Repair of triplex-directed DNA alkylation by nucleotide excision repair.

Triplex-forming oligonucleotides (TFOs) are being investigated as highly specific DNA binding agents to inhibit the expression of clinically relevant genes. So far, they have been shown to inhibit transcription from the HER-2/neu gene in vitro, whereas their use in vivo has been studied to a limited extent. This study uses a TFO-chlorambucil (chl) conjugate capable of forming site-specific covalent guanine adducts within the HER-2/neu promoter. We demonstrate that nucleotide excision repair (NER) represents a mechanism of cellular resistance to TFO-directed DNA alkylation. In vitro repair assays demonstrate that triplex-directed chl-guanine adducts are substrates for repair by NER competent cell extracts but not XP12BE cell extracts deficient in NER. The degree of repair is estimated by a ligation-mediated polymerase chain reaction with a pre-formed triplex in a plasmid transfected into repair competent cells, indicating that approximately 25% of the guanine adducts are removed after 24 h. These data indicate that guanine adducts from TFO-directed alkylation are a substrate for NER and that DNA repair is a significant barrier to the intracellular persistence of target gene binding by TFOs.

Quantitative reverse transcription-polymerase chain reaction to study mRNA decay: comparison of endpoint and real-time methods.

Four quantitative reverse transcription-PCR (RT-PCR) methods were compared to evaluate the time course of mRNA formation and decay. Mouse fibroblasts (NIH 3T3) transfected with the human beta-globin open reading frame/c-myc 3'-untranslated region chimeric gene under control of the c-fos promoter (fos-glo-myc) were used for serum-inducible transcription. The amount of fos-glo-myc mRNA, relative to beta-actin, was measured by quantitative, RT-PCR at various times following the addition of serum to serum-starved fibroblasts transfected with the chimeric gene. Both endpoint (band densitometry and probe hybridization) and real-time (SYBR green and TaqMan) PCR methods were used to assay the identical cDNA. The real-time methods produced a 4- to 5-log dynamic range of amplification, while the dynamic range of the endpoint assays was 1-log. The real-time and probe hybridization assays produced a comparable level of sensitivity that was considerably greater than band densitometry. The coefficient of variation from 22 replicate PCR reactions was 14.2 and 24.0% for the SYBR green and TaqMan detection, respectively, and 44.9 and 45.1% for the band densitometry and probe hybridization assays, respectively. The rank order for the values of r(2) obtained from the linear regression of the first-order mRNA decay plots was SYBR green > TaqMan > probe hybridization > band densitometry. Real-time PCR is more precise and displays a greater dynamic range than endpoint PCR. Among the real-time methods, SYBR green and TaqMan assays produced comparable dynamic range and sensitivity while SYBR green detection was more precise and produced a more linear decay plot than TaqMan detection.

3'-minor groove binder-DNA probes increase sequence specificity at PCR extension temperatures.

DNA probes with conjugated minor groove binder (MGB) groups form extremely stable duplexes with single-stranded DNA targets, allowing shorter probes to be used for hybridization based assays. In this paper, sequence specificity of 3'-MGB probes was explored. In comparison with unmodified DNA, MGB probes had higher melting temperature (T(m)) and increased specificity, especially when a mismatch was in the MGB region of the duplex. To exploit these properties, fluorogenic MGB probes were prepared and investigated in the 5'-nuclease PCR assay (real-time PCR assay, TaqMan assay). A 12mer MGB probe had the same T(m)(65 degrees C) as a no-MGB 27mer probe. The fluorogenic MGB probes were more specific for single base mismatches and fluorescence quenching was more efficient, giving increased sensitivity. A/T rich duplexes were stabilized more than G/C rich duplexes, thereby leveling probe T(m)and simplifying design. In summary, MGB probes were more sequence specific than standard DNA probes, especially for single base mismatches at elevated hybridization temperatures.

Antisense oligonucleotides containing modified bases inhibit in vitro translation of Leishmania amazonensis mRNAs by invading the mini-exon hairpin.

Complementary oligodeoxynucleotides (ODNs) that contain 2-aminoadenine and 2-thiothymine interact weakly with each other but form stable hybrids with unmodified complements. These selectively binding complementary (SBC) agents can invade duplex DNA and hybridize to each strand (Kutyavin, I. V., Rhinehart, R. L., Lukhtanov, E. A., Gorn, V. V., Meyer, R. B., and Gamper, H. B. (1996) Biochemistry 35, 11170-11176). Antisense ODNs with similar properties should be less encumbered by RNA secondary structure. Here we show that SBC ODNs strand invade a hairpin in the mini-exon RNA of Leishmania amazonensis and that the resulting heteroduplexes are substrates for Escherichia coli RNase H. SBC ODNs either with phosphodiester or phosphorothioate backbones form more stable hybrids with RNA than normal base (NB) ODNs. Optimal binding was observed when the entire hairpin sequence was targeted. Translation of L. amazonensis mRNA in a cell-free extract was more efficiently inhibited by SBC ODNs complementary to the mini-exon hairpin than by the corresponding NB ODNs. Nonspecific protein binding in the cell-free extract by phosphorothioate SBC ODNs rendered them ineffective as antisense agents in vitro. SBC phosphorothioate ODNs displayed a modest but significant improvement of leishmanicidal properties compared with NB phosphorothioate ODNs.

Solution structure of a highly stable DNA duplex conjugated to a minor groove binder.

The tripeptide 1,2-dihydro-(3 H )-pyrrolo[3,2- e ]indole-7-carboxylate (CDPI3) binds to the minor groove of DNA with high affinity. When this minor groove binder is conjugated to the 5'-end of short oligonucleotides the conjugates form unusually stable hybrids with complementary DNA and thus may have useful diagnostic and/or therapeutic applications. In order to gain an understanding of the structural interactions between the CDPI3minor groove binding moiety and the DNA, we have determined and compared the solution structure of a duplex consisting of oligodeoxyribonucleotide 5'-TGATTATCTG-3' conjugated at the 5'-end to CDPI3 and its complementary strand to an unmodified control duplex of the same sequence using nuclear magnetic resonance techniques. Thermal denaturation studies indicated that the hybrid of this conjugate with its complementary strand had a melting temperature that was 30 degrees C higher compared with the unmodified control duplex. Following restrained molecular dynamics and relaxation matrix refinement, the solution structure of the CDPI3-conjugated DNA duplex demonstrated that the overall shape of the duplex was that of a straight B-type helix and that the CDPI3moiety was bound snugly in the minor groove, where it was stabilized by extensive van der Waal's interactions.

Synthesis and reactivity of aryl nitrogen mustard-oligodeoxyribonucleotide conjugates.

A versatile method is described for preparing aryl nitrogen mustard-oligodeoxyribonucleotide (mustard-ODN) conjugates under anhydrous conditions. The chemistry uses DMSO soluble triethylammonium or tributylammonium salts of the ODNs. A G/A motif triplex forming ODN was chosen for study since it had been shown earlier to bind with high affinity and specificity to a duplex DNA target. A 5'-hexylamine derivative of this ODN was reacted with three different 2,3,5,6-tetrafluorophenyl ester derivatives of aryl nitrogen mustards which were designed to have different alkylation rates. An HPLC assay was used to determine reaction rates of these mustard-ODNs under various conditions. The reactivity of the mustard groups depended on chloride concentration and the presence of nucleophiles. Conjugation of mustards to G/A-containing ODNs decreased their aqueous stability. Hydrolysis and alkylation rates of these agents were consistent with reaction via an aziridinium intermediate. Rates of sequence specific alkylation within a triplex were determined by denaturing gel electrophoresis and shown to depend on inherent reactivity of the mustard group. The improved synthesis and chemical characterization of mustard-ODNs should facilitate their use as sequence specific alkylating agents and as probes for nucleic acid structure.

Minor groove DNA alkylation directed by major groove triplex forming oligodeoxyribonucleotides.

We describe sequence-specific alkylation in the minor groove of double-stranded DNA by a hybridization-triggered reactive group conjugated to a triplex forming oligodeoxyribonucleotide (TFO) that binds in the major groove. The 24 nt TFOs (G/A motif) were designed to form triplexes with a homopurine tract within a 65 bp target duplex. They were conjugated to an N 5-methyl-cyclopropapyrroloindole (MCPI) residue, a structural analog of cyclopropapyrroloindole (CPI), the reactive subunit of the potent antibiotic CC-1065. These moieties react in the DNA minor groove, alkylating adenines at their N3 position. In order to optimize alkylation efficiency, linkers between the TFO and the MCPI were varied both in length and composition. Quantitative alkylation of target DNA was achieved when the dihydropyrroloindole (DPI) subunit of CC-1065 was incorporated between an octa(propylene phosphate) linker and MCPI. The required long linker traversed one strand of the target duplex from the major groove-bound TFO to deliver the reactive group to the minor groove. Alkylation was directed by relative positioning of the TFOs. Sites in the minor groove within 4-8 nt from the end of the TFO bearing the reactive group were selectively alkylated.

Oligonucleotides containing 2-aminoadenine and 2-thiothymine act as selectively binding complementary agents.

A pair of complementary oligodeoxynucleotides (ODNs) uniformly substituted with 2-amino-adenine (A') in place of adenine and 2-thiothymine (T') in place of thymine did not hybridize to each other but did form very stable hybrids with unmodified complementary ODNs. These unusual properties were a consequence of the hydrogen-bonding properties of the two base analogs. Thermal denaturation studies of short duplexes which contained these bases demonstrated that the A'-T and A-T' doublets formed stable base pairs whereas the A'-T' doublet acted like a mismatch. Complementary ODNs substituted with these base analogs are referred to as SBC or selectively binding complementary ODNs. When used as a pair, these single-stranded ODNs invaded the ends of homologous duplexes and formed stable three-arm junctions under conditions where unmodified ODNs failed to give a product. SBC ODNs have a fundamental thermodynamic advantage in hybridizing to short segments of double-stranded nucleic acid and represent a new approach for the design of oligomeric probes and antisense agents. Many secondary structure features present in long single-stranded nucleic acids should be accessible to these reagents.

Structure-activity relationships of cytotoxic cholesterol-modified DNA duplexes.

Short DNA duplexes with cholesterol linked at the 3'-terminus of each strand have unique, selective cytotoxic properties. The structural requirements for biological activity were explored through chemical synthesis of analogs and testing in cultured hepatoma cells. Effects of modifications to the sequence, backbone, 3'-sterol, 3'-linker, and 5'-terminus were evaluated. Self-complementary 3'-modified oligodeoxynucleotide (ODN) 10-mers were prepared from solid supports bearing the modification and linker of interest. Any changes to the normal phosphodiester backbone were poorly tolerated. The presence of cholesterol or a closely related sterol was an absolute requirement for activity. The length and position of attachment of the linker to cholesterol was important, with longer linkers showing reduced activity. Large, lipophilic groups at the 5'-terminus gave reduced cytotoxicity and poor solubility properties. The short length and unique structure of these ODNs allowed efficient automated synthesis on a 400 mumol scale and simplified purification.

[Quantitative characteristics of modifying nucleic acids by alkylating oligonucleotide derivatives in the presence of oligonucleotide effectors]. / Kolichestvennye kharakteristiki modifikatsii nukleinovykh kislot alkiliruiushchimi porizvodnymi oligonukleotidov v presutstvii oligonukleotidnykh éffektorov.

Modification of the 26-meric DNA fragment d(TTGCCTTGAATGGGAAGAGGGTCATT) with 4-(N-2-chloroethyl-N-methylamino)benzyl-5'-phosphamide derivative of hexadeoxyribonucleotide d(pTTCCCA) was investigated in the presence of two bis-3',5-N-(2-hydroxyethyl)phenazinium derivatives of octadeoxyribonucleotides (effectors E1 and E2) forming complementary complexes with the target next to 3'- and 5'-ends of the reagent's recognition site, respectively. In the absence of effectors, G17 is predominantly modified. Some minor modification of G12, G13 and G14 was also observed. The association constant of the target with the reagent was calculated using the dependence of the modification extent on the initial concentration of the reagent and was found to be Kx = (2.16 +/- 0.38) x 10(4) M-1 at 25 degrees C. At the reagent concentration 5 x 10(-6) M the target modification was nearly absent. In the presence of E1 the modification extent of the 26-mer increased with its concentration to a plateau value of approximately 0.5. Quantitative treatment of this concentration dependence permitted to estimate the value of the product Ke1 alpha = (3.95 +/- 0.43) x 10(8) M-1, where alpha 1 is the cooperativity coefficient and Ke1 is the association constant of the target with E1. To determine alpha 1, the Ke1 value was measured by the gel retardation method and found to be (5.06 +/- 0.23) x 10(7) M-1. Consequently, alpha 1 approximately 8. Effector E2 is less efficient and permits to reach the plateau value only as low as 0.24. This may be due to the competition of the reagent and E2 for the reagent recognition site, since the latter is partially complementary to this site. The increase of the E2 concentration results in a decrease of the modification extent of G17 accompanied with an increase of the modification extent of G12-G14. Thus, in the conditions used the oligonucleotide effectors although increasing the duplex stability do not permit to achieve quantitative yields as it should be for reactions proceeding in quasi-equilibrium conditions.

[Recognition of uracil in DNA by uracil-DNA-glycosylase from human placenta]. / Uznavanie uratsila v sostave DNK uratsil-DNK-glikozilazoi iz plztsentycheloveka.

The affinity of different ligands (d(pA)n, d(pT)n, d(pA)nxd(pT)n, dU-containing oligonucleotides) to the uracil-DNA-glycosylase (UDG) from human placenta have been investigated. All used oligodeoxynucleotides were shown to be competitive inhibitors of uracil-DNA glycosylase toward to [3H]-uracil-DNA substrate. Minimal ligand capable to bind to the template site of the enzyme was shown to be nucleoside monophosphate (Ki(dTMP) = 30 mM, Ki(dAMP) = 10 mM). Ligand affinity increases by the factor f 1.28 and 1.36 (respectively for d(pT)n and d(pA)n) per added monomer unit according to the progression Ki[d(pN)n] = Ki(dNMP).(f)-g, where g- number of mononucleotide bases of the d(pA)n, d(pT)n. Linear dependences of -lgKi vs n have inflection point at n = 10. At n > 10 ligand affinity remain constant. Affinity of the complexes d(pA)n.d(pT)n were observed to have the analogues dependencies, but Ki was 3 fold lower than for d(pA)n with corresponding length. The Ki of duplexes containing noncomplementary residues have been determined. Insertion of dU-residues or other noncomplementary base into one of the chains of duplexes d(pA)n.d(pT)n leads to increasing of the affinity about 10-20 fold: d(pT)4(pU)(pT)5 x d(pA)10 (Ki = 6.0 MKM), d(pT)10 x d(pA)4(pU)(pA)5 (Ki = 3.0 MKM), d(pA)7(pU)(pA)7 x d(pT)7(pC)(pT)7(4.0 MKM), d(pA)7(pU)(pA)7 x d(pT)7(pG)(pT)7 (6.0 MKM), d(pA)7(pU)(pA)7 x d(pT)15 (7.0 MKM). On the basis of the data obtained the conclusion that UDG interacts with 10 mononucleotide units of DNA was reached. The contribution of 9 nonmodified base pairs of DNA into recognition of substrate containing modified base by the enzyme is about 3-4 orders of magnitude higher than the contribution of the modified base.

[Complementary-addressed photomodification of DNA-targets by arylazide and perfluoroarylazide oligonucleotide derivatives. IV. Photomodification of ss- and ds-DNA-fragments]. / Komplementarno-adresovannaia fotomodifikatsiia DNK-mishenei arilazidnymi i perftorarilazidnymi proizvodnymi oligonukleotidov. IV. Fotomodifikatsiia ss- i ds-DNK-fragmentov.

A highly efficient sequence-specific photomodification of single stranded (ss) and double stranded (ds) DNA fragments was carried out with hexadecathymidilate derivative, R-p(T)16(R--p-azidotetrafluorobenzamide) and 27-meric DNA fragments as a targets. [formula: see text] The main points of the modification were G7 and G24 for the ss target and G7 and G22 of purine- and pyrimidine-rich strands, respectively, for the ds DNA fragment. The photomodification extent was 60-77% for ss DNA and 10-53% for ds DNA depending on the reaction conditions: it increased in a buffer with a high ionic strength (1.0 M) and at a low temperature (4 degrees C) when the triplexes are more stable.

[Complementary-addressed photomodification of nucleic acids by arylazide and perfluoroarylazide oligonucleotide derivatives. III. Oligonucleotide reagents with a photoactive group at the end or inside the chain; tandem reagents]. / Komplementarno-adresovannaia fotomodifikatsiia nukleinovykh kislot arilazidnymi i perftorarilazidnym proizvodnymi oligonukleotidov. III. Oligonukleotidnye reagenty s fotoaktivnoi gruppoi na kontse ili vnutri tsepi; tandemy reagentov.

Photomodification of target oligonucleotides with reagents bearing p-azidotetrafluorobenzamide group at various positions of the oligonucleotide address was investigated. The photoactive group was attached to the 5'- or 3'-terminal phosphate or at the C5-position of a deoxyuridine residue at the 5'-end or inside the oligonucleotide chain. The reagents with the internal photoactive group modified the target with 50-55% efficiency (fraction of covalent adducts reagent-target), whereas the derivatives with a terminal reactive group were more effective (70%). The main point of the modification was the guanosine residue of the target which located near to the photoactive group and was not involved into the duplex formation. Tandems of reagents which are complementary to neighbouring sites of the target modify predominantly the same guanosine residue, with up to 80% extent.

Oligo(A), oligo(TG), and Alu repeats of DNA in chromatin are available for sequence-specific chemical modification with oligodeoxynucleotide derivatives.

Reaction of 4-(N-2-chloroethyl-N-methylamino) benzylphosphamides of oligonucleotides, which are targeted to the poly(A), poly(TG), and Alu repeats of eukaryotic DNA in chromatin and isolated nuclei from HeLa cells, has been investigated. It was found that the reagents alkylate DNA and some proteins due to specific complex formation. The affinity character of the reaction was proved by the fact that free corresponding oligonucleotides taken in excess or preliminary treatment of chromatin with S1 nuclease both prevent the biopolymers from the modification. Deproteinated DNA from the same cells does not react with oligonucleotide derivatives. This suggests that the chromatin DNA must have some structural features allowing oligonucleotide binding. Reactivity may be attributed to the existence of strongly negative supercoiled DNA regions containing single-stranded sequences or regions where DNA can unwind in the presence of complementary oligonucleotides. Results obtained suggest that in eukaryotic chromatin there are open DNA sequences available for affinity modification with oligonucleotide derivatives not only due to formation of triple helixes.

[Recognition of T-T cyclobutane pyrimidine dimers in the form of primers by DNA polymerases]. / Uznavanie DNK-polimerazami T-T tsiklobutanovykh pirimidinovykh dimerov v sostave praimerov.

A study was made of the efficiency of primer conversion catalyzed by human placenta DNA polymerase on the length of primer. The dependence of -log Kd and Vmax on the number of mononucleotide units (n) of primer were shown to be linear up to n <--> 10. Each mononucleotide unit of the primer enhanced its affinity by a factor of 2.3 and the maximal polymerization rate by a factor of 1.3. For the first time estimation was made for the contribution of replication enzymes: human placenta DNA polymerase and E. coli DNA polymerase I (as well as AMV reverse transcriptase) to a decrease in the amount of T-T dimers in DNA emerging after UV- or gamma-irradiation. The efficiency of elongation of the d(pT)10 primer was shown to decrease with an increase in T-T dimers in the primer. When the d(pT)10 primer contains about 2.6 T-T dimers per molecule, the efficiency of its elongation decreases by a factor of 8-18.

[Inhibition of reproduction of the human immunodeficiency virus by sense and antisense oligodeoxynucleotides]. / Ingibirovanie reproduktsii virusa immunodefitsita cheloveka smyslovymi i antismyslovymi oligodezoksinukleotidami.

Inhibitory effects on human immunodeficiency virus (HIV) reproduction on lymphoid cell line MT-4 were characterized for antisense and sense oligodeoxynucleotides. It was established that antisense oligonucleotide pCGTAGTTCGTCGAGGTCCGT (MP-20) (ID50 = 0.1 microM) is a more effective HIV inhibitor than the previously described pTGGCGTACTCACCAGTCGCCGC (DSS-22) (ID50 = 4.7 microM) and pTTTTTTTTTTTTTTTT (PA-16) (ID50 = 8.0 microM). A sense oligonucleotide pGCATCAAGCAGCTCCAGGCA (PM-20) (ID50 = 0.5 microM) complementary to the region of the start of translation of the open reading frame on the (+)-chain virus DNA was also investigated. Specificity of the anti-HIV-I action of oligonucleotides was confirmed by experiments with HIV-II.

[In vitro suppression of translation of tick-borne encephalitis virus RNA using antisense nucleotides]. / Podavlenie transliatsii in vitro fragmentov RNK virusa kleshchevogo éntsefalita s pomoshch'iu antismyslovykh nukleotidov.

Effect of antisense oligodeoxyribonucleotides on in vitro translation of RNAs corresponding to fragments of the tick-borne encephalitis virus genome has been investigated. Sequences optimal for oligonucleotide binding and translation arrest have been identified. The most efficient oligonucleotide (17-mer) at a concentration of 2.5 microM completely arrests translation of the RNA coding for the NS3 protein.

[Structure of a single-stranded DNA target as a factor influencing the effectiveness of its modification with a complementary reagent]. / Stroenie odnotsepochechnoi DNK-misheni kak faktor, vliiaiushchii vliiaiushchii na éffektivnost' ee modifikatsii v komplekse s komplementarnym reagentom.

Site directed alkylation of three oligonucleotide targets: 41-mer (hairpin structure), 22-mer (loop part of this hairpin) and 10-mer (part of the loop) with 5'-p-(N-2-chloroethyl-N-methylamino)benzylamides of oligonucleotides complementary to the loop region was studied. Thermodynamic parameters of the interaction were estimated using the dependence of the limit modification extent on the reagent concentration at different temperatures. The stability of the complex increases much in the set: 302-mer carrying the above hairpin, 41-mer, 22-mer; data on 22-mer and 10-mer being almost identical. This indicates significant influence of the loop supporting structure on the interaction with antisense reagents.