RESUMO
DNA quadruplex structures provide an additional layer of regulatory control in genome maintenance and gene expression and are widely used in nanotechnology. We report the discovery of an unprecedented tetrastranded structure formed from a native G-rich DNA sequence originating from the telomeric region of Caenorhabditis elegans. The structure is defined by multiple properties that distinguish it from all other known DNA quadruplexes. Most notably, the formation of a stable so-called KNa-quadruplex (KNaQ) requires concurrent coordination of K+ and Na+ ions at two distinct binding sites. This structure provides novel insight into G-rich DNA folding under ionic conditions relevant to eukaryotic cell physiology and the structural evolution of telomeric DNA. It highlights the differences between the structural organization of human and nematode telomeric DNA, which should be considered when using C. elegans as a model in telomere biology, particularly in drug screening applications. Additionally, the absence/presence of KNaQ motifs in the host/parasite introduces an intriguing possibility of exploiting the KNaQ fold as a plausible antiparasitic drug target. The structure's unique shape and ion dependency and the possibility of controlling its folding by using low-molecular-weight ligands can be used for the design or discovery of novel recognition DNA elements and sensors.
Assuntos
Quadruplex G , Animais , Humanos , Caenorhabditis elegans/genética , DNA/química , Sequência de Bases , Cátions , Telômero/genéticaRESUMO
Cytosine-rich DNA regions can form four-stranded structures based on hemi-protonated C.C+ pairs, called i-motifs (iMs). Using CD, UV absorption, NMR spectroscopy, and DSC calorimetry, we show that model (CnT3)3Cn (Cn) sequences adopt iM under neutral or slightly alkaline conditions for n > 3. However, the iMs are formed with long-lasting kinetics under these conditions and melt with significant hysteresis. Sequences with n > 6 melt in two or more separate steps, indicating the presence of different iM species, the proportion of which is dependent on temperature and incubation time. At ambient temperature, kinetically favored iMs of low stability are formed, most likely consisting of short C.C+ blocks. These species act as kinetic traps and prevent the assembly of thermodynamically favored, fully C.C+ paired iMs. A higher temperature is necessary to unfold the kinetic forms and enable their substitution by a slowly developing thermodynamic structure. This complicated kinetic partitioning process considerably slows down iM folding, making it much slower than the timeframes of biological reactions and, therefore, unlikely to have any biological relevance. Our data suggest kinetically driven iM species as more likely to be biologically relevant than thermodynamically most stable iM forms.
Assuntos
DNA , Conformação de Ácido Nucleico , Cinética , Motivos de Nucleotídeos , DNA/genética , DNA/química , Concentração de Íons de HidrogênioRESUMO
Guanine quadruplexes (G4s) are noncanonical forms of nucleic acids that are frequently found in genomes. The stability of G4s depends, among other factors, on the number of G-tetrads. Three- or four-tetrad G4s and antiparallel two-tetrad G4s have been characterized experimentally; however, the existence of an intramolecular (i. e., not dimeric or multimeric) two-tetrad parallel-stranded DNA G4 has never been experimentally observed. Many sequences compatible with two-tetrad G4 can be found in important genomic regions, such as promoters, for which parallel G4s predominate. Using experimental and theoretical approaches, the propensity of the model sequence AATGGGTGGGTTTGGGTGGGTAA to form an intramolecular parallel-stranded G4 upon increasing the number of GGG-to-GG substitutions has been studied. Deletion of a single G leads to the formation of intramolecular G4s with a stacked G-triad, whose topology depends on the location of the deletion. Removal of another guanine from another G-tract leads to di- or multimeric G4s. Further deletions mostly prevent the formation of any stable G4. Thus, a solitary two-tetrad parallel DNA G4 is not thermodynamically stable and requires additional interactions through capping residues. However, transiently populated metastable two-tetrad species can associate to form stable dimers, the dynamic formation of which might play additional delicate roles in gene regulation. These findings provide essential information for bioinformatics studies searching for potential G4s in genomes.
Assuntos
Quadruplex G , Sequência de Bases , DNA/genética , Guanina , Regiões Promotoras GenéticasRESUMO
We recently showed that Saccharomyces cerevisiae telomeric DNA can fold into an unprecedented pseudocircular G-hairpin (PGH) structure. However, the formation of PGHs in the context of extended sequences, which is a prerequisite for their function in vivo and their applications in biotechnology, has not been elucidated. Here, we show that despite its 'circular' nature, PGHs tolerate single-stranded (ss) protrusions. High-resolution NMR structure of a novel member of PGH family reveals the atomistic details on a junction between ssDNA and PGH unit. Identification of new sequences capable of folding into one of the two forms of PGH helped in defining minimal sequence requirements for their formation. Our time-resolved NMR data indicate a possibility that PGHs fold via a complex kinetic partitioning mechanism and suggests the existence of K+ ion-dependent PGH folding intermediates. The data not only provide an explanation of cation-type-dependent formation of PGHs, but also explain the unusually large hysteresis between PGH melting and annealing noted in our previous study. Our findings have important implications for DNA biology and nanotechnology. Overrepresentation of sequences able to form PGHs in the evolutionary-conserved regions of the human genome implies their functionally important biological role(s).
Assuntos
DNA Circular/química , Pareamento de Bases , Modelos Moleculares , Ressonância Magnética Nuclear Biomolecular , Conformação de Ácido Nucleico , Motivos de Nucleotídeos , Saccharomyces cerevisiae/genética , Estereoisomerismo , Telômero/químicaRESUMO
The ends of eukaryotic chromosomes typically contain a 3' ssDNA G-rich protrusion (G-overhang). This overhang must be protected against detrimental activities of nucleases and of the DNA damage response machinery and participates in the regulation of telomerase, a ribonucleoprotein complex that maintains telomere integrity. These functions are mediated by DNA-binding proteins, such as Cdc13 in Saccharomyces cerevisiae, and the propensity of G-rich sequences to form various non-B DNA structures. Using CD and NMR spectroscopies, we show here that G-overhangs of S. cerevisiae form distinct Hoogsteen pairing-based secondary structures, depending on their length. Whereas short telomeric oligonucleotides form a G-hairpin, their longer counterparts form parallel and/or antiparallel G-quadruplexes (G4s). Regardless of their topologies, non-B DNA structures exhibited impaired binding to Cdc13 in vitro as demonstrated by electrophoretic mobility shift assays. Importantly, whereas G4 structures formed relatively quickly, G-hairpins folded extremely slowly, indicating that short G-overhangs, which are typical for most of the cell cycle, are present predominantly as single-stranded oligonucleotides and are suitable substrates for Cdc13. Using ChIP, we show that the occurrence of G4 structures peaks at the late S phase, thus correlating with the accumulation of long G-overhangs. We present a model of how time- and length-dependent formation of non-B DNA structures at chromosomal termini participates in telomere maintenance.
Assuntos
Homeostase do Telômero/fisiologia , Telômero/metabolismo , DNA/metabolismo , DNA de Cadeia Simples/metabolismo , Proteínas de Ligação a DNA/metabolismo , Ensaio de Desvio de Mobilidade Eletroforética , Quadruplex G , Cinética , Conformação de Ácido Nucleico , Oligonucleotídeos/genética , Saccharomyces cerevisiae/metabolismo , Proteínas de Saccharomyces cerevisiae/metabolismo , Telomerase/genética , Proteínas de Ligação a Telômeros/metabolismoRESUMO
In this study, we report the first atomic resolution structure of a stable G-hairpin formed by a natively occurring DNA sequence. An 11-nt long G-rich DNA oligonucleotide, 5'-d(GTGTGGGTGTG)-3', corresponding to the most abundant sequence motif in irregular telomeric DNA from Saccharomyces cerevisiae (yeast), is demonstrated to adopt a novel type of mixed parallel/antiparallel fold-back DNA structure, which is stabilized by dynamic G:G base pairs that transit between N1-carbonyl symmetric and N1-carbonyl, N7-amino base-pairing arrangements. Although the studied sequence first appears to possess a low capacity for base pairing, it forms a thermodynamically stable structure with a rather complex topology that includes a chain reversal arrangement of the backbone in the center of the continuous G-tract and 3'-to-5' stacking of the terminal residues. The structure reveals previously unknown principles of the folding of G-rich oligonucleotides that could be applied to the prediction of natural and/or the design of artificial recognition DNA elements. The structure also demonstrates that the folding landscapes of short DNA single strands is much more complex than previously assumed.