The root-knot nematode calreticulin Mi-CRT is a key effector in plant defense suppression.

Root-knot nematodes (RKN) are obligate biotrophic parasites that settle close to the vascular tissues in roots, where they induce the differentiation of specialized feeding cells and maintain a compatible interaction for 3 to 8 weeks. Transcriptome analyses of the plant response to parasitic infection have shown that plant defenses are strictly controlled during the interaction. This suggests that, similar to other pathogens, RKN secrete effectors that suppress host defenses. We show here that Mi-CRT, a calreticulin (CRT) secreted by the nematode into the apoplasm of infected tissues, plays an important role in infection success, because Mi-CRT knockdown by RNA interference affected the ability of the nematodes to infect plants. Stably transformed Arabidopsis thaliana plants producing the secreted form of Mi-CRT were more susceptible to nematode infection than wild-type plants. They were also more susceptible to infection with another root pathogen, the oomycete Phytophthora parasitica. Mi-CRT overexpression in A. thaliana suppressed the induction of defense marker genes and callose deposition after treatment with the pathogen-associated molecular pattern elf18. Our results show that Mi-CRT secreted in the apoplasm by the nematode has a role in the suppression of plant basal defenses during the interaction.

[Endotracheal tube cuff and nitrous oxide: bench evaluation and assessment of clinical practice]. / Sondes d'intubation et protoxyde d'azote : étude sur banc et évaluation de la pratique clinique.

OBJECTIVE: To evaluate the risk of over-inflation of endotracheal tube cuffs (ETC) when used with nitrous oxide (N(2)O); to assess the rate of under and over-inflation of ETC when they are inflated without a manometer; to survey anesthesiologists about how they prevent these risks. METHODS: Nine types of endotracheal tube were studied on bench using various N(2)O concentrations; airway pressure levels and two sizes of trachea. Then, the rate and magnitude of over and under inflation pressure of ETC was assessed in our clinical practice. Finally, a national survey assessed how anesthesiologists prevented misuse of endotracheal tube with N(2)O. RESULTS: Pressure in ETC rose sharply using N(2)O, up to more than 40 cmH(2)O in six over nine tube types. Only two tube types (Mallinckrodt Hi-Lo Brandt and Lanz) were immune regarding N(2)O. Pratice study showed that ETC over inflation (>30 cmH(2)O) and under inflation (<20 cmH(2)O) was observed in 50 and 31 % of patients, respectively when cuff was inflated without a manometer. In France, a minority of anesthesiologists inflated ETC with a manometer (41 %) because in 61 % of theatres only manometers were available. CONCLUSION: There are risks induced by the use of N(2)O with tracheal tubes. This study provides data to sensitize users to these risks.

Cellular and molecular characterization of Phytophthora parasitica appressorium-mediated penetration.

Data on plant pathogenic oomycetes are scarce and little is known about the early events leading to the onset of infection. The aim of this work was to analyze the penetration process of the soil-borne plant pathogen Phytophthora parasitica, which has a wide host range. Here, we performed a cytological analysis of the colonization of the first plant cell and developed an inoculation assay for characterizing the entire penetration process through cellular and molecular analyses. We showed that P. parasitica infects roots by producing a specialized structure, the appressorium. We produced the first cDNA library for the penetrating stage of a Phytophthora species and showed it to be highly enriched in pathogenicity-related sequences. These included coding sequences for many cell-degrading enzymes, effectors such as RXLR-containing proteins and proteins involved in protection against plant defense responses. Characterization of the appressorium cDNA library and identification of genes overrepresented early in P. parasitica infection provided us with an unprecedented opportunity to decipher the molecular mechanisms involved in penetration of the plant cells during the initiation of infection by a soil-borne oomycete.

The tetraspanin BcPls1 is required for appressorium-mediated penetration of Botrytis cinerea into host plant leaves.

Animal tetraspanins are membrane proteins controlling cell adhesion, morphology and motility. In fungi, the tetraspanin MgPls1 controls an appressorial function required for the penetration of Magnaporthe grisea into host plants. An orthologue of MgPLS1, BcPLS1, was identified in the necrotrophic fungal plant pathogen Botrytis cinerea. We constructed a Bcpls1::bar null mutant by targeted gene replacement. Bcpls1::bar is not pathogenic on intact plant tissues of bean, tomato or rose, but it infects wounded plant tissues. Both wild type and Bcpls1::bar differentiate appressoria on plant and artificial surfaces, a process involving an arrest of polarized growth, apex swelling and its cell wall reinforcement. Although wild-type appressoria allowed the penetration of the fungus into the host plant within 6-12 h, no successful penetration events were observed with Bcpls1::bar, suggesting that its appressoria are not functional. An eGFP transcriptional fusion showed that BcPLS1 was specifically expressed in conidia, germ tubes and appressoria during host penetration. Our results indicate that BcPLS1 is required for the penetration of B. cinerea into intact host plants. The defect in pathogenicity of Bcpls1::bar also demonstrates that functional B. cinerea appressoria are required for a successful penetration process. As Bcpls1::bar and Mgpls1 Delta::hph penetration defects are similar, fungal tetraspanins are likely to be required for an essential appressorial function widespread among fungi.

A new class of tetraspanins in fungi.

Tetraspanins are animal proteins involved in membrane complexes that are involved in cell adhesion, differentiation, and motility. The PLS1 gene from rice blast fungus Magnaporthe grisea encodes a protein (Pls1p) structurally related to tetraspanins that is required for pathogenicity. In Botrytis cinerea public sequences, we identified an EST homologous to PLS1. Using degenerated oligonucleotides, we amplified sequences homologous to PLS1 in fungi Colletotrichum lindemuthianum and Neurospora crassa. Analysis of N. crassa and M. grisea genome sequences revealed the presence of a single tetraspanin gene. Thus, fungi differ from animals, which contain between 20 and 37 paralogous tetraspanin genes. Fungal proteins encoded by BcPLS1, ClPLS1, and NcPLS1 display all the structural hallmarks of tetraspanins (predicted topology with four transmembrane domains, extra- and intracellular loops; conserved cysteine-based patterns in second extracellular loop). Phylogenetic analysis suggests that these genes define a new family of orthologous genes encoding fungal-specific tetraspanins.

Molecular characterisation and polymorphism of MinLm1, a minisatellite from the phytopathogenic ascomycete Leptosphaeria maculans.

A sequence-characterised amplified region marker was identified in the phytopathogenic fungus Leptosphaeria maculans, which generated a single-banding pattern corresponding to six alleles showing size polymorphism between L. maculans field isolates. The size polymorphism was due to 2-7 tandem repeats of the 23-bp motif 5' TCTTACTTACATACACACCTCCC 3'. The repeated sequence, termed MinLm1, shares many features specific to minisatellites, e.g. a very strong G/C strand asymmetry, the presence of 6-bp direct repeats at both ends of the sequence and its occurrence in a region rich in microsatellites such as (CT)n, (ATG)n, (GTG)n and (CAT)n. MinLm1 shows a very high degree of conservation of the bases from one repeat to another and from one isolate to another (percent match range: 99.6-100%), whatever their geographical or temporal relatedness. MinLm1 is a single-locus minisatellite located on chromosomes sized 2.79 Mb and 2.48 Mb, of L. maculans isolates a.2 and H5, respectively. In agricultural populations of L. maculans, two alleles of MinLm1 were prevalent, corresponding to 2x and 5x repeats of the core motif. Differences in allele frequencies were observed in some cropping conditions, suggesting that MinLm1 is an informative marker for epidemiological studies of the pathogen.

PLS1, a gene encoding a tetraspanin-like protein, is required for penetration of rice leaf by the fungal pathogen Magnaporthe grisea.

We describe in this study punchless, a nonpathogenic mutant from the rice blast fungus M. grisea, obtained by plasmid-mediated insertional mutagenesis. As do most fungal plant pathogens, M. grisea differentiates an infection structure specialized for host penetration called the appressorium. We show that punchless differentiates appressoria that fail to breach either the leaf epidermis or artificial membranes such as cellophane. Cytological analysis of punchless appressoria shows that they have a cellular structure, turgor, and glycogen content similar to those of wild type before penetration, but that they are unable to differentiate penetration pegs. The inactivated gene, PLS1, encodes a putative integral membrane protein of 225 aa (Pls1p). A functional Pls1p-green fluorescent protein fusion protein was detected only in appressoria and was localized in plasma membranes and vacuoles. Pls1p is structurally related to the tetraspanin family. In animals, these proteins are components of membrane signaling complexes controlling cell differentiation, motility, and adhesion. We conclude that PLS1 controls an appressorial function essential for the penetration of the fungus into host leaves.