The impact of preclinical irreproducibility on drug development.

The development of novel therapeutics depends and builds upon the validity and reproducibility of previously published data and findings. Yet irreproducibility is pervasive in preclinical life science research and can be traced to cumulative errors or flaws in several areas, including reference materials, study design, laboratory protocols, and data collection and analysis. The expanded development and use of consensus-based standards and well-documented best practices is needed to both enhance reproducibility and drive therapeutic innovations.

The acute promyelocytic leukemia-associated protein, promyelocytic leukemia zinc finger, regulates 1,25-dihydroxyvitamin D(3)-induced monocytic differentiation of U937 cells through a physical interaction with vitamin D(3) receptor.

Monocyte differentiation induced by 1,25-dihydroxyvitamin D(3) (1,25(OH)(2)D(3)) is interrupted during the course of acute promyelocytic leukemia (APL). One form of APL is associated with the translocation t(11;17), which joins the promyelocytic leukemia zinc finger (PLZF) and retinoic acid receptor alpha (RARalpha) genes. Because PLZF is coexpressed in the myeloid lineage with the vitamin D(3) receptor (VDR), the interplay between PLZF and VDR was examined. It was found that PLZF interacts directly with VDR. This occurred at least partly through contacts in the DNA-binding domain of VDR and the broad complex, tram-trak, bric-a-brac/pox virus zinc finger (BTB/POZ) domain of PLZF. Moreover, PLZF altered the mobility of VDR derived from nuclear extracts when bound to its cognate binding site, forming a slowly migrating DNA-protein complex. Overexpression of PLZF in a monocytic cell line abrogated 1,25(OH)(2)D(3) activation from both a minimal VDR responsive reporter and the promoter of p21(WAF1/CIP1), a target gene of VDR. Deletion of the BTB/POZ domain significantly relieved PLZF-mediated repression of 1,25(OH)(2)D(3)-dependent activation. In addition, stable, inducible expression of PLZF in U937 cells inhibited the ability of 1,25(OH)(2)D(3) to induce surface expression of the monocytic marker CD14 and morphologic changes associated with differentiation. These results suggest that PLZF may play an important role in regulating the process by which 1,25(OH)(2)D(3) induces monocytic differentiation in hematopoietic cells.

Using human rights in maternal mortality programs: from analysis to strategy.

This article describes an approach to maternal mortality reduction that uses human rights not simply to denounce the injustice of death in pregnancy and childbirth, but also to guide the design and implementation of maternal mortality policies and programs. As a first principle, programs and policies need to prioritize measures that promote universal access to high quality emergency obstetric care services, which we know from health research are essential to saving women's lives. With that priority, human rights principles can be integrated into programs at the clinical, facility management, and national policy levels. For example, a human rights 'audit' can help identify ways to encourage respectful, non-discriminatory treatment of patients, providers and staff in the clinical setting. Human rights principles of entitlement and accountability can inform mechanisms of community participation designed to improve responsiveness and functioning of health facilities. Human rights principles can inform analysis of health sector reform and its impact on access to emergency obstetric care. Whether applied to the intricacies of human relationships within a facility or to the impact of international financial institutions on health systems, the ultimate role of human rights is to identify the workings of power that keep unacceptable levels of maternal morality as they are and to use the human rights vision of dignity and social justice to work for the re-arrangements of power necessary for change.

Mediator complexes and transcription.

Over the past decade, various components of the transcription machinery have been identified as potential targets for activators. Recently, metazoan versions of yeast Mediator have been isolated and found to act as key coactivators to many transcription factors. Recent work has defined the composition, function and biology of metazoan mediator complexes, which has led us to propose a new nomenclature for the variously named versions of the mediator complex.

Repression of transcription of the p27(Kip1) cyclin-dependent kinase inhibitor gene by c-Myc.

Upon engagement of the B Cell Receptor (BCR) of WEHI 231 immature B cells, a drop in c-Myc expression is followed by activation of the cyclin-dependent kinase inhibitor (CKI) p27(Kip1), which induces growth arrest and apoptosis. Here, we report inverse patterns of p27 and c-Myc protein expression follow BCR engagement. We present evidence demonstrating, for the first time, that the p27(Kip1) gene is a target of transcriptional repression by c-Myc. Specifically, the changes in p27 protein levels correlated with changes in p27 mRNA levels, and gene transcription. Induction of p27 promoter activity followed BCR engagement of WEHI 231 cells, and this induction could be repressed upon co-transfection of a c-Myc expression vector. Inhibition of the TATA-less p27 promoter by c-Myc was also observed in Jurkat T cells, vascular smooth muscle, and Hs578T breast cancer cells, extending the observation beyond immune cells. Consistent with a putative Inr element CCAGACC (where +1 is underlined) at the start site of transcription in the p27 promoter, deletion of Myc homology box II reduced the extent of repression. Furthermore, enhanced repression was observed upon transfection of the c-Myc 'super-repressor', with mutation of Phe115 to Leu. The sequences mediating transcriptional activity and c-Myc repression were mapped to bp -20 to +20 of the p27 gene. Finally, binding of Max was shown to facilitate c-Myc binding and repression of p27 promoter activity. Overall, these studies identify the p27 CKI gene as a new target whereby c-Myc can control cell proliferation, survival and neoplastic transformation.

Molecular analysis of the prostate-specific antigen upstream gene enhancer.

BACKGROUND: Our objective was to identify factors other than androgen receptor that bind to and regulate the prostate-specific antigen (PSA) upstream gene enhancer (PSE). METHODS: DNAse I footprinting and electromobility shift assays (EMSA) were performed over the PSE using lysates from PSA-producing cell lines, LNCaP and LAPC4, and nonproducing PSA cell lines, PC-3 cells, U937 monocytes, and Namalwa B cells. Mutational analysis and transient transfection assays were used to determine the contributions made by different elements towards the regulation of the enhancer. RESULTS: Three distinct regions surrounding androgen response elements of the PSE were found to bind unknown ubiquitous and cell type-specific proteins. These regions, when mutated in a PSE reporter construct, were shown to be required for maximal activation in LNCaP cells. CONCLUSIONS: These results correlate unknown sequence-specific DNA binding proteins with androgen-mediated regulation of a prostate-specific gene, thus providing further insight into the mechanism of PSA gene expression.

Discrete roles for peroxisome proliferator-activated receptor gamma and retinoid X receptor in recruiting nuclear receptor coactivators.

Peroxisome proliferator-activated receptor gamma (PPARgamma) plays a major role in adipogenesis. PPARgamma binds to DNA as a heterodimer with retinoid X receptor (RXR), and PPARgamma-RXR can be activated by ligands specific for either receptor; the presence of both ligands can result in a cooperative effect on the transactivation of target genes. How these ligands mediate transactivation, however, remains unclear. PPARgamma is known to interact with both the p160/SRC-1 family of coactivators and the distinct, multisubunit coactivator complex called DRIP. A single DRIP subunit, DRIP205 (TRAP220, PBP), binds directly to PPARgamma. Here we report that PPARgamma and RXR selectively interacted with DRIP205 and p160 proteins in a ligand-dependent manner. At physiological concentrations, RXR-specific ligands only induced p160 binding to RXR, and PPARgamma-specific ligands exclusively recruited DRIP205 but not p160 coactivators to PPARgamma. This selectivity was not observed in interaction assays off DNA, implying that the specificity of coactivator binding in response to ligand is strongly influenced by the allosteric effects of DNA-bound heterodimers. These coactivator-selective effects were also observed in transient-transfection assays in the presence of overexpressed p160 or DRIP coactivators. The results suggest that the cooperative effects of PPARgamma- and RXR-specific ligands may occur at the level of selective coactivator recruitment.

p21 is a transcriptional target of HOXA10 in differentiating myelomonocytic cells.

The myeolomonocytic cell line U937 differentiates into macrophages in response to a variety of agents. Several genes including the cyclin-dependent kinase inhibitor p21(waf1/cip1) and the homeobox gene transcription factor HOXA10 are induced at the onset of differentiation. Ectopic expression of either gene results in U937 differentiation. In this paper, we describe a mechanism by which p21 and HOXA10 may act in concert, where HOXA10 can bind directly to the p21 promoter and, together with its trimeric partners PBX1 and MEIS1, activate p21 transcription, resulting in cell cycle arrest and differentiation. These experiments for the first time identify p21 as a selective target for a HOX protein and link the differentiative properties of a transcription factor and a cell cycle inhibitor.

Ligand-inducible interaction of the DRIP/TRAP coactivator complex with retinoid receptors in retinoic acid-sensitive and -resistant acute promyelocytic leukemia cells.

Retinoic acid (RA) signaling is mediated by its nuclear receptors RXR and RAR, which bind to their cognate response elements as a heterodimer, RXR/RAR, and act in concert with coregulatory factors to regulate gene transcription on ligand binding. To identify specific cofactors that interact with the RXR/RAR heterodimer in acute promyelocytic leukemia (APL) cells, a double cistronic construct was used that allowed coexpression of the RXR LBD (ligand binding domain) with the RAR LBD as an affinity matrix to pull down interacting proteins from nuclear extracts prepared from a human APL cell line, NB4. A group of proteins was detected whose interaction with RXR/RAR is ligand inducible. The molecular weight pattern of these proteins is similar to that of a complex of proteins previously identified as DRIP or TRAP, which are ligand-dependent transcription activators of VDR and TR, respectively. The RXR/RAR-interacting proteins from NB4 were confirmed to be identical to the DRIP subunits by comparative electrophoresis, Western blot analysis, and in vitro protein interaction assay. In addition to RXR/RAR, the DRIP component can interact directly with the APL-specific PML-RARalpha fusion protein. The same DRIP complex is present in RA-resistant APL cells and in a variety of cancer cell lines, supporting its global role in transcriptional regulation.

Functional interactions between the estrogen receptor and DRIP205, a subunit of the heteromeric DRIP coactivator complex.

Nuclear receptors regulate transcription in direct response to their cognate hormonal ligands. Ligand binding leads to the dissociation of corepressors and the recruitment of coactivators. Many of these factors, acting in large complexes, have emerged as potential chromatin remodelers through intrinsic histone modifying activities. In addition, other ligand-recruited complexes appear to act more directly on the transcriptional apparatus. The DRIP complex is a 15-subunit complex required for nuclear receptor transcriptional activation in vitro. It is recruited to the receptor in response to ligand through specific interactions of one subunit, DRIP205. We present evidence that DRIP205 interacts with another member of the steroid receptor subfamily, estrogen receptor (ER). This interaction occurs in an agonist-stimulated fashion which in turn is inhibited by several ER antagonists. In vivo, a fragment of DRIP205 containing only its receptor interacting region acts to selectively inhibit ER's ability to activate transcription in response to estradiol. These observations suggest a key role for the DRIP coactivator complex in estrogen-ER signaling.

Mechanisms of gene regulation by vitamin D(3) receptor: a network of coactivator interactions.

The vitamin D(3) receptor regulates transcription in direct response to its cognate hormonal ligand, 1,25(OH)(2)D(3). Ligand binding leads to the recruitment of coactivators. Many of these factors, acting in large complexes, have emerged as chromatin remodelers partly through intrinsic histone modifying activities. In addition, other ligand-recruited complexes appear to act more directly on the transcriptional apparatus, suggesting that transcriptional regulation by VDR and other nuclear receptors may involve a process of both chromatin alterations and direct recruitment of key initiation components at regulated promoters.

The DRIP complex and SRC-1/p160 coactivators share similar nuclear receptor binding determinants but constitute functionally distinct complexes.

Transcriptional activation requires both access to DNA assembled as chromatin and functional contact with components of the basal transcription machinery. Using the hormone-bound vitamin D(3) receptor (VDR) ligand binding domain (LBD) as an affinity matrix, we previously identified a novel multisubunit coactivator complex, DRIP (VDR-interacting proteins), required for transcriptional activation by nuclear receptors and several other transcription factors. In this report, we characterize the nuclear receptor binding features of DRIP205, a key subunit of the DRIP complex, that interacts directly with VDR and thyroid hormone receptor in response to ligand and anchors the other DRIP subunits to the nuclear receptor LBD. In common with other nuclear receptor coactivators, DRIP205 interaction occurs through one of two LXXLL motifs and requires the receptor's AF-2 subdomain. Although the second motif of DRIP205 is required only for VDR binding in vitro, both motifs are used in the context of an retinoid X receptor-VDR heterodimer on DNA and in transactivation in vivo. We demonstrate that both endogenous p160 coactivators and DRIP complexes bind to the VDR LBD from nuclear extracts through similar sequence requirements, but they do so as distinct complexes. Moreover, in contrast to the p160 family of coactivators, the DRIP complex is devoid of any histone acetyltransferase activity. The results demonstrate that different coactivator complexes with distinct functions bind to the same transactivation region of nuclear receptors, suggesting that they are both required for transcription activation by nuclear receptors.

Identification and characterization of two androgen response regions in the human neutral endopeptidase gene.

Transcription of the human neutral endopeptidase 24.11 (NEP) gene is androgen regulated in prostate cancer cells. Homology search identified a sequence GTCACAaagAGTTCT similar to the ARE consensus sequence GGTACAnnnTGTTCT within the 3'-untranslated region of the NEP mRNA. A double-stranded radiolabelled oligonucleotide containing this NEP-ARE sequence formed a DNA-protein complex with nuclear proteins from LNCaP cells or COS-7 cells co-transfected with an androgen receptor (AR) expression vector, and with full-length AR synthesized by baculovirus in mobility shift assays. Unlabeled NEP-ARE or consensus ARE but not mutated NEP-ARE replaced radiolabelled NEP-ARE. Steroid-dependent enhancement of transcription was assayed by transfecting ptkCAT reporter constructs containing the NEP-ARE into CV-1/AR cells and prostate cancer cells (PC-3/AR). Enhancement of chloramphenicol acetyltransferase (CAT) activity was increased four-fold by androgen, seven-fold by dexamethasone and three-fold by progesterone in CV-1/AR cells, and the NEP-ARE bound to glucocorticoid and progesterone receptor in mobility shift assays. We next performed DNase-I footprinting analysis of the NEP promoter and identified a 23 bp sequence GGTGCGGGTCGGAGGGATGCCCA (NEP-ARR) which was protected from DNase I cleavage by nuclear extracts from COS-7 cells expressing AR. This sequence was 62.5% homologous to an androgen responsive region (PSA-ARR) identified in the promoter of the prostate specific antigen (PSA) gene. A double-stranded radiolabelled oligonucleotide containing this NEP-ARR sequence formed DNA-protein complex with AR but not GR proteins. Unlabeled NEP-ARR, PSA-ARR and NEP-ARE replaced radiolabelled NEP-ARR. Steroid-dependent enhancement of transcription assays in PC-3/AR cells revealed that the enhancement of CAT activity was increased 2.3-fold by androgen, but not by glucocorticoid or progesterone. In a thymidine kinase promoter, the NEP-ARE and NEP-ARR together stimulated a five-fold increase in promoter activity in PC cells. These data suggest that steroid regulation of the NEP gene involves at least two elements including a typical ARE which binds androgen, progesterone and glucocorticoid receptors, and a unique ARR which only binds androgen receptor.

Binding of liganded vitamin D receptor to the vitamin D receptor interacting protein coactivator complex induces interaction with RNA polymerase II holoenzyme.

Because the vitamin D receptor interacting protein (DRIP) coactivator complex shares components with the RNA polymerase II (Pol II) holoenzyme complex, we tested whether the two protein complexes associate in cellular extracts. On initial purification steps, the DRIP complex copurified with the Pol II holoenzyme. Pol II was found to bind to the vitamin D receptor in a ligand-dependent fashion when either nuclear extracts or partially purified preparations were used as sources of DRIP and Pol II holoenzyme. A subpopulation of holoenzyme complexes bound to the receptor because BRCA1, which associates with the Pol II holoenzyme, did not associate with the liganded receptor, and only in certain of the holoenzyme- and DRIP-containing fractions did Pol II bind to the liganded receptor. Immunoprecipitation experiments revealed that the DRIP complex was not pre-associated with the Pol II holoenzyme, but the interaction between these two complexes was induced only in the presence of receptor and ligand. These data support a model in which the activation of transcription by hormone-bound receptor requires binding to the DRIP coactivator, and this induced ternary complex can then bind to the Pol II holoenzyme to activate transcription.

A RA-dependent, tumour-growth suppressive transcription complex is the target of the PML-RARalpha and T18 oncoproteins.

PML and Tif1a are fused to RARA and Braf, respectively, resulting in the production of PML-RARalpha and Tif1alpha-B-Raf (T18) oncoproteins. Here we show that PML, Tif1alpha and RXRalpha/RARalpha function together in a transcription complex that is dependent on retinoic acid (RA). We found that PML acts as a ligand-dependent coactivator of RXRalpha/RARalpha. PML interacts with Tif1alpha and CBP. In Pml-/- cells, the RA-dependent induction of genes such as RARB2 and the ability of Tif1alpha and CBP to act as transcriptional coactivators on RA are impaired. We show that both PML and Tif1alpha are growth suppressors required for the growth-inhibitory activity of RA. T18, similar to PML-RARalpha, disrupts the RA-dependent activity of this complex in a dominant-negative manner resulting in a growth advantage. Our data define a new pathway for the control of cell growth and tumorigenesis, and provide a new model for the pathogenesis of acute promyelocytic leukaemia (APL).

Nuclear receptor cofactors as chromatin remodelers.

Nuclear receptors regulate transcription in direct response to their cognate hormonal ligands. Ligand binding leads to the dissociation of corepressors and the recruitment of coactivators. Many of these factors, acting in large complexes, have emerged as chromatin remodelers through intrinsic histone modifying activities or through other novel functions. In addition, other ligand-recruited complexes appear to act more directly on the transcriptional apparatus, suggesting that transcriptional regulation by nuclear receptors may involve a process of both chromatin alterations and direct recruitment of key initiation components at regulated promoters.

Differential regulation of glucocorticoid receptor transcriptional activation via AF-1-associated proteins.

The hormone-activated glucocorticoid receptor (GR), through its N- and C-terminal transcriptional activation functions AF-1 and AF-2, controls the transcription of target genes presumably through interaction(s) with transcriptional regulatory factors. Utilizing a modified yeast two-hybrid approach, we have identified the tumor susceptibility gene 101 (TSG101) and the vitamin D receptor-interacting protein 150 (DRIP150) as proteins that interact specifically with a functional GR AF-1 surface. In yeast and mammalian cells, TSG101 represses whereas DRIP150 enhances GR AF-1-mediated transactivation. Thus, GR AF-1 is capable of recruiting both positive and negative regulatory factors that differentially regulate GR transcriptional enhancement. In addition, we show that another member of the DRIP complex, DRIP205, interacts with the GR ligand binding domain in a hormone-dependent manner and facilitates GR transactivation in concert with DRIP150. These results suggest that DRIP150 and DRIP205 functionally link GR AF-1 and AF-2, and represent important mediators of GR transcriptional enhancement.

Coactivators for the orphan nuclear receptor RORalpha.

A mutation in the nuclear orphan receptor RORalpha results in a severe impairment of cerebellar development by unknown mechanisms. We have shown previously that RORalpha contains a strong constitutive activation domain in its C terminus. We therefore searched for mammalian RORalpha coactivators using the minimal activation domain as bait in a two-hybrid screen. Several known and putative coactivators were isolated, including glucocorticoid receptor-interacting protein-1 (GRIP-1) and peroxisome proliferator-activated receptor (PPAR)-binding protein (PBP/TRAP220/DRIP205). These interactions were confirmed in vitro and require the intact activation domain of RORalpha although different requirements for interaction with GRIP-1 and PBP were detected. Even in the absence of exogenous ligand, RORalpha interacts with a complex or complexes of endogenous proteins, similar to those that bind to ligand-occupied thyroid hormone and vitamin D receptors. Both PBP and GRIP-1 were shown to be present in these complexes. Thus we have identified several potential RORalpha coactivators that, in contrast to the interactions with hormone receptors, interact with RORalpha in yeast, in bacterial extracts, and in mammalian cells in vivo and in vitro in the absence of exogenous ligand. GRIP-1 functioned as a coactivator for the RORalpha both in yeast and in mammalian cells. Thus, GRIP-1 is the first proven coactivator for RORalpha.

20-Epi analogues of 1,25-dihydroxyvitamin D3 are highly potent inducers of DRIP coactivator complex binding to the vitamin D3 receptor.

1,25-Dihydroxyvitamin D3 (1,25(OH)2D3) plays a major role in the stimulation of bone growth, mineralization, and intestinal calcium and phosphate absorption; it also acts as a general inhibitor of cellular proliferation. Several new, clinically relevant compounds dissociate antiproliferative and calcemic activities of 1,25(OH)2D3, but the molecular basis for this has not been clearly elucidated. Here, we tested whether the potency of one class of compounds, 20-epi analogues, to induce myeloid cell differentiation, is because of direct molecular effects on vitamin D receptor (VDR). We report that two 20-epi analogues, MC1627 and MC1288, induced differentiation and transcription of p21(Waf1,Cip1), a key VDR target gene involved in growth inhibition, at a concentration 100-fold lower than that of 1,25(OH)2D3. We compared this sensitivity to analogue effects on VDR interacting proteins: RXR, GRIP-1, and DRIP205, a subunit of the DRIP coactivator complex. Compared with the interaction of VDR with RXR or GRIP-1, the differentiation dose-response most closely correlated to the ligand-dependent recruitment of the DRIP coactivator complex to VDR and to the ability of the receptor to activate transcription in a cell-free system. These results provide compelling links between the efficiency of the 20-epi analogue in inducing VDR/DRIP interactions, transactivation in vitro, and its enhanced ability to induce cellular differentiation.