RNAs. RNA4, RNA5, RNA6, RNA7, RNA8 and RNA10, together with a recombinant RNArec7-8, are all members of a family sharing a previously non recognized conserved protein domain, while RNA9 is part of a distinct family characterized by another conserved motif. Datamining of pecan (Carya illinoinensis) public transcriptomic data allowed the identification of two further jiviviruses and the identification of supplementary genomic RNAs with homologies to those of GaJV-1. Taken together, these results reshape our vision of the divided genome of jiviviruses and raise novel questions about the function(s) of the proteins encoded by jiviviruses supplementary RNAs.

Natural Infection of Pomegranate (Punica Granatum) by Apple Dimple Fruit Viroid.

The analysis by high throughput sequencing (HTS) and RT-PCR of Spanish pomegranate fruits showing yellow rings revealed the presence of viroid isolates closely related to fig isolates of apple dimple fruit viroid (ADFVd). The analysis of pomegranate public RNASeq data (Sequence Reads Archives, SRAs) from Israel provided evidence for the presence of similar ADFVd isolates in pomegranate trees in this country. In addition, reads or contigs of plum viroid I (PVd-I) isolates were also identified in two of the analyzed SRA datasets from Israel, suggesting the presence of this second viroid in pomegranate. Full length ADFVd genomic sequences have been recovered, increasing knowledge on the diversity of this viroid and on the pomegranate virome in which only four viruses and one viroid had previously been reported.

Novel Ampeloviruses Infecting Cassava in Central Africa and the South-West Indian Ocean Islands.

Cassava is one of the most important staple crops in Africa and its production is seriously damaged by viral diseases. In this study, we identify for the first time and characterize the genome organization of novel ampeloviruses infecting cassava plants in diverse geographical locations using three high-throughput sequencing protocols [Virion-Associated Nucleotide Acid (VANA), dsRNA and total RNA], and we provide a first analysis of the diversity of these agents and of the evolutionary forces acting on them. Thirteen new Closteroviridae isolates were characterized in field-grown cassava plants from the Democratic Republic of Congo (DR Congo), Madagascar, Mayotte, and Reunion islands. The analysis of the sequences of the corresponding contigs (ranging between 10,417 and 13,752 nucleotides in length) revealed seven open reading frames. The replication-associated polyproteins have three expected functional domains: methyltransferase, helicase, and RNA-dependent RNA polymerase (RdRp). Additional open reading frames code for a small transmembrane protein, a heat-shock protein 70 homolog (HSP70h), a heat shock protein 90 homolog (HSP90h), and a major and a minor coat protein (CP and CPd respectively). Defective genomic variants were also identified in some cassava accessions originating from Madagascar and Reunion. The isolates were found to belong to two species tentatively named Manihot esculenta-associated virus 1 and 2 (MEaV-1 and MEaV-2). Phylogenetic analyses showed that MEaV-1 and MEaV-2 belong to the genus Ampelovirus, in particular to its subgroup II. MEaV-1 was found in all of the countries of study, while MEaV-2 was only detected in Madagascar and Mayotte. Recombination analysis provided evidence of intraspecies recombination occurring between the isolates from Madagascar and Mayotte. No clear association with visual symptoms in the cassava host could be identified.

Characterization of the Mycovirome of the Phytopathogenic Fungus, Neofusicoccum parvum.

Neofusicoccum parvum is a fungal plant-pathogen belonging to the family Botryosphaeriaceae, and is considered one of the most aggressive causal agents of the grapevine trunk disease (GTD) Botryosphaeria dieback. In this study, the mycovirome of a single strain of N. parvum (COLB) was characterized by high throughput sequencing analysis of total RNA and subsequent bioinformatic analyses. Contig annotations, genome completions, and phylogenetic analyses allowed us to describe six novel mycoviruses belonging to four different viral families. The virome is composed of two victoriviruses in the family Totiviridae, one alphaendornavirus in the family Endornaviridae, two mitoviruses in the family Mitoviridae, and one narnavirus belonging to the family Narnaviridae. The presence of the co-infecting viruses was confirmed by sequencing the RT-PCR products generated from total nucleic acids extracted from COLB. This study shows that the mycovirome of a single N. parvum strain is highly diverse and distinct from that previously described in N. parvum strains isolated from grapevines.

Sixty Years from the First Disease Description, a Novel Badnavirus Associated with Chestnut Mosaic Disease.

Although chestnut mosaic disease (ChMD) was described several decades ago, its etiology is still not clear. Using classical approaches and high-throughput sequencing (HTS) techniques, we identified a novel Badnavirus that is a strong etiological candidate for ChMD. Two disease sources from Italy and France were submitted to HTS-based viral indexing. Total RNAs were extracted, ribodepleted, and sequenced on an Illumina NextSeq500 (2 × 150 nt or 2 × 75 nt). In each source, we identified a single contig of ≈7.2 kb that corresponds to a complete circular viral genome and shares homologies with various badnaviruses. The genomes of the two isolates have an average nucleotide identity of 90.5%, with a typical badnaviral genome organization comprising three open reading frames. Phylogenetic analyses and sequence comparisons showed that this virus is a novel species; we propose the name Chestnut mosaic virus (ChMV). Using a newly developed molecular detection test, we systematically detected the virus in symptomatic graft-inoculated indicator plants (chestnut and American oak) as well in chestnut trees presenting typical ChMD symptoms in the field (100 and 87% in France and Italy surveys, respectively). Datamining of publicly available chestnut sequence read archive transcriptomic data allowed the reconstruction of two additional complete ChMV genomes from two Castanea mollissima sources from the United States as well as ChMV detection in C. dentata from the United States. Preliminary epidemiological studies performed in France and central eastern Italy showed that ChMV has a high incidence in some commercial orchards and low within-orchard genetic diversity.