Sugarcane Mosaic Distribution, Incidence, Increase, and Spatial Pattern in Louisiana.

Sugarcane mosaic is a historically important disease in Louisiana currently caused by sorghum mosaic virus (SrMV). Successful breeding for resistance reduced the disease to low incidence in commercial cultivars. However, mosaic was detected in experimental clone evaluations at multiple locations, leading to uncertainty concerning the current distribution and incidence in the state. Field surveys were conducted from 2016 to 2018 in breeding program yield trials and experimental clone seed cane increase fields. Mosaic symptomatic plants were observed in a newly released cultivar, HoCP 09-804, in three of five production areas, with incidences ranging from 0 to 10%. Mosaic also was observed in nine additional experimental clones. Single leaf samples were tested for SrMV using reverse transcription PCR. All symptomatic samples and a low percentage (0.3%) of asymptomatic samples tested positive for SrMV, confirming that it continues to be the causal species. Runs analysis detected aggregation of infected plants within at least 70% of rows in 94% of surveyed fields. The spatial pattern and geographical distribution of disease incidence suggested that infected seed cane was the source of the disease. Surveys conducted in the same fields of HoCP 09-804 through two subsequent crops detected disease incidence increases in some fields and decreases in the others in first ratoon, but observed incidence was lower compared with plant cane in all fields in second ratoon. The results indicated that disease increase owing to aphid transmission did not occur under the prevailing conditions.

Expression analysis of genes associated with sucrose accumulation in sugarcane (Saccharum spp. hybrids) varieties differing in content and time of peak sucrose storage.

Sucrose synthesis/accumulation in sugarcane is a complex process involving many genes and regulatory sequences that control biochemical events in source-sink tissues. Among these, sucrose synthase (SuSy), sucrose phosphate synthase (SPS), soluble acid (SAI) and cell wall (CWI) invertases are important. Expression of these enzymes was compared in an early (CoJ64) and late (BO91) maturing sugarcane variety using end-point and qRT-PCR. Quantitative RT-PCR at four crop stages revealed high CWI expression in upper internodes of CoJ64, which declined significantly in both top and bottom internodes with maturity. In BO91, CWI expression was high in top and bottom internodes and declined significantly only in top internodes as the crop matured. Overall, CWI expression was higher in CoJ64 than in BO91. During crop growth, there was no significant change in SPS expression in bottom internodes in CoJ64, whereas in BO91 it decreased significantly. Apart from a significant decrease in expression of SuSy in mature bottom internodes of BO91, there was no significant change. Similar SAI expression was observed with both end-point and RT-PCR, except for significantly increased expression in top internodes of CoJ64 with maturity. SAI, being a major sucrose hydrolysing enzyme, was also monitored with end-point PCR expression in internode tissues of CoJ64 and BO91, with higher expression of SAI in BO91 at early crop stages. Enzyme inhibitors, e.g. manganese chloride (Mn(++) ), significantly suppressed expression of SAI in both early- and late-maturing varieties. Present findings enhance understanding of critical sucrose metabolic gene expression in sugarcane varieties differing in content and time of peak sucrose storage. Thus, through employing these genes, improvement of sugarcane sucrose content is possible.

First Report of Orange Rust Caused by Puccinia kuehnii in Sugarcane in Louisiana.

In June 2012, lesions typical of rust were observed on sugarcane cultivar Ho 05-961 (a complex hybrid of Saccharum L. spp.) on a farm near Schriever, Louisiana. Incidence and severity of disease symptoms were low. Two types of pustules were observed on leaves of the infected plants. One pustule type was reddish-brown in color turning brown with age, characteristic of brown rust which has been observed in Louisiana since 1979 (2). The other pustule type was orange and did not turn brown with age. Urediniospore samples from the two pustule types were collected. The morphology of the urediniospores from the reddish-brown pustules was consistent with that described for Puccinia melanocephala Syd. & Syd., the fungus that causes brown rust of sugarcane, while the morphology of the urediniospores from the orange pustules was consistent with those described for P. kuehnii E.J. Butler, the causal organism of orange rust of sugarcane (3). Telia and teliospores were not observed. The identity of the two species of Puccinia causing the brown and orange rust lesions was verified using the species-specific quantitative PCR assays (1). Two DNA samples extracted from the pustules identified as P. kuehnii were independently subjected to PCR amplification using primers Pk1F and Pk1R (1) to yield a product from the rDNA that was then bidirectionally sequenced using the same primers. The resulting 480-nt sequences were identical to each other, and a BLAST search of GenBank revealed 100% identity to 19 previously reported isolates of P. kuehnii but not more than 89% similarity to any isolate of P. melanocephala (4). To our knowledge, this is the first report of orange rust in Louisiana. In the 4 months following the detection of orange rust, observations of the disease have been limited to Ho 05-961. Seed cane increase plots of this newly released cultivar were surveyed, and orange rust symptoms and urediniospores were detected in 17 of 38 (45%) fields. The incidence and severity of the disease remained low, and the distribution appeared to be limited to the southern portion of the Louisiana sugarcane production area. References: (1) N. C. Glynn et al. Plant Pathol. 59:703, 2010. (2) H. Koike. Plant Dis. 64:226, 1980. (3) C. C. Ryan et al. Page 189 in: Diseases of Sugarcane: Major Diseases. C. Ricaud et al., eds. Elsevier, Amsterdam, 1989. (4) E. V. Virtudazo et al. Mycoscience 42:447, 2001.

Molecular Variation of Sporisorium scitamineum in Mainland China Revealed by RAPD and SRAP Markers.

Sugarcane smut caused by Sporisorium scitamineum occurs worldwide, causing serious losses in sugar yield and quality. To study the molecular variation of S. scitamineum, 23 S. scitamineum isolates collected from the six primary sugarcane production areas in mainland China (Guangxi, Yunnan, Guangdong, Hainan, Fujian, and Jiangxi provinces) were assessed by random amplified polymorphic DNA (RAPD) and sequence-related amplified polymorphism (SRAP) markers. The results of RAPD, SRAP, and RAPD-SRAP combined analysis showed that, whereas the molecular variation of S. scitamineum was associated with geographic origin, there was no evidence of co-evolution between sugarcane and the pathogen. The results of RAPD, SRAP, or RAPD-SRAP combined analysis also did not provide any information about race differentiation of S. scitamineum. This suggests that the mixture of spores from sori collected from different areas should be used in artificial inoculations for resistance breeding and selection.

First Report of Sorghum mosaic virus Causing Mosaic in Miscanthus sinensis.

Miscanthus is being evaluated as a bioenergy feedstock because of its potentially significant biomass production, perennial habit, and lack of major diseases and pests. It is also a valuable parent in sugarcane breeding programs as a source of cold tolerance. In May 2010, mosaic symptoms were observed on a clone of Miscanthus sinenesis Anderss. maintained at the USDA, ARS, Sugarcane Research Unit. All plants of the Miscanthus clone in our germplasm collection are from vegetative cuttings of the original infected plant and show mosaic symptoms. Leaves from the ratoon of a single plant tested positive in a reverse transcription-PCR with the Potyvirus Group PCR Test (Agdia, Inc., Elkhart, IN) with two primer sets, Poty-F1/Poty-R1 and Poty-F2/Poty-R2. After sequencing the potyvirus amplicons, a BLAST search in GenBank revealed that these sequences had the highest identities (81 and 69%) with Sorghum mosaic virus (SrMV) at the nucleic acid level and a 72 and 95% similarity at the amino acid level. Extracts from the Miscanthus clone prepared by the indirect extraction buffer (Agdia) containing sodium carbonate also tested positive for potyvirus by indirect ELISA with the 'universal' potyvirus monoclonal antibody, PTY1. To our knowledge, this is the first report of SrMV on Miscanthus. The only other member of the genus Potyvirus reported on Miscanthus is Sugarcane mosaic virus (1,2). Mosaic caused by SrMV could become an economically important disease of Miscanthus if this crop is grown for bioenergy feedstock on large areas. An SrMV-infected Miscanthus crop could pose a threat to established crops of susceptible sugarcane and sorghum since the virus is transmitted in a nonpersistent manner by several aphids, as well as, contributing to geographic shifts of the pathogen. References: (1) B. O. Agindotan et al. J. Virol. Methods 169:119, 2010. (2) D.-L. Xu et al. Arch. Virol. 153:1031, 2008.

Early Detection of Leifsonia xyli subsp. xyli in Sugarcane Leaves by Real-Time Polymerase Chain Reaction.

A real-time, polymerase chain reaction (PCR) assay was developed for detecting Leifsonia xyli subsp. xyli in sugarcane leaf tissue. Real-time PCR assays were conducted on the youngest, fully expanded leaf of three cultivars collected bi-weekly from field nurseries between 11 April and 19 July 2005. L. xyli subsp. xyli infection was detected in leaves collected at all sampling dates, including those from 1-month-old plants on 11 April. Assays conducted on older, more rapidly growing plants (28 July and 21 October 2005) indicated that leaf position affects assay efficiency. Conventional PCR was less efficient than real-time PCR for detecting L. xyli subsp. xyli in leaf tissue. Real-time PCR was used to rank cultivars for susceptibility to L. xyli subsp. xyli infection based on the relative titer of L. xyli subsp. xyli in leaves of inoculated, 3- and 4-month-old greenhouse-grown plants. The ranking of cultivars by real-time PCR was in close agreement with the ranking determined by tissue-blot enzyme immunoassay performed on tissue from 7- to 9-month-old stalks.

A Genetic Shift in the Virus Strains that Cause Mosaic in Louisiana Sugarcane.

Leaf samples from 693 sugarcane plants showing mosaic symptoms were collected in 2001, 2002, and 2003 at 12 locations within the Louisiana sugarcane industry. Virus isolates associated with the diseased plants were identified using reverse-transcriptase polymerase chain reaction (RT-PCR) to distinguish between Sugarcane mosaic virus (SCMV) and Sorghum mosaic virus (SrMV). No SCMV strain was associated with any diseased plant collected during the survey. RT-PCR-based restriction fragment length polymorphism (RFLP) analysis showed that SrMV strains I, H, and M were associated with 67, 10, and 2% of the plants with mosaic symptoms, respectively. In previous surveys conducted between 1978 and 1995, over 90% of the plants sampled were infected with SrMV strain H. The remaining plants mostly were infected with SrMV strain I, except for an occasional sample with SrMV strain M. RT-PCR showed that approximately 13% of the samples collected between 2001 and 2003 were infected with SrMV, but the RFLP banding pattern did not match any described strain. Twelve plants were co-infected by two SrMV strains and two plants by three SrMV strains. No RT-PCR product was produced by either the SCMV- or the SrMV-specific RT-PCR primer set for 8% of the plants showing mosaic symptoms, suggesting that another virus may cause sugarcane mosaic in Louisiana.

Infectivity Titration for Assessing Resistance to Leaf Scald Among Sugarcane Cultivars.

Greenhouse experiments were conducted to determine potential of infectivity titration to evaluate resistance of sugarcane to leaf scald disease caused by Xanthomonas albilineans. In two experiments, single-bud cuttings were inoculated with suspensions containing 101, 105, or 108 CFU/ml of X. albilineans. The occurrence of symptoms was recorded every 15 days from 45 to 210 days after inoculation. At the final evaluation date, leaf vascular sap was plated onto selective medium to detect latent infections. ED50 (log10 of the bacterial concentration required to infect 50% of inoculated plants) was estimated for each cultivar based on probit analysis of cumulative infection frequency. Frequency of infected plants varied among inoculum doses and cultivars and resulted in ED50 values ranging from 3.0 to 12.3 and 3.1 to 9.8 in the first and second experiments, respectively. Good agreement between experiments was observed for ED50 values of individual cultivars. Differences in ED50 among cultivars agreed with field observations of natural disease incidence. Cultivar responses to leaf scald were compared based on the cumulative frequencies of death and recovery in symptomatic plants, and the frequencies of symptomatic plants observed at different evaluation dates for plants inoculated with 108 CFU/ml of X. albilineans. Good agreement between ED50 values and these responses was observed. Greenhouse inoculation tests using infectivity titration or just one inoculum concentration could provide an alternative to field tests for the assessment of sugarcane resistance to leaf scald.

Spread and Increase of Ratoon Stunting Disease of Sugarcane and Comparison of Disease Detection Methods.

The spread and increase of ratoon stunting disease (RSD) resulting from two mechanical harvests were compared in eight sugarcane cultivars at two locations. RSD spread and increase were detected in the ratoon crops grown after each harvest and varied among cultivars and locations. Disease spread and increase were greater in plants grown from stalks collected at the first harvest than in the first ratoon growth from the harvested field. RSD infection was determined using five disease detection methods: alkaline-induced metaxylem autofluorescence; microscopic examination of xylem sap; and dot blot, evaporative-binding, and tissue blot enzyme immunoassays. The tissue blot enzyme immunoassay was the most accurate RSD detection method. The dot blot and evaporative-binding enzyme immunoassays were the least sensitive for detection of RSD-infected stalks, and alkaline-induced metaxylem autofluorescence was least accurate for correct identification of noninfected stalks. The results indicate that disease spread and increase are variable even among cultivars susceptible to yield loss due to RSD, and the greatest threat of disease spread and increase occurs at planting.

Development of Polymerase Chain Reaction Primers Highly Specific for Xanthomonas albilineans, the Causal Bacterium of Sugarcane Leaf Scald Disease.

New primers were developed that greatly improved the specificity of the polymerase chain reaction (PCR) protocol for Xanthomonas albilineans, the causal agent of sugarcane leaf scald disease. Length-polymorphic PCR products, amplified under the current PCR protocol from the 16S-23S ribosomal DNA intergenic transcribed spacers (ITS) of X. albilineans and three unidentified sugarcane saprophytic bacterial species, were cloned and sequenced. Fourteen other nonredundant ITS sequences retrieved from the database were highly homologous to the sequence of X. albilineans. Two X. albilineans-specific PCR primers, namely, PGBL1 (5' CTT TGG GTC TGT AGC TCA GG) and PGBL2 (5' GCC TCA AGG TCA TAT TCA GC), were designed based on a multiple sequence alignment among these 18 sequences. These two primers permitted specific PCR amplification of a 288-bp DNA product from all 71 diverse X. albilineans strains tested. No amplification product was observed from any other bacterial species tested, including the three unidentified sugarcane saprophytes. The new PCR protocol has been routinely used to detect the leaf scald pathogen from infected sugarcane tissues.

A Polymerase Chain Reaction Protocol for the Detection of Clavibacter xyli subsp. xyli, the Causal Bacterium of Sugarcane Ratoon Stunting Disease.

A polymerase chain reaction (PCR) protocol was developed that specifically detected Clavibacter xyli subsp. xyli, the causal agent of sugarcane ratoon stunting disease. Generic PCR products from the intergenic transcribed spacer (ITS) region of 16S-23S ribosomal DNA of C. xyli subsp. xyli and C. xyli subsp. cynodontis were cloned and sequenced. Based on a multiple sequence alignment among these two sequences and other nonredundant highly homologous sequences from the database, two C. xyli subsp. xyli-specific PCR primers were designed, Cxx1 (5' CCGAAGTGAGCAGATTGACC) and Cxx2 (5' ACCCTGTGTTGTTTTCAACG). These two 20-mer oligonucleotides primed the specific amplification of a 438-bp DNA product from genomic DNA samples of 21 C. xyli subsp. xyli strains. Amplification was not observed with genomic DNA of one C. xyli subsp. cynodontis strain, five strains of four other Clavibacter species, and two strains of two Rathayibacter species. The 438-bp PCR product also was amplified directly from cultured C. xyli subsp. xyli cells and from C. xyli subsp. xyli-infected sugarcane vascular sap with a unique reaction buffer containing polyvinylpyrrolidone and ficoll. Extraction of genomic DNA was not necessary prior to PCR assay.

A Polymerase Chain Reaction Protocol for the Detection of Xanthomonas albilineans, the Causal Agent of Sugarcane Leaf Scald Disease.

A polymerase chain reaction (PCR) protocol was developed that amplified a 360-bp DNA product unique to Xanthomonas albilineans (Xa), the causal agent of sugarcane leaf scald disease. The assay utilizes previously described PCR primers that target the intergenic transcribed spacer (ITS) region between the 16S and 23S rRNA genes. Primer pair Ala4/L1 allowed amplification of a 360-bp DNA fragment from 71 Xa strains including representatives of serovars I, II, and III. Fragments of different sizes were also amplified from three unidentified saprophytic bacteria from sugarcane. Xa could be detected at a lower bacterial concentration with the PCR protocol than with a serological dot blot assay. With PCR, as little as 1.25 pg of Xa genomic DNA (125 fg if followed by Southern blot hybridization), or as few as 0 to 5 CFU of Xa per reaction were detected from infected sugarcane sap and leaf diffusate. Five CFU of Xa per reaction were detected from suspension culture. The PCR protocol provides a rapid, reliable, and economical tool for routine detection and identification of Xa.