Transmission of Pantoea ananatis and P. agglomerans, causal agents of center rot of onion (Allium cepa), by onion thrips (Thrips tabaci) through feces.

Frankliniella fusca, the tobacco thrips, has been shown to acquire and transmit Pantoea ananatis, one of the causal agents of the center rot of onion. Although Thrips tabaci, the onion thrips, is a common pest of onions, its role as a vector of P. ananatis has been unknown. The bacterium, P. agglomerans, is also associated with the center rot of onion, but its transmission by thrips has not been previously investigated. In this study, we investigated the relationship of T. tabaci with P. ananatis and P. agglomerans. Surface-sterilized T. tabaci were provided with various acquisition access periods (AAP) on onion leaves inoculated with either P. ananatis or P. agglomerans. A positive exponential relationship was observed between thrips AAP duration and P. ananatis (R² = 0.967; P = 0.023) or P. agglomerans acquisition (R² = 0.958; P = 0.017). Transmission experiments conducted with T. tabaci adults indicated that 70% of the seedlings developed center rot symptoms 15 days after inoculation. Immunofluorescence microscopy with antibodies specific to P. ananatis revealed that the bacterium was localized only in the gut of T. tabaci adults. Mechanical inoculation of onion seedlings with fecal rinsates alone produced center rot but not with salivary secretions. Together these results suggested that T. tabaci could efficiently transmit P. ananatis and P. agglomerans.

First Report of Bacterial Blight of Sugar Beet Caused by Pseudomonas syringae pv. aptata in Georgia, USA.

Sugar beet (Beta vulgaris L.) is not currently a commercial crop in Georgia, but experimental plantings as a winter rotational crop are promising in terms of yield and industrial sugar production (T. Brenneman, personal communication). A disease outbreak of suspected bacterial origin occurred in sugar beet plots (experimental lines Beta Seed energy beet 'BTS ENC115,' 'BTS EGC184,' 'BTS EGC195,' and 'BTS 1EN6702') in Tift Co., GA, in December 2012, at ~35% incidence. Foliar symptoms included circular to irregular spots, each with a tan center and dark margin. Ten leaves/experimental line with leaf spot symptoms were collected, and bacterial isolations made on King's B agar medium. After 48 h of incubation, cream-colored, fluorescent yellow, round colonies with smooth margins were isolated. The isolates were each gram negative, oxidase negative, non-pectolytic on potato, arginine dihydrolase negative, produced levan, and gave a hypersensitivity response (HR) on tobacco. These characteristics indicated that the isolates belonged to Pseudomonas syringae van Hall LOPAT group Ia (3). The 16S-23S rRNA (internal transcribed regions) (1) from four foliar isolates (SB-1, SB-2, SB-3, and SB-4), one/experimental line, was amplified, and the resultant PCR products were sequenced and BLAST searched in GenBank. The 16S-23S rRNA sequences matched those of P. syringae pv. syingae (Pss) (KF023189) and P. syringae pv. aptata (Psa) (AY342167.1) with 96 to 98% and 97 to 99% sequence identity, respectively. Also, the percent similarity of the 16S-23S rRNA sequences among the four isolates was >99% (KJ922021 to 24 for SB-1 to SB-4, respectively). The four test isolates also had ≤89 and ≤99% similarity with Pss and Psa, respectively, when tested with BIOLOG (Hayward, CA). In addition, four sugarbeet isolates along with a type strain of Psa (NCPPB 3539) were amplified using a PCR primer pair that detected the presence of the avrPphE gene, an avirulence gene present in Psa but absent in Pss (2). The type strain of Pss (NCPPB 1770) was not amplified using this primer pair. BOX-PCR analysis gave identical banding patterns for the four isolates as that of a type strain of Psa. In two independent experiments, 3-week-old seedlings of the sugar beet cv. Beta EGR099 (n = 10 seedlings/isolate/experiment) were spray-inoculated with a sterilized water suspension of 1 × 108 CFU/ml of each of the isolates. All of the inoculated seedlings developed symptoms (water-soaked lesions that developed into necrotic spots) 10 days after inoculation (DAI) in greenhouse conditions (~30°C and ~80% RH). All of the seedlings inoculated with the type strain of Psa also produced typical bacterial blight symptoms at 10 DAI. In contrast, five control seedlings inoculated with sterilized water remained asymptomatic, and target bacterial colonies were not re-isolated from the leaves of these plants. Bacterial colonies were re-isolated from symptomatic seedlings, and showed similar characteristics based on physiological tests, BIOLOG profile, BOX-PCR analysis, and positive amplification with the avrPphE PCR assay, which indicated that these strains were Psa. To our knowledge, this is the first report of Psa in sugarbeet in Georgia. The fact that a Psa strain was also isolated from a sugar beet seed lot (data not shown) suggested that the pathogen may have been introduced on contaminated seeds. Knowledge of the presence of Psa in the agro-ecosystem of Georgia may encourage scientists to implement integrated management practices for this pathogen. References: (1) C. Guasp et al. Int. J. Syst. Evol. Microbiol. 50:1629, 2000. (2) Y. Inoue and Y. Takikawa. Page 687 in: Presentations 6th Int. Conf. Pseudomonas syringae Pathovars and Related Pathogens, 2003. (3) R. A. Lelliot et al. J. Appl. Bacteriol. 29:470, 1966.

First Report of Bacterial Leaf Spot of Pumpkin Caused by Xanthomonas cucurbitae in Georgia, United States.

In August 2012, a commercial pumpkin (Cucurbita maxima L. cv. Neon) field in Terrell County, GA, had a disease outbreak that caused severe symptoms on leaves and fruits. Leaves displayed small (2 to 3 mm), angular, water-soaked, yellow lesions while fruits had small (2 to 3 mm), sunken, circular, dry lesions. The field exhibited 40% disease incidence with observable symptoms on fruits. In severe cases, fruit rots were also observed. Symptomatic leaves and fruits were collected from 25 pumpkin plants and isolations were made on both nutrient agar and yeast extract-dextrose-CaCO3 (YDC) agar medium (1). Xanthomonad-like yellow colonies were observed on both agar plates and colonies appeared mucoid on YDC. Suspect bacteria were gram-negative, oxidase positive, hydrolyzed starch and esculin, formed pits on both crystal violet pectate and carboxymethyl cellulose media, but were indole negative and did not produce nitrites from nitrates. Bacterial isolates also produced hypersensitive reactions on tobacco when inoculated with a bacterial suspension of 1 × 108 CFU/ml. Identity of the isolates were identified as genus Xanthomonas by using primers RST2 (5'AGGCCCTGGAAGGTGCCCTGGA3') and RST3 (5'ATCGCACTGCGTACCGCGCGCGA3') in a conventional PCR assay, which produced an 840-bp band. The 16S rRNA gene of five isolates was amplified using universal primers fD1 and rD1 (3) and amplified products were sequenced and compared using BLAST in GenBank. The nucleotide sequences (1,200 bp) of the isolates matched Xanthomonas cucurbitae (GenBank Accession AB680438.1), X. campestris (HQ256868.1), X. campestris pv. campestris (NR074936.1), X. hortorum (AB775942.1), and X. campestris pv. raphani (CP002789.1) with 99% similarity. PCR amplification and sequencing of a housekeeping gene atpD (ATP synthase, 720 bp) showed 98% similarity with X. cucurbitae (HM568911.1). Since X. cucurbitae was not listed in the BIOLOG database (Biolog, Hayward, CA), substrate utilization tests for three pumpkin isolates were compared with utilization patterns of Xanthomonas groups using BIOLOG reported by Vauterin et al. (4). The isolates showed 94.7, 93.7, and 92.6% similarity to the reported metabolic profiles of X. campestris, X. cucurbitae, and X. hortorum, respectively, of Xanthomonas groups 15, 8, and 2. However, PCR assay with X. campestris- and X. raphani-specific primers (3) did not amplify the pumpkin isolates, indicating a closer relationship with X. cucurbitae. Spray inoculations of five bacterial isolates in suspensions containing 1 × 108 CFU/ml on 2-week-old pumpkin seedlings (cv. Lumina) (n = five seedlings/isolate/experiment) under greenhouse conditions of 30°C and 70% RH produced typical yellow leaf spot symptoms on 100% of the seedlings. Seedlings (n = 10) spray-inoculated with sterile water were asymptomatic. Reisolated bacterial colonies from symptomatic seedlings displayed similar characteristics to those described above. Further confirmation of bacterial identity was achieved by amplifying and sequencing the 16S rRNA gene, which showed 98 to 99% similarity to X cucurbitae accessions in GenBank. To our knowledge, this is the first report of X. cucurbitae on pumpkin in Georgia. As this bacterium is known to be seedborne, it is possible that the pathogen might have introduced through contaminated seeds. References: (1) N. W. Schaad et al. Laboratory Guide for the Identification of Plant Pathogenic Bacteria, third edition. APS Press. St. Paul, MN, 2001. (2) Y. Besancon et al. Biotechnol. Appl. Biochem. 20:131, 1994. (3) Leu et al. Plant Pathol. Bull. 19:137, 2010. (4) Vauterin et al. Int. J. Syst. Bacteriol. 45:472, 1995.

A New Report of Xanthomonas cucurbitae Causing Bacterial Leaf Spot of Watermelon in Georgia, USA.

In June 2012, watermelon leaves (Citrullus lanatus (Thunb.) Matsum. & Nakai) were observed with angular, necrotic spots with chlorotic halos in a field in Telfair County, GA. The field exhibited 20 to 25% disease incidence with no observable symptoms on fruits. Isolations were made from foliar lesions of 30 leaves onto yeast extract-dextrose-CaCO3 (YDC) agar medium (3). Yellow-pigmented, Xanthomonas-like colonies were observed after 48-h incubation at 28°C from 100% of the samples. Bacteria harvested were gram-negative, oxidase-negative, indole-negative, hydrolyzed starch and esculin, and formed pits on crystal violet pectate and carboxymethyl cellulose media. The bacterial isolates did not produce nitrites from nitrates but produced hypersensitive reactions on tobacco upon inoculation with 1 × 108 colony-forming units (CFU)/ml. These characteristics are typical of members of the Xanthomonas campestris group. The genus Xanthomonas was confirmed using conventional PCR with genus-specific primers RST2 (5'AGGCCCTGGAAGGTGCCCTGGA3') and RST3 (5'ATCGCACTGCGTACCGCGCGCGA3'), which produced an 840-bp band. Universal primers fD1 and rD1 (1) were used to amplify the 16S rRNA gene from four isolates and amplified products were sequenced and BLAST searched in GenBank. The nucleotide sequences of the isolates showed 97 to 98% similarity to X. cucurbitae (Accessions AB680438.1 and Y10760), X. campestris (HQ256868.1), X. arboricola (JF835910.1), X. oryzae pv. oryzicola (CP003057.1) and X. campestris pv. raphani (CP002789.1). PCR amplification and sequencing of the atpD gene (ATP synthase, 720 bp) showed 99% similarity with X. cucurbitae when BLAST searched in GenBank (HM568911.1). X. cucurbitae was not present in the database of BIOLOG (Biolog, Hayward, CA); therefore, substrate utilization tests of three isolates were compared with substrate utilization patterns of Xanthomonas groups reported by Vauterin et al. (4). The watermelon isolates displayed 93.7, 89.5, and 89.5% similarity with the reported BIOLOG metabolic profiles of X. campestris, X. cucurbitae, and X. hortorum, respectively, of Xanthomonas groups 15, 8, and 2. However, none of the isolates were amplified using a conventional PCR assay with X. campestris pv. campestris and X. campestris pv. raphani-specific primers (2), indicating a closer relationship with X. cucurbitae. When 2-week old watermelon seedlings cv. Crimson sweet (n = 4/isolate/experiment) were inoculated by spraying with a suspension of 1 × 108 CFU/ml, 100% of the seedlings developed symptoms (water soaked angular lesions that developed into necrotic spots) 14 days after planting under greenhouse conditions (~30°C and ~70% RH). Ten control plants inoculated with sterile water remained asymptomatic. Bacterial colonies were reisolated from symptomatic seedlings that showed similar characteristics to those described above. The identity of isolated colonies was confirmed by amplifying and sequencing the 16S rRNA gene, which showed 97 to 98% similarity to X cucurbitae accessions in GenBank. To our knowledge, this is the first report of X. cucurbitae on watermelon in Georgia since the 1950s. References: (1) Y. Besancon et al. Biotechnol. Appl. Biochem. 20:131, 1994. (2) Leu et al. Plant Pathol. Bull. 19:137, 2010. (3) N. W. Schaad et al. Laboratory Guide for Identification of Plant Pathogenic Bacteria, 3rd ed. APS Press. St. Paul, MN, 2001. (4) Vauterin et al. Int. J. Syst. Bacteriol. 45:472, 1995.

Geographical Distribution and Survival of Iris yellow spot virus in Spiny Sowthistle, Sonchus asper, in Georgia.

Iris yellow spot virus (IYSV) has occurred in Georgia since 2003. IYSV is transmitted by onion thrips, Thrips tabaci. During a weed survey in the Vidalia onion-growing zone (VOZ), spiny sowthistle (Sonchus asper) was identified as a host for IYSV. Spiny sowthistle is widespread in Georgia, and this presented an opportunity to study the natural spread of IYSV and assess its potential role in IYSV epidemiology. From 2007 to 2009, during the spring season, 2,011 sowthistle samples were collected from various counties within and outside the VOZ. The samples were tested for IYSV infection by enzyme-linked immunosorbent assay and confirmed by reverse-transcription polymerase chain reaction and sequencing. IYSV sequences from sowthistle were 98 to 99% identical to onion IYSV sequences from onion originated from Georgia. By the third year, IYSV-infected sowthistle plants were found in 79% of the counties in the VOZ and in 61% of the sampled counties in all directions, except to the east of the VOZ. Furthermore, thrips-mediated transmission assays confirmed that T. tabaci can efficiently transmit IYSV from onion to sowthistle. Sowthistle also supported T. tabaci survival and reproduction. These findings demonstrate that sowthistle plants can serve as an IYSV inoculum source and as a thrips reservoir.

Acidovorax citrulli Seed Inoculum Load Affects Seedling Transmission and Spread of Bacterial Fruit Blotch of Watermelon Under Greenhouse Conditions.

Infested seed are typically the primary source of inoculum for bacterial fruit blotch (BFB) of cucurbits. An inoculum threshold of 1 infested seed per 10,000 seeds is widely used in seed health testing for Acidovorax citrulli. However, the influence of seed inoculum load on BFB seedling transmission has not been elucidated. In this study, watermelon seedlots (128 seeds/lot) containing one seed inoculated with A. citrulli at levels ranging from 1 × 101 to 1 × 107 CFU were used to investigate the effect of seed inoculum load on seedling transmission and spatiotemporal spread of BFB under greenhouse conditions. The relationship between A. citrulli seed inoculum load and frequency of BFB seedling transmission followed a sigmoidal pattern (R2 = 0.986, P = 0.0047). In all, 100 and 96.6% of seedlots containing one seed with 1 × 107 and 1 × 105 CFU of A. citrulli, respectively, transmitted the pathogen to seedlings; in contrast, the proportion of seedlots that yielded BFB-infected seedlings was lower for lots with one seed infested with 1 × 103 (46.6%) and 1 × 101 (16.7%) CFU of A. citrulli. The relationship between A. citrulli seed inoculum load and frequency of pathogen detection in seedlots using immunomagnetic separation combined with a real-time polymerase chain reaction assay also followed a sigmoidal pattern (R2 = 0.997, P = 0.0034). Whereas 100% of samples from seedlots (10,000 seeds/lot) with one seed containing ≥1 × 105 CFU tested positive for A. citrulli, 75% of samples from lots with one seed containing 1 × 103 CFU tested positive for the pathogen, and only 16.7% of samples with one seed containing 10 CFU tested positive. Because disease transmission was observed for lots with just one seed containing 10 A. citrulli CFU, zero tolerance for seedborne A. citrulli is recommended for effective BFB management. The seedling transmission experiments also revealed that temporal spread of BFB in 128-cell seedling trays increased linearly with A. citrulli inoculum load (r2 = 0.976, P = 0.0037). Additionally, the frequency of spatial spread of BFB from an inoculated seedling in the center of a planting tray to adjacent healthy seedlings over one-, two-, or three-cell distances was greater for lots with one seed infested with at least 1 × 105 CFU than for lots with one seed infested at lower inoculum loads (1 × 101 and 1 × 103 CFU/seed).

Effect of Transplant Age, Tobacco Cultivar, Acibenzolar-S-Methyl, and Imidacloprid on Tomato Spotted Wilt Infection in Flue-Cured Tobacco.

Tomato spotted wilt virus (TSWV) has become the most serious problem in flue-cured tobacco in Georgia and is a growing problem in other tobacco-growing areas in the United States. The effects of transplant age (6 to 10 weeks), tobacco cultivar (K-326 and NC-71), and preplant applications of acibenzolar-S-methyl (ASM) and the insecticide imidacloprid (IMD) were evaluated on levels of TSWV infection, number of symptomatic plants, and yield in field trials over 4 years. In all 4 years and in four of five trials, treatment of transplants with ASM and IMD resulted in fewer symptomatic plants, smaller areas under the disease progress curve (AUDPC), and higher yields compared with the nontreated controls. There were no consistent effects of transplant age or cultivar on number of symptomatic plants or systemic infections, AUDPC, or yield. Treatment of transplants with ASM and IMD can significantly reduce the number of symptomatic plants in the field and substantially increase yields and value per hectare.

First Report of Colletotrichum gloeosporioides Causing 'Twister Disease' of Onion (Allium cepa) in Georgia.

In the fall of 2007, onion seedlings with twisted and distorted leaves were observed in seedbeds in multiple fields in the Vidalia onion region of Georgia. Tests for viruses and bacteria were negative and chemical injury was deemed improbable because of disease distribution in the fields. Upon further investigation, fungal fruiting bodies were observed on the outside sheath of a few of the seedlings. Symptomatic plants were cut into 1-cm segments and surface sterilized in 70% ethanol for 3 min. After rinsing in sterile water, the segments were placed onto potato dextrose agar amended with tetracycline. The fungus isolated from symptomatic plants fit the description of Colletotrichum gloeosporioides (Penz.) Penz. & Sacc. Conidia were aseptate, cylindrical, and hyaline. Sequencing of the internal transcribed spacer region and a BLAST search in GenBank (99% sequence similarity to C. gloeosporioides accessions) confirmed the identification. Ten onion seedlings were spray inoculated with a suspension of 1 × 107 spores/ml until runoff, and four seedlings were inoculated with water as negative controls. Plants were bagged for 12 h to maintain high relative humidity. Five plants were placed in the greenhouse and five plants placed in a growth chamber at 22°C. All plants inoculated with C. gloeosporioides developed distorted and twisted leaves 3 weeks after inoculation in the growth chamber and 5 weeks after inoculation in the greenhouse. Night time temperatures in the greenhouse (15°C) were lower than those in the growth chamber (22°C). Seedlings inoculated with water showed no symptoms. The fungus was reisolated from symptomatic plants. C. gloeosporioides has been reported to cause a disease called twister on onion in tropical regions (1). The fall of 2007 was unusually warm with maximum temperatures reaching 26°C during the day. The pathogen is present on many crops in the United States, but to our knowledge, this is the first report of C. gloeosporioides causing twister disease of onion in the United States. In Nigeria and Brazil, yield losses as much as 100% were observed in fields with infected onions (1). The impact of infection on the growth of the transplants and subsequent yield in Vidalia onions is currently unknown. References: (1) J. P. Hill. Compendium of Onion and Garlic Diseases. 2nd ed. The American Phytopathological Society, St. Paul, MN, 2008.

First Report of Peanut mottle virus in Forage Peanut (Arachis glabrata) in North America.

Rhizoma peanut (Arachis glabrata Benth.) is a forage crop with increasing acreage (>10,500 ha) in the coastal plain region of the United States. Peanut mottle virus (PeMoV), a member of the family Potyviridae, is transmitted nonpersistently by aphids and seed-transmitted in A. hypogaea. Important hosts of the virus include peanut, soybean, and pea. During January of 2006 in Tifton, GA, immature rhizoma peanut plants identifier A176 with a lost PI number and PI 243334 exhibiting chlorotic ringspots were tested for viruses (potyviruses, Tomato spotted wilt virus [TSWV] and Cucumber mosaic virus [CMV]) frequently found in crops in the southeastern United States. All symptomatic plants tested were positive in the general potyvirus screen by indirect ELISA (Agdia, Inc., Elkhart, IN) and negative for TSWV and CMV. Leaves from two symptomatic plants of A176 and several asymptomatic genotypes were blotted onto FTA cards (Whatman Inc., Maidstone, UK) to bind viral RNA for preservation and processed according to the manufacturer's protocol. To determine the specific potyvirus identity, punch-outs from the FTA cards were used for reverse transcription (RT)-PCR (3) to test for PeMoV and Peanut stripe virus (PStV), both of which are found in A. hypogaea in Georgia. The forward primer (5'-GCTGTGAATTGTTGTTGAGAA-3') and the reverse primer (5'-ACAATGATGAAGTTCGTTAC-3') were specific for PeMoV and the forward primer (5'-GCACACACTTCTTGGC ATGG-3') and reverse primer (5'-GCATGCCCTCGCCATTGCAA-3') were specific for PStV (2). The primers are specific to the respective viral coat protein genes. Amplicons of the expected size (327 bp) were produced from symptomatic A176 and PI 243334 samples but not from the asymptomatic genotypes. The resulting PCR product was sequenced and a BLAST search in GenBank confirmed PeMoV (98 to 99% nt identity with Accession Nos. X73422 and AF023848). This finding is of significance because rhizoma peanuts are typically propagated by cuttings. Therefore, maintaining virus-free stock is critical. Although, PeMoV has been found in A. pintoi in Colombia (1), to our knowledge, this is the first report of PeMoV in rhizoma peanut (A. glabrata) peanut anywhere in the world. References: (1) A. A. Brandt et al. Plant Viruses Online: Descriptions and Lists from the VIDE Database, 2007. (2) R. G. Dietzgen et al. Plant Dis. 85:989, 2001. (3) R. D. Gitaitis et al. Phytopathology (Abstr.) 95(Suppl):S35, 2005.

First Report of Iris yellow spot virus in Spiny Sowthistle (Sonchus asper) in the United States.

Iris yellow spot virus (IYSV) is a member of the genus Tospovirus in the family Bunyaviridae. Its known host range is very limited, and the currently known hosts include onion, leek, lisianthus, and alstroemeria (2). The virus is vectored by onion thrips (Thrips tabaci). Onion (Allium cepa) is grown as a winter crop in Georgia from September to April and is the only known host commercially grown in the region. However, the virus has been found across the onion-growing region in the state every year since its first occurrence during 2003 (3). Consequently, the virus must oversummer in other host(s) or its insect vector. Accordingly, samples of weeds were collected in the vicinity of onion fields and cull piles in the Vidalia region and tested for the presence of IYSV by a double-antibody sandwich (DAS)-ELISA (Agdia, Inc., Elkhart, IN). One of three nonsymptomatic spiny sowthistle samples tested positive by ELISA for IYSV. Total RNA was extracted from the leaf using the RNeasy Plant Mini Kit (Qiagen, Valencia, CA) following the manufacturer's protocol. Two microliters were used for reverse transcription (RT)-PCR with the forward primer (5'-TCAGAAATCGAGAAACTT-3') and reverse primer (5'-TAATTATATCTATCTTTCTTGG-3') for the IYSV nucleocapsid gene (1). A band of the expected size (approximately 800 bp) was obtained and sequenced. The sequence from the sowthistle (GenBank Accession No. EU078327) matched IYSV sequences from Georgia and Peru in a BLAST search in GenBank (closest matches with Accession Nos. DQ838584, DQ838592, DQ838593, and DQ658242). This is to our knowledge, the first confirmed report of IYSV infecting spiny sowthistle. The distribution of IYSV in sowthistle and its role as an oversummering host for IYSV is currently an on-going study. References: (1) L. du Toit et al. Plant Dis. 88:222, 2004. (2) D. H. Gent et al. Plant Dis. 90:1468, 2006. (3) S. W. Mullis et al. Plant Dis. 88:1285, 2004.

First Report of Pantoea agglomerans Causing a Leaf Blight and Bulb Rot of Onions in Georgia.

In April 2006, sweet onions (Allium cepa) that were grown in Wayne County, GA displayed symptoms typical of either center rot caused by Pantoea ananatis or a foliar blight caused by Iris yellow spot virus (IYSV). After samples tested negative for IYSV by enzyme-linked immunosorbent assay and polymerase chain reaction, isolations were made from basal areas of leaves of infected plants where healthy and diseased tissues converged. All samples yielded yellow colonies on trypticase soy broth agar (TSBA) that were nonfluorescent when transferred to King's medium B. Four strains were characterized and tentatively identified as a Pantoea sp. by yellow pigmentation of colonies, oxidative and fermentative use of glucose, and lack of oxidase. However, the inability to produce indole from tryptophan, negative ice-nucleation activity, ability to reduce nitrate to nitrite, and the presence of phenylalanine deaminase were characteristics more typical of P. agglomerans than P. ananatis. Furthermore, all test strains utilized cellobiose, raffinose, lactose, gelatin, melibiose, and malonate. The identity of the bacterium was confirmed as P. agglomerans by BIOLOG (Hayward, CA). In addition, the 16S gene was amplified using universal primers (forward 5'-AGTTTGATCCTGGCTCAG-3' and reverse 5'-TACCTTGTTACGACTTCGTCCCA-3' (1) and sequenced. A BLAST search of the sequence against the NIH GenBank nucleotide library also confirmed the identity of the onion pathogen as P. agglomerans (97% identity) by having 8 of the top 10 bacteria providing significant alignments identified as P. agglomerans. The remaining two matches were uncultured bacteria from environmental samples. To confirm pathogenicity, two onion plants for each of the four test strains were inoculated with a turbid, aqueous bacterial suspension (~1 × 108 CFU ml-1) or sterile water in the lab (n = 8) and the field (n = 8). In addition, two plants each were inoculated with P. ananatis as a positive control and with a water blank and a nonpathogenic strain of P. agglomerans from peach (Png 86-2) as negative controls. All test strains of P. agglomerans produced severe blighting and withering of onion leaves in 4 days, while the water control and Png 86-2 were negative. Results were the same for both lab and field trials. Bacteria recovered from the plants infected with the test strains demonstrated the same characteristics of P. agglomerans as described above. Although P. agglomerans was originally reported as a pathogen of onion in South Africa (2), to the best of our knowledge, this is the first report of P. agglomerans causing a disease of onions in the United States. The long-term impact on the onion industry at this time is unknown. However, considering the close relationship of this organism with P. ananatis and the similarity of disease symptoms with those caused by center rot, there is potential that this bacterium could become established in the onion-growing area of Georgia and become part of a center rot 'complex'. References: (1) T. De Baere et al. J. Clin. Microbiol. 42:4393, 2004. (2) M. J. Hattingh and D. F. Walters. Plant Dis. 65:615, 1981.

First Report of Phakopsora pachyrhizi, the Causal Agent of Asian Soybean Rust, on Florida Beggarweed in the United States.

Phakopsora pachyrhizi Syd. & P. Syd., which causes Asian soybean rust (SBR), was observed on Florida beggarweed, Desmodium tortuosum (Sw) DC., in Attapulgus, GA during late October and early November 2005. Tan to brown lesions (<1.0 mm in diameter) consistent with symptoms of SBR (2) were observed on older leaves of several plants collected near an SBR-infected soybean trial. Dissection (40 to 60×) and compound microscopy (×200 to 400) revealed conical pustules and ellipsoid, echinulate urediniospores (average size 15 × 20 µm) on the abaxial leaf surface. Polymerase chain reaction (PCR) (primers Ppm1 and Ppa2) (1) was conducted on four samples to confirm identification of P. pachyrhizi or P. meibomiae. Three were positive for P. pachyrhizi, and one was negative for both species. Using morphology and real-time PCR, SBR was confirmed as P. pachyrhizi by the USDA/APHIS in Beltsville, MD. Six noninfected Florida beggarweed plants were transplanted to pots during December 2005 and grown at 22 to 24°C in a greenhouse. On 11 January 2006, a water suspension of urediniospores collected from SBR-infected soybeans (1 × 105 spores per ml) was spray inoculated on all leaves to almost runoff and incubated for 48 h in a plastic humidity chamber. Lesions, pustules, and urediniospores consistent with SBR (2) were observed on 3 February 2006. A PCR assay was conducted on six samples from the infected greenhouse plants and all were positive for P. pachyrhizi. Florida beggarweed is widespread in the southern United States and may serve as an additional overwintering source for P. pachyrhizi and a potential inoculum source for the soybean crop. References: (1) R. D. Fredrick et al. Phytopathology 92:217, 2002. (2) J. B. Sinclair and G. L. Hartman. Soybean rust. Pages 25-26 in: Compendium of Soybean Diseases. 4th ed. G. L. Hartman et al., eds. The American Phytopathological Society, St. Paul, MN, 1999.

First Report of Pinaceae in Georgia Naturally Infected with Tomato spotted wilt virus.

In October 2004, three pine tree seedlings included in an ongoing survey of annual weeds elicited positive reactions for Tomato spotted wilt virus (TSWV [family Bunyaviridae, genus Tospovirus]) using double assay sandwich-enzyme linked immunosorbent assay (DAS-ELISA) (Agdia Inc. Elkhart, IN). All the seedlings appeared healthy with no visible adverse effects from the virus. Over the next 12 months, an additional 1,326 samples of various pine species representing different growth stages were screened for TSWV. Samples were comprised of local populations of Pinus elliottii Engelm., P. taeda L., and P. palustris P. Mill., with the majority (n = 886) of samples being seedlings collected from southern Georgia. Along with the seedlings, needles, stem sections, and roots from saplings, as well as needles from mature trees, were screened for the virus. Of the trees sampled, 5.35% (n = 71) tested positive for TSWV, and of the seedlings 6.77% (n = 60) tested positive. The DAS-ELISA positive threshold was obtained using a figure of three times the average plus two standard deviations of healthy negative pine tissue control absorbance readings at 405 nm. A number of saplings testing positive (n = 6) were marked for further evaluation, and the needles from these saplings consistently screened positive for TSWV in subsequent testing. Furthermore, several samples were processed in modified burlese funnels to detect the possible presence of thrips. No thrips were ever identified in any of the burlese funnel collections. Different tissue types (needles, roots, stem sections, and reproductive organs) were screened, but the virus was only detected in needles. This suggests that local infections are only at feeding sites of viruliferous thrips. The known thrips vectors for TSWV are not considered to be pine feeders, and there is no indication that pine trees are a reproductive reservoir for any local thrips species. However, pine-feeding thrips may also feed on known weed hosts, thus pines could be a perennial reservoir. Mechanical inoculations from surface-sterilized infected pine needles onto known TSWV indicator plants (Nicotiana glutinosa L., N. benthamiana, and Emilia sonchifolia L. (DC)) were inconsistent. Successful transmission occurred 24% of the time. To further verify serological data, total RNA extracts of pine sap were purified and subjected to immunocapture-reverse transcriptase-polymerase chain reaction (IC-RT-PCR) using primers specific to the nucleocapsid gene of TSWV (1). IC-RT-PCR was used due to the inability to obtain useful total RNA from the pine tissues. This may be due to a secondary metabolite interfering with the total RNA extraction protocol. The IC-RT-PCR products were analyzed with electrophoresis using 0.01% ethidium bromide stain in a 0.8% agarose gel. Amplicons produced at the expected size (bp = 774) were considered positive for TSWV. Several were sequenced and were consistent with known, local TSWV isolates. There is no indication that TSWV is detrimental to pine trees, but considering the widespread distribution of the genus Pinus and the potential of serving as a reservoir of TSWV, it may play a role in the overall epidemiology of TSWV in southern Georgia. Reference: (1) R. K. Jain et al. Plant Dis. 82:900, 1998.

First Report of Onion (Allium cepa) Naturally Infected with Iris yellow spot virus in Peru.

Onions have become an important export crop for Peru during the last few years. The onions produced for export are primarily short-day onions and include Grano- or Granex-type sweet onions. The first of two growing seasons for onion in Peru occurs from February/March until September/October and the second occurs from September/October to December/January. Iris yellow spot virus (IYSV [family Bunyaviridae, genus Tospovirus]), primarily transmitted by onion thrips (Thrips tabaci), has been reported in many countries during recent years, including the United States (1,2). In South America, the virus was reported in Brazil during 1999 (3) and most recently in Chile during 2005 (4). During 2003, an investigation of necrotic lesions and dieback in onions grown near the towns of Supe and Ica, Peru led to the discovery of IYSV in this region. Of 25 samples of symptomatic plants collected from five different fields near Supe, 19 tested strongly positive and an additional three tested weakly positive for IYSV using double antibody sandwich-enzyme linked immunosorbent assay (DAS-ELISA) (Agdia Inc., Elkhart, IN). None of the samples tested positive for Tomato spotted wilt virus (TSWV). A number of onions with necrosis and dieback symptoms were also observed during 2004 and 2005. During September 2005, 25 plants with symptoms suspected to be caused by IYSV or TSWV in the Supe and Casma valleys were collected and screened for both viruses using DAS-ELISA. All plants screened were positive for IYSV. There was no serological indication of TSWV infection in these samples. The positive samples were blotted onto FTA cards (Whatman Inc., U.K.) to bind the viral RNA for preservation and processed according to the manufacturer's protocols. The presence of IYSV was verified by reverse transcription-polymerase chain reaction (RTPCR) using (5'-TCAGAAATCGAGAAACTT-3') and (5'-TAATTATATCTATCTTTCTTGG-3') as forward and reverse primers (1), respectively. The primers amplify the nucleocapsid (N) gene of IYSV, and the RT-PCR products from this reaction were analyzed with gel electrophoresis with an ethidium bromide stain in 0.8% agarose to verify the presence of this amplicon in the samples. Subsequent to the September 2005 sampling, 72 additional samples from regions in northern and southern Peru were analyzed in the same manner. The amplicons obtained were cloned, sequenced, and compared with known IYSV isolates for further verification. Onions have become a significant export crop for Peru, and more research is needed to determine the impact of IYSV on the Peruvian onion export crop. To our knowledge, this is the first report of IYSV in onion in Peru. References: (1) L. du Toit et al. Plant Dis. 88:222, 2004. (2) S. W. Mullis et al. Plant Dis. 88:1285, 2004. (3) L. Pozzer et al. Plant Dis. 83:345, 1999. (4) M. Rosales et al. Plant Dis. 89:1245, 2005.

First Report of Tomato spotted wilt virus in Soybean (Glycine max) in Georgia.

Tomato spotted wilt virus (TSWV) is a member of the family Bunyaviridae and has a wide host range including important crops such as tomato, pepper, tobacco, peanut, and onion. In areas of Georgia, soybean (Glycine max) is double cropped between two onion crops and as a rotation crop with peanuts. Soybeans do not show any TSWV symptoms, and therefore, have not been tested on a large scale for the virus. However, because symptomless weed and crop plants provide a reservoir for TSWV and the thrips vectors (2), a survey was conducted during the summer of 2005 to evaluate the occurrence of TSWV in soybean. The survey took place in seven counties in southern Georgia with field sizes ranging between 0.4 and 20 ha (1 and 50 acres). Soybean cultivars included Haskell, DP7220, DP6770, Pioneer 97B52, and Vigoro V622NRR. Of 848 randomly selected plants tested using the double-antibody sandwich enzyme-linked immunosorbent assay (DAS-ELISA) (Agdia, Inc., Elkhart, IN), 6.6% tested positive for TSWV. Plants testing positive ranged from seedling to the pod-setting stages. Leaves and roots of several plants tested positive, indicating a systemic infection. Soybean plants testing positive using ELISA were blotted onto FTA cards (Whatman Inc., Brentford, UK) to bind viral RNA for preservation, and the blotted samples were processed according to the manufacturer's protocol. Reverse transcription-polymerase chain reaction using punch-outs from the FTA cards and TSWV nucleocapsid gene specific forward and reverse primers (5'-TTAAGCAAGTTCTGTGAG-3' and 5'-ATGTCTAAGGTTAAGCTC-3'), respectively (4), confirmed the identity of TSWV. TSWV has been found in soybean in other parts of the world (1) but has only been reported in the United States in a survey from Tennessee (3). To our knowledge, this is the first report of the occurrence of TSWV in soybean in Georgia. The role soybean plays as a reservoir or green bridge for thrips and TSWV is currently unknown. References: (1) A. R. Golnaraghi et al. Plant Dis. 88:1069, 2004. (2) R. L. Groves et al. Phytopathology 91:891, 2001. (3) B. S. Kennedy and B. B. Reddick. Soybean Genet. Newsl. 22:197, 1995. (4) H. R. Pappu et al. Tob. Sci. 40:74, 1996.

First Report of Tomato spotted wilt virus in Leek (Allium porrum) in the United States.

Tomato spotted wilt virus (TSWV) is a member of the family Bunyaviridae. It has many important crop hosts including tomato, pepper, tobacco, peanut, and onion. In Georgia, Vidalia onions (Allium cepa), a close relative of leek, can be infected by TSWV and Iris yellow spot virus (IYSV), which is another thrips-vectored tospovirus (2). For this reason, samples of leek transplants with virus-like symptoms in one field at the border of Georgia and Florida were tested for the presence of TSWV and IYSV. The transplants had been grown from seed in a greenhouse at the same location. The sampled plants exhibited extended bleaching of leaf tips and necrotic lesions. These symptoms were also seen on onion plants infected with TSWV and IYSV. The only natural infections of leek with IYSV have been reported thus far only from Reunion Island (4) and Slovenia (1), but to our knowledge, TSWV has not been reported as a pathogen of leek. Green tissue near the necrotic lesions and bleached tips of one symptomatic leaf per plant was sampled and analyzed using a double-antibody sandwich enzyme-linked immunosorbent assay (DAS-ELISA) (Agdia, Inc., Elkhart, IN). Of 90 plants tested, eight were positive for TSWV and none were positive for IYSV. Leek samples testing positive using ELISA were blotted onto FTA cards (Whatman Inc., Brentford, UK) to bind viral RNA for preservation and then processed according to the manufacturer's protocol. Punch-outs from the FTA cards were used for reverse transcription polymerase chain reaction (RT-PCR) with the TSWV-specific forward primer (5'-TTAAGCAAGTTCTGTGAG-3') and reverse primer (5'-ATGTCTAAGGTTAAGCTC-3') (3) to confirm the identity of TSWV. The primers are specific to the viral nucleocapsid gene. An amplicon of the expected size (774 bp) was produced from TSWV ELISA-positive leek plants, but not from healthy controls. TSWV has been found in many plants worldwide, but to our knowledge this is the first report of TSWV infecting leek. The effect that TSWV has on leek production is currently unknown. References: (1) D. A. Benson et al. Nucleic Acids Res. 1:32 (Database issue):D23-6, 2004. (2) S. W. Mullis et al. Plant Dis. 88:1285, 2004. (3) H. R. Pappu et al. Tob. Sci. 40:74, 1996. (4) I. Robène-Soustrade et al. Online publication. New Dis. Rep. 11, 2005.

First Report of Vidalia Onion (Allium cepa) Naturally Infected with Tomato spotted wilt virus and Iris yellow spot virus (Family Bunyaviridae, Genus Tospovirus) in Georgia.

Vidalia onion is an important crop in Georgia's agriculture with worldwide recognition as a specialty vegetable. Vidalia onions are shortday, Granex-type sweet onions grown within a specific area of southeastern Georgia. Tomato spotted wilt virus (TSWV) has been endemic to Georgia crops for the past decade, but has gone undetected in Vidalia onions. Tobacco thrips (Frankliniella fusca) and Western flower thrips (Frankliniella occidentalis) are the primary vectors for TSWV in this region, and a number of plant species serve as reproductive reservoirs for the vector or virus. Iris yellow spot virus (IYSV), an emerging tospovirus that is potentially a devastating pathogen of onion, has been reported in many locations in the western United States (2,4). Thrips tabaci is the known vector for IYSV, but it is unknown if noncrop plants play a role in its epidemiology in Georgia. During October 2003, a small (n = 12) sampling of onions with chlorosis and dieback of unknown etiology from the Vidalia region was screened for a variety of viruses, and TSWV and IYSV infections were serologically detected. Since that time, leaf and bulb tissues from 4,424 onion samples were screened for TSWV and IYSV using double antibody sandwich-enzyme linked immunosorbent assay (DAS-ELISA) with commercial kits (Agdia Inc., Elkhart, IN). Samples were collected from 53 locations in the Vidalia region during the growing season between November 2003 and March 2004. Plants exhibiting stress, such as tip dieback, necrotic lesions, chlorosis or environmental damage were selected. Of these, 306 were positive for TSWV and 396 were positive for IYSV using positive threshold absorbance of three times the average plus two standard deviations of healthy negative onion controls. Positive serological findings of the onion tissues were verified by immunocapture-reverse transcription-polymerase chain reaction (IC-RT-PCR) for TSWV (3) and RT-PCR for IYSV (1). In both instances, a region of the viral nucleocapsid (N) gene was amplified. The PCR products were analyzed with gel electrophoresis with an ethidium bromide stain in 0.8% agarose. Eighty-six percent (n = 263) of the TSWV ELISA-positive samples exhibited the expected 774-bp product and 55 percent (n = 217) of the IYSV ELISA-positive samples exhibited the expected 962-bp product. The reduced success of the IYSV verification could be attributed to the age and deteriorated condition of the samples at the time of amplification. Thrips tabaci were obtained from onion seedbeds and cull piles within the early sampling (n = 84) and screened for TSWV by the use of an indirect-ELISA to the nonstructural (NSs) protein of TSWV. Of the thrips sampled, 25 were positive in ELISA. While the incidence of IYSV and TSWV in the Vidalia onion crop has been documented, more research is needed to illuminate their potential danger to Vidalia onions. References: (1) I. Cortês et al. Phytopathology 88:1276, 1998. (2) L. J. du Toit et al. Plant Dis. 88:222, 2004. (3) R. K. Jain et al. Plant Dis. 82:900, 1998. (4) J. W. Moyer et al. (Abstr.) Phytopathology 93(suppl.):S115, 2003.

Role of Blossoms in Watermelon Seed Infestation by Acidovorax avenae subsp. citrulli.

ABSTRACT The role of watermelon blossom inoculation in seed infestation by Acidovorax avenae subsp. citrulli was investigated. Approximately 98% (84/87) of fruit developed from blossoms inoculated with 1 x 10(7) or 1 x 10(9) CFU of A. avenae subsp. citrulli per blossom were asymptomatic. Using immunomagnetic separation and the polymerase chain reaction, A. avenae subsp. citrulli was detected in 44% of the seed lots assayed, despite the lack of fruit symptoms. Furthermore, viable colonies were recovered from 31% of the seed lots. Of these lots, 27% also yielded seedlings expressing bacterial fruit blotch symptoms when planted under conditions of 30 degrees C and 90% relative humidity. A. avenae subsp. citrulli was detected and recovered from the pulp of 33 and 19%, respectively, of symptomless fruit whose blossoms were inoculated with A. avenae subsp. citrulli. The ability to penetrate watermelon flowers was not unique to A. avenae subsp. citrulli, because blossoms inoculated with Pantoea ananatis also resulted in infested seed and pulp. The data indicate that watermelon blossoms are a potential site of ingress for fruit and seed infestation by A. avenae subsp. citrulli.

Transmission of Pantoea ananatis, Causal Agent of Center Rot of Onion, by Tobacco Thrips, Frankliniella fusca.

Center rot of onion, caused by Pantoea ananatis, was first reported on onion in Georgia in 1997 and has continued to reduce yields and cause postharvest losses. In a previous study, we developed a nondestructive assay that demonstrated an association between P. ananatis and approximately 10% of the tobacco thrips, Frankliniella fusca, surveyed. In this study, we report that all strains of P. ananatis, isolated from surface-sterilized, crushed thrips, were pathogenic when inoculated onto greenhouse-grown onion plants. Furthermore, when 6 to 12 thrips harboring populations of P. ananatis of 1 × 103 CFU ml-1 or greater were placed on healthy onion seedlings to feed, disease transmission occurred in 52% of the plants challenged. Incubation periods ranged from 4 to 9 days. Bacteria isolated from symptoms typical of those associated with center rot were characterized and identified as P. ananatis. In contrast, an equal number of plants remained healthy for up to 28 days after being exposed to the same number of tobacco thrips that were identified as being free of P. ananatis.

First Report of a Leaf Blight of Onion Caused by Xanthomonas spp. in Georgia.

In October of 2001 and 2002, a leaf blight was reported affecting Vidalia onion (Allium cepa) cvs. Pegasus and Sweet Vidalia, respectively, in one field each. Lesions on onion seedlings began as a water-soaked, tip dieback that gradually blighted the entire leaf. Symptoms on onion transplants appeared as elongated, water-soaked lesions that typically collapsed at the point of initial infection. In both cases, disease was very severe on seedlings, and disease incidence was 50% or more in both fields. Warm temperatures combined with overhead irrigation and above average rainfall likely enhanced the severity and spread of disease. Disease was not detected on more mature onions once cool, dry conditions occurred later in the season, and no significant economic loss occurred. Seed was tested from seed lots of the aforementioned cultivars and Xanthomonas spp. were not found. Diseased tissue was macerated in sterile, phosphate-buffered saline, and 10 µl of the resulting suspension was streaked on nutrient agar plates. Yellow-pigmented, gram-negative, rod-shaped bacteria were isolated routinely from diseased tissue. Bacteria were catalase-positive, cellulolytic, oxidase-negative, amylolytic, proteolytic, and utilized glucose in an oxidative manner. Analysis of whole cell, fatty acid methyl esters (FAME) using the Microbial Identification System (MIS, Sherlock version 3.1; MIDI, Inc., Newark, DE) identified four representative strains of the bacterium as a pathovar of Xanthomonas axonopodis (similarity indices 0.75 to 0.83). Known Xanthomonas spp. from onion from Colorado and Texas (1,2) had similar FAME profiles when analyzed by the MIDI system. Onion plants were grown under greenhouse conditions for 2 months and inoculated by injecting the base of a quill with 1.0 ml of bacterial suspensions (1 × 107 CFU ml-1) of the Xanthomonas sp. isolated from Georgia, and negative controls were inoculated with 1 ml of sterile water. Disease symptoms developed on plants inoculated with bacterial suspensions in 4 to 7 days and Xanthomonas sp. was isolated from the lesions produced. Disease symptoms occurred when the same suspension was sprayed on onion foliage. No symptoms occurred on plants inoculated with 1 ml of sterile water. To our knowledge, this is the first report of Xanthomonas spp. affecting Vidalia onions. References: (1) T. Isakeit et al. Plant Dis. 84:201, 2000. (2) H. F. Schwartz and K. Otto. Plant Dis. 84:922, 2000.