Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 15 de 15
Filtrar
Mais filtros











Base de dados
Intervalo de ano de publicação
1.
Am J Trop Med Hyg ; 102(3): 494-496, 2020 03.
Artigo em Inglês | MEDLINE | ID: mdl-31912776

RESUMO

The brain drain of professionals from low- and middle-income countries (LMICs) to developed countries is well documented and partially due to the challenges faced by biomedical researchers to establish themselves back at home, after training abroad. These challenges may result in the loss of highly trained individuals from LMICs and reduce the availability of local expertise to develop/inform best practices in health care and to direct locally relevant research. The path of training of LMIC researchers in high-income countries is well documented. However, strategies for a successful reintegration of biomedical researchers back to their home research institutions in LMICs are less clear. We report observations of workshops addressing repatriation needs of researchers returning to their home countries after training abroad during the American Society of Tropical Medicine and Hygiene (ASTMH) 2017 and 2018 annual meetings. Strategies proposed include maintaining connections with the home research institution, ideally through collaborations, planning 18 months ahead before returning with grants applications submitted, and engaging in networking throughout the training period. In addition to presenting our observations, we hope to build a network to facilitate this process, compile resources, and identify expertise within the ASTMH to develop robust strategies to allow young biomedical researchers to flourish in LMICs.


Assuntos
Pesquisa Biomédica/economia , Pesquisa Biomédica/educação , Países em Desenvolvimento , Recursos em Saúde , Pesquisadores/educação , Medicina Tropical/educação , África Subsaariana , Escolha da Profissão , Atenção à Saúde , Humanos , América Latina , Medicina Tropical/economia
2.
Elife ; 92020 01 03.
Artigo em Inglês | MEDLINE | ID: mdl-31898935

RESUMO

The lack of diversity among faculty at universities and medical schools in the United States is a matter of growing concern. However, the factors that influence the career choices of underrepresented minority and female postdoctoral researchers have received relatively little attention. Here we report the results of a survey of 1284 postdocs working in the biomedical sciences in the US. Our findings highlight possible reasons why some underrepresented minority and female postdocs choose not to pursue careers in academic research, and suggest interventions that could be taken in the early stages of postdoctoral training to prevent this attrition of underrepresented groups.


Assuntos
Escolha da Profissão , Educação de Pós-Graduação/estatística & dados numéricos , Grupos Minoritários/estatística & dados numéricos , Pesquisadores/estatística & dados numéricos , Mulheres , Pesquisa Biomédica , Estados Unidos
3.
Curr Opin Infect Dis ; 32(5): 413-418, 2019 10.
Artigo em Inglês | MEDLINE | ID: mdl-31369419

RESUMO

PURPOSE OF REVIEW: Malaria threatens the lives of over 200 million individuals with the disease each year. Plasmodium falciparum is the predominant cause of severe malaria which may be lethal and result in neurocognitive sequelae despite appropriate treatment. We review recent advances regarding the pathophysiology of severe malaria and treatment recommendations for severe disease in the United States. RECENT FINDINGS: Infected red blood cell (iRBC) sequestration in microvascular beds is a critical factor in the development of severe malaria syndromes. Interactions between iRBC variant adhesive peptides and the endothelial protein C receptor (EPCR) result in perturbations of coagulation and cytopreservation pathways. Alterations in the protein C/EPCR axis are implicated in cerebral malaria, respiratory distress, and anemia. Brain MRIs reveal the posterior reversible encephalopathy syndrome in cerebral malaria patients. Transcriptomic analysis reveals commonalities in disease pathogenesis in children and adults despite differences in clinical presentation. US guidelines for severe malaria treatment currently recommend intravenous artesunate including in pregnant women and children. SUMMARY: Despite advances in our understanding of malarial pathogenesis much remains unknown. Antimalarial agents eradicate parasites but no treatments are available to prevent or ameliorate severe malaria or prevent disease sequelae. Further study is needed to develop effective adjunctive therapies.


Assuntos
Antimaláricos/administração & dosagem , Artesunato/administração & dosagem , Malária Falciparum/tratamento farmacológico , Malária Falciparum/fisiopatologia , Administração Intravenosa , Humanos , Estados Unidos
4.
J Biophotonics ; 12(1): e201800098, 2019 01.
Artigo em Inglês | MEDLINE | ID: mdl-29900690

RESUMO

Cerebral malaria (CM) is a severe complication of Plasmodium falciparum infection associated with impaired cerebral blood flow. Visualization of the eye vasculature, which is embryologically derived from that of the brain, is used clinically to diagnose the syndrome. Here, we introduce camera-phone laser speckle imaging as a new tool for in vivo, noncontact two-dimensional mapping of blood flow dynamics in the experimental cerebral malaria (ECM) murine model of Plasmodium berghei ANKA. In a longitudinal study, we show that the camera-phone imager can detect an overall decrease in the retinal blood-flow-speed (BFS) as ECM develops in P. berghei ANKA infected mice, with no similar change observed in uninfected control mice or mice infected with a non-ECM inducing strain (P. berghei NK65). Furthermore, by analyzing relative alterations in the BFS of individual retinal vessels during the progression of ECM, we illustrate the strength of our imager in identifying different BFS-change heterogeneities in the retinas of ECM and uninfected mice. The technique creates new possibilities for objective investigations into the diagnosis and pathogenesis of CM noninvasively through the eye. The camera-phone laser speckle imager along with measured spatial blood perfusion maps of the retina of a mouse infected with P. berghei ANKA-a fatal ECM model-on different days during the progression of the infection (top, day 3 after infection; middle, day 5 after infection; and bottom, day 7 after infection).


Assuntos
Lasers , Malária Cerebral/diagnóstico por imagem , Malária Cerebral/fisiopatologia , Imagem Molecular/instrumentação , Fluxo Sanguíneo Regional , Retina/diagnóstico por imagem , Retina/fisiopatologia , Animais , Matriz Extracelular/metabolismo , Camundongos
5.
Sci Rep ; 8(1): 13215, 2018 09 04.
Artigo em Inglês | MEDLINE | ID: mdl-30181651

RESUMO

Rotavirus and noroviruses are major causes of diarrhea. Variable rotavirus vaccination efficacy in Africa and Asia is multifactorial, including the diversity of circulating strains and viral co-infection. We describe a multiplexed assay that detects and genotypes viruses from stool specimens. It includes a one-step reverse transcriptase PCR reaction, a ligase detection reaction (LDR), then hybridization of fluorescent products to micro-beads. In clinical samples it detects rotavirus, caliciviruses (sapovirus and norovirus), mixed infections, and genotypes or genogroups of rotaviruses and noroviruses, respectively. The assay also has the capacity to detect hepatitis A. The assay was validated on reference isolates and 296 stool specimens from the US and Ghana. The assay was 97% sensitive and 100% specific. The genogroup was concordant in 100% of norovirus, and the genotype in 91% and 89% of rotavirus G- and P-types, respectively. Two rare rotavirus strains, G6P[6] and G6P[8], were detected in stool specimens from Ghana. The high-throughput assay is sensitive, specific, and may be of utility in the epidemiological surveillance for rare and emerging viral strains post-rotavirus vaccine implementation.


Assuntos
Diarreia/virologia , Fezes/virologia , Norovirus/genética , Rotavirus/classificação , Rotavirus/genética , Infecções por Caliciviridae/diagnóstico , Infecções por Caliciviridae/epidemiologia , Infecções por Caliciviridae/virologia , Criança , Diarreia/diagnóstico , Diarreia/epidemiologia , Técnicas de Genotipagem , Gana/epidemiologia , Humanos , Reação em Cadeia da Polimerase Multiplex , Norovirus/isolamento & purificação , Filogenia , Rotavirus/isolamento & purificação , Infecções por Rotavirus/diagnóstico , Infecções por Rotavirus/epidemiologia , Infecções por Rotavirus/virologia , Sapovirus/genética , Sapovirus/isolamento & purificação
6.
Emerg Infect Dis ; 22(5): 786-93, 2016 May.
Artigo em Inglês | MEDLINE | ID: mdl-27089479

RESUMO

Hispaniola is the only Caribbean island to which Plasmodium falciparum malaria remains endemic. Resistance to the antimalarial drug chloroquine has rarely been reported in Haiti, which is located on Hispaniola, but the K76T pfcrt (P. falciparum chloroquine resistance transporter) gene mutation that confers chloroquine resistance has been detected intermittently. We analyzed 901 patient samples collected during 2006-2009 and found 2 samples showed possible mixed parasite infections of genetically chloroquine-resistant and -sensitive parasites. Direct sequencing of the pfcrt resistance locus and single-nucleotide polymorphism barcoding did not definitively identify a resistant population, suggesting that sustained propagation of chloroquine-resistant parasites was not occurring in Haiti during the study period. Comparison of parasites from Haiti with those from Colombia, Panama, and Venezuela reveals a geographically distinct population with highly related parasites. Our findings indicate low genetic diversity in the parasite population and low levels of chloroquine resistance in Haiti, raising the possibility that reported cases may be of exogenous origin.


Assuntos
Malária Falciparum/epidemiologia , Malária Falciparum/parasitologia , Proteínas de Membrana Transportadoras/genética , Mutação , Plasmodium falciparum/genética , Proteínas de Protozoários/genética , Código de Barras de DNA Taxonômico , Geografia , Haiti/epidemiologia , História do Século XXI , Humanos , Malária Falciparum/história , Filogeografia , Plasmodium falciparum/classificação , Análise de Sequência de DNA
7.
PLoS One ; 10(9): e0138484, 2015.
Artigo em Inglês | MEDLINE | ID: mdl-26381398

RESUMO

CDC designated category A infectious agents pose a major risk to national security and require special action for public health preparedness. They include viruses that cause viral hemorrhagic fever (VHF) syndrome as well as variola virus, the agent of smallpox. VHF is characterized by hemorrhage and fever with multi-organ failure leading to high morbidity and mortality. Smallpox, a prior scourge, has been eradicated for decades, making it a particularly serious threat if released nefariously in the essentially non-immune world population. Early detection of the causative agents, and the ability to distinguish them from other pathogens, is essential to contain outbreaks, implement proper control measures, and prevent morbidity and mortality. We have developed a multiplex detection assay that uses several species-specific PCR primers to generate amplicons from multiple pathogens; these are then targeted in a ligase detection reaction (LDR). The resultant fluorescently-labeled ligation products are detected on a universal array enabling simultaneous identification of the pathogens. The assay was evaluated on 32 different isolates associated with VHF (ebolavirus, marburgvirus, Crimean Congo hemorrhagic fever virus, Lassa fever virus, Rift Valley fever virus, Dengue virus, and Yellow fever virus) as well as variola virus and vaccinia virus (the agent of smallpox and its vaccine strain, respectively). The assay was able to detect all viruses tested, including 8 sequences representative of different variola virus strains from the CDC repository. It does not cross react with other emerging zoonoses such as monkeypox virus or cowpox virus, or six flaviviruses tested (St. Louis encephalitis virus, Murray Valley encephalitis virus, Powassan virus, Tick-borne encephalitis virus, West Nile virus and Japanese encephalitis virus).


Assuntos
Febres Hemorrágicas Virais/diagnóstico , Reação em Cadeia da Polimerase Multiplex/métodos , Varíola/diagnóstico , Vírus da Varíola/isolamento & purificação , Vírus/isolamento & purificação , Febres Hemorrágicas Virais/virologia , Humanos , Varíola/virologia
8.
Methods Mol Biol ; 632: 141-57, 2010.
Artigo em Inglês | MEDLINE | ID: mdl-20217576

RESUMO

Infectious diseases account for between 14 and 17 million deaths worldwide each year. Accurate and rapid diagnosis of bacterial, fungal, viral, and parasitic infections is therefore essential to reduce the morbidity and mortality associated with these diseases. Classical microbiological and serological methods have long served as the gold standard for diagnosis but are increasingly being replaced by molecular diagnostic methods that demonstrate increased sensitivity and specificity and provide an identification of the etiologic agent in a shorter period of time. PCR/LDR coupled with universal array detection provides a highly sensitive and specific platform for the detection and identification of bacterial and viral infections.


Assuntos
Doenças Transmissíveis/diagnóstico , Doenças Transmissíveis/genética , Ligases/metabolismo , Análise de Sequência com Séries de Oligonucleotídeos/métodos , Reação em Cadeia da Polimerase/métodos , Doenças Transmissíveis/enzimologia , Humanos , Hibridização de Ácido Nucleico , Oligonucleotídeos/química , Oligonucleotídeos/genética , Oligonucleotídeos/metabolismo , Sistemas Automatizados de Assistência Junto ao Leito , Impressão , Controle de Qualidade
10.
Am J Trop Med Hyg ; 80(4): 541-6, 2009 Apr.
Artigo em Inglês | MEDLINE | ID: mdl-19346372

RESUMO

Damage to the cerebral microvasculature is a feature of cerebral malaria. Circulating endothelial progenitor cells are needed for microvascular repair. Based on this knowledge, we hypothesized that the failure to mobilize sufficient circulating endothelial progenitor cells to the cerebral microvasculature is a pathophysiologic feature of cerebral malaria. To test this hypothesis, we compared peripheral blood levels of CD34 (+)/VEGFR2(+) and CD34 (+)/CD133(+) cells and plasma levels of the chemokine stromal cell-derived growth factor 1 (SDF-1) in 214 children in Accra, Ghana. Children with cerebral malaria had lower levels of CD34 (+)/VEGFR2(+) and CD34 (+)/CD133(+) cells compared with those with uncomplicated malaria, asymptomatic parasitemia, or healthy controls. SDF-1 levels were higher in children with acute malaria compared with healthy controls. Together, these results uncover a potentially novel role for endothelial progenitor cell mobilization in the pathophysiology of cerebral malaria.


Assuntos
Células Endoteliais/citologia , Malária Cerebral/patologia , Células-Tronco/citologia , Antígeno AC133 , Antígenos CD/análise , Antígenos CD34/análise , Quimiocinas/genética , Quimiocinas/metabolismo , Criança , Pré-Escolar , Células Endoteliais/química , Feminino , Citometria de Fluxo , Regulação da Expressão Gênica , Gana/epidemiologia , Glicoproteínas/análise , Humanos , Lactente , Malária Cerebral/epidemiologia , Masculino , Peptídeos/análise , Células-Tronco/química , Receptor 2 de Fatores de Crescimento do Endotélio Vascular/análise
11.
Mol Biochem Parasitol ; 146(2): 163-72, 2006 Apr.
Artigo em Inglês | MEDLINE | ID: mdl-16439031

RESUMO

Development of sexual stage parasites within the mosquito vector is a crucial step in the transmission of Plasmodium parasites. The expression of the P25 and P28 proteins on the surface of Plasmodium parasites in the mosquito midgut is required for development and hence disease transmission. 3' gene-flanking sequences are essential for expression of these critical proteins but the nucleotide elements required are poorly defined. Transient gene transfection experiments using constructs containing deletions of the 3' gene-flanking region of the Plasmodium falciparum P25 homologue, pfs25, reveal that elements necessary for protein expression are within 315 nucleotides (nt) of the stop codon. A T-rich region 137-231 nt from the stop codon is required for expression. The nonamer AATAAAATG, 360 nt downstream from the stop codon, enhances expression by 51 percent. Using 3' RACE analysis, multiple polyadenylation sites from endogenous and plasmid-derived pfs25 transcripts were identified. Dissimilarities between the identified elements and those of metazoans support the hypothesis that definition of P25/28 3' gene regulatory processes may eventually permit the development of agents which block malaria transmission but are non-toxic to humans.


Assuntos
Regiões 3' não Traduzidas , Regulação da Expressão Gênica , Plasmodium falciparum/genética , Proteínas de Protozoários/genética , Sequências Reguladoras de Ácido Nucleico , Animais , Sequência de Bases , Genes Reporter , Luciferases de Vaga-Lume/análise , Luciferases de Vaga-Lume/genética , Dados de Sequência Molecular , Poliadenilação , Deleção de Sequência , Transfecção
12.
Mol Biochem Parasitol ; 142(1): 25-31, 2005 Jul.
Artigo em Inglês | MEDLINE | ID: mdl-15907558

RESUMO

Merozoite surface protein 1 (MSP 1) of Plasmodium falciparum has a major allelic dimorphism in the majority of its sequence, the origin and significance of which is obscure. Here, the cloning and sequencing of the msp1 gene from P. reichenowi (a chimpanzee parasite that is the nearest relative of P. falciparum) and P. gallinaceum (a malaria parasite of birds) is reported. P. reichenowi msp1 is most closely related to one allelic type (K1) of P. falciparum. The other P. falciparum major allelic type (MAD20) is very divergent from these sequences, although not as divergent as msp1 of P. gallinaceum. Assuming a date of 6 million years ago (mya) for the divergence of the P. falciparum K1 and the P. reichenowi msp1 genes (on the basis of previous estimates for these parasite species as well as host divergence times), the most recent common ancestor of the dimorphic region of msp1 would date to approximately 27mya. Thus, the P. falciparum msp1 dimorphism is confirmed as one of the oldest polymorphisms known with the exception of self-incompatibility S genes in Solanaceae. In contrast with the major allelic dimorphism, the polymorphisms present in the relatively conserved C terminus of P. falciparum msp1 appear to have arisen since the divergence of the P. falciparum and P. reichenowi msp1 genes.


Assuntos
Sequência de Bases , Evolução Molecular , Proteína 1 de Superfície de Merozoito/química , Plasmodium falciparum/genética , Plasmodium gallinaceum/genética , Plasmodium/genética , Alelos , Animais , Clonagem Molecular , Proteína 1 de Superfície de Merozoito/genética , Dados de Sequência Molecular , Filogenia , Polimorfismo Genético , Alinhamento de Sequência , Análise de Sequência de DNA
13.
Mol Biochem Parasitol ; 137(2): 239-45, 2004 Oct.
Artigo em Inglês | MEDLINE | ID: mdl-15383294

RESUMO

During metazoan development, 3' UTR signals mediate the time and place of gene expression. For protozoan Plasmodium parasites, the formation of ookinetes from gametes in the mosquito midgut is an analogous developmental process. Previous studies of the 3' UTR signals necessary for expression of Pgs28, the major surface protein of Plasmodium gallinaceum ookinetes, suggested that a 3' UTR T-rich region and DNA sequences containing an ATTAAA eukaryotic polyadenylation consensus motif were necessary for its expression. During metazoan development, U-rich elements may function in conjunction with eukaryotic polyadenylation consensus signals to mediate developmental protein expression. To define whether the putative Plasmodium elements were mediators of Pgs28 expression mutations of these nucleotide sequences were made in plasmid constructs. The effect of the mutations on Pgs28 expression was tested by the transient gene transfection of sexual stage P. gallinaceum parasites. These studies reveal that two different mutations of the ATTAAA motif, which alter gene expression in higher eukaryotes and yeast, do not alter the expression of Pgs28. However, the U-rich element, adjacent nucleotides UUUACAAAAUUGUUUUAACU and downstream nucleotides UAUAUAAAA are able to mediate expression to varying degrees. The organization and overlapping function of these elements appears to more closely resemble that of yeasts or plants than those of metazoans.


Assuntos
Antígenos de Protozoários/genética , Plasmodium gallinaceum/genética , Proteínas de Protozoários/genética , Regiões 3' não Traduzidas , Animais , Sequência de Bases , DNA de Protozoário/genética , Regulação da Expressão Gênica , Genes de Protozoários , Dados de Sequência Molecular , Plantas/genética , Plantas/metabolismo , Plasmodium gallinaceum/metabolismo , Processamento Pós-Transcricional do RNA , RNA Mensageiro/genética , RNA Mensageiro/metabolismo , RNA de Protozoário/genética , RNA de Protozoário/metabolismo , Saccharomyces cerevisiae/genética , Saccharomyces cerevisiae/metabolismo , Especificidade da Espécie
15.
Am J Trop Med Hyg ; 70(4): 408-11, 2004 Apr.
Artigo em Inglês | MEDLINE | ID: mdl-15100455

RESUMO

Two previous reviews summarized the New York Hospital experience with 110 cases of malaria from 1968 to 1990. We have extended these studies to include 59 cases of malaria seen from 1991 to 1999 and analyze trends over the past 30 years. Plasmodium falciparum remains the most common species, 38 (64%) of the 59 cases, with the majority of them, 34 (89%) of 38 cases, being acquired in Africa. Of the 59 cases, 22 (37%) were immigrants living in the United States who had visited their countries of origin. Only five (8%) of 59 patients reported using chemoprophylaxis. This represents a marked decrease from the previous reviews. None of the immigrants or their children used chemoprophylaxis. Diagnosis was prompt, and patients responded well to therapy. Complications of malaria were low and no deaths were reported, as was the case in the previous reviews. The low use of chemoprophylaxis, particularly among immigrants, is a major concern.


Assuntos
Malária Falciparum/epidemiologia , Malária Falciparum/parasitologia , Malária Vivax/epidemiologia , Malária Vivax/parasitologia , Plasmodium falciparum/crescimento & desenvolvimento , Plasmodium vivax/crescimento & desenvolvimento , Adolescente , Adulto , África/etnologia , Idoso , Animais , Ásia/etnologia , Quimioprevenção , Criança , Pré-Escolar , Emigração e Imigração/tendências , Feminino , Humanos , Masculino , Pessoa de Meia-Idade , Cidade de Nova Iorque/epidemiologia , Estudos Retrospectivos , Viagem/tendências
SELEÇÃO DE REFERÊNCIAS
DETALHE DA PESQUISA