Functional annotation of the animal genomes: An integrated annotation resource for the horse.

The genomic sequence of the horse has been available since 2009, providing critical resources for discovering important genomic variants regarding both animal health and population structures. However, to fully understand the functional implications of these variants, detailed annotation of the horse genome is required. Due to the limited availability of functional data for the equine genome, as well as the technical limitations of short-read RNA-seq, existing annotation of the equine genome contains limited information about important aspects of gene regulation, such as alternate isoforms and regulatory elements, which are either not transcribed or transcribed at a very low level. To solve above problems, the Functional Annotation of the Animal Genomes (FAANG) project proposed a systemic approach to tissue collection, phenotyping, and data generation, adopting the blueprint laid out by the Encyclopedia of DNA Elements (ENCODE) project. Here we detail the first comprehensive overview of gene expression and regulation in the horse, presenting 39,625 novel transcripts, 84,613 candidate cis-regulatory elements (CRE) and their target genes, 332,115 open chromatin regions genome wide across a diverse set of tissues. We showed substantial concordance between chromatin accessibility, chromatin states in different genic features and gene expression. This comprehensive and expanded set of genomics resources will provide the equine research community ample opportunities for studies of complex traits in the horse.

Another lesson from unmapped reads: in-depth analysis of RNA-Seq reads from various horse tissues.

In recent years, a vast amount of sequencing data has been generated and large improvements have been made to reference genome sequences. Despite these advances, significant portions of reads still do not map to reference genomes and these reads have been considered as junk or artificial sequences. Recent studies have shown that these reads can be useful, e.g., for refining reference genomes or detecting contaminating microorganisms present in the analyzed biological samples. A special case of this is RNA sequencing (RNA-Seq) reads that come from tissue transcriptomes. Unmapped reads from RNA-Seq have received much less attention than those from whole-genome sequencing. In particular, in the horse, an analysis of unmapped RNA reads has not been performed yet. Thus, in this study, we analyzed the unmapped reads originating from the RNA-Seq performed through the Functional Annotation of Animal Genomes (FAANG) project in the horse, using eight different tissues from two mares. We demonstrated that unmapped reads from RNA-Seq could be easily assembled into transcripts relating to many important genes present in the sequences of other mammals. Large portions of these transcripts did not have coding potential and, thus, can be considered as non-coding RNA. Moreover, reads that were not mapped to the reference genome but aligned to the entries in NCBI database of horse proteins were enriched for biological processes that largely correspond to the functions of organ from which RNA was isolated and thus are presumably true transcripts of genes associated with cell metabolism in those tissues. In addition, a portion of reads aligned to the common pathogenic or neutral microbiota, of which the most common was Brucella spp. These data suggest that unmapped reads can be an important target for in-depth analysis that may substantially enrich results of initial RNA-Seq experiments for various tissues and organs.

Prevalence of positive urine culture in the presence of inactive urine sediment in 1049 urine samples from dogs.

BACKGROUND: Urinalysis (UA) is often used to screen for bacterial cystitis, regardless of sediment results, and followed up by quantitative urine culture (UC) for definitive diagnosis. OBJECTIVES: Determine prevalence of positive UCs in dogs with inactive urine sediments on routine UA. ANIMALS: A total of 1049 urine samples with inactive urine sediments and UCs collected from dogs presented to a veterinary specialty hospital between January 2018 and February 2020. METHODS: Retrospective study of dogs with an inactive urine sediment on routine UA and follow-up UCs. Signalment, UA findings, proteinuria, and UC results were recorded. Associations among these findings were assessed using multivariate logistic regression carried out using a backward stepwise method. RESULTS: Overall prevalence of positive UC was 3.4% (95% confidence interval [CI], 2.4-4.8). Escherichia coli was the most commonly isolated bacteria. Only naturally voided samples were associated with increased prevalence of positive culture when compared to collection by cystocentesis or a non-specified method. No statistically significant association with culture positivity was found for urine protein-to-creatinine ratio, urine specific gravity, urine pH, breed, age, or sex. CONCLUSIONS AND CLINICAL IMPORTANCE: Based on the low prevalence (3.4%) of positive culture in urine samples from dogs with inactive sediment on routine UA and the relatively high cost of UC and sensitivity, cost-benefit analysis including clinical suspicion of lower urinary tract disease should inform testing decisions, rather than routinely performing cultures on urine samples without active sediments.

Endoparasitism of Golden Retrievers: Prevalence, risk factors, and associated clinicopathologic changes.

Endoparasitism is a common disease in dogs throughout their lifetime despite the widespread availability of inexpensive diagnostic tests and effective treatments. The consequences of host parasite interactions in otherwise apparently healthy dogs remains largely unknown. This cross-sectional study used complete blood count, serum biochemistry, and fecal flotation data collected from 3,018 young dogs (<3 years of age) enrolled within the Morris Animal Foundation Golden Retriever Lifetime Study (GRLS) to determine the prevalence of endoparasitism and compare bloodwork values of parasite positive and negative participants using logistic regression. Variables including age, gender, reproductive status, and geographic region at the time of evaluation were assessed to identify potential associations. To the authors' knowledge, a comprehensive assessment of clinicopathological changes associated with endoparasite infection in a large cohort has not been completed in the recent decade. The overall prevalence of endoparasitism was 6.99% (211/3018). Dogs who were parasite positive had statistically lower albumin (P = 0.004), lower RBC count (P = 0.01), higher neutrophil count (P = 0.002), and higher platelet count (P <0.001) as compared to parasite negative dogs. It was also concluded that dogs living in rural areas were more likely to have endoparasites than those living in suburban areas. Epidemiological data is crucial for the design and monitoring of prevention and control strategies. Identification of endoparasites by fecal testing is an essential tool to identify susceptible and resistant animals that can act as spreaders and reservoirs of intestinal parasites thereby enabling appropriate therapy and reducing the risk of new infection to animals and humans. Further epidemiological studies are needed to prevent, monitor, and develop new strategies to control endoparasites.

DNA methylation aging and transcriptomic studies in horses.

Cytosine methylation patterns have not yet been thoroughly studied in horses. Here, we profile n = 333 samples from 42 horse tissue types at loci that are highly conserved between mammalian species using a custom array (HorvathMammalMethylChip40). Using the blood and liver tissues from horses, we develop five epigenetic aging clocks: a multi-tissue clock, a blood clock, a liver clock and two dual-species clocks that apply to both horses and humans. In addition, using blood methylation data from three additional equid species (plains zebra, Grevy's zebras and Somali asses), we develop another clock that applies across all equid species. Castration does not significantly impact the epigenetic aging rate of blood or liver samples from horses. Methylation and RNA data from the same tissues define the relationship between methylation and RNA expression across horse tissues. We expect that the multi-tissue atlas will become a valuable resource.

Increased α-tocopherol metabolism in horses with equine neuroaxonal dystrophy.

BACKGROUND: Equine neuroaxonal dystrophy/equine degenerative myeloencephalopathy (eNAD/EDM) is an inherited neurodegenerative disorder associated with a vitamin E deficiency within the first year of life. Vitamin E consists of 8 isoforms metabolized by the CYP4F2 enzyme. No antemortem diagnostic test currently exists for eNAD/EDM. HYPOTHESIS/OBJECTIVES: Based on the association of α-tocopherol deficiency with the development of eNAD/EDM, we hypothesized that the rate of α-tocopherol, but not γ-tocopherol or tocotrienol metabolism, would be increased in eNAD/EDM-affected horses. ANIMALS: Vitamin E metabolism: Proof of concept (POC) study; eNAD/EDM-affected (n = 5) and control (n = 6) horses. Validation study: eNAD/EDM-affected Quarter Horses (QHs; n = 6), cervical vertebral compressive myelopathy affected (n = 6) horses and control (n = 29) horses. CYP4F2 expression and copy number: eNAD/EDM-affected (n = 12) and age- and sex-matched control (n = 11-12) horses. METHODS: The rates of α-tocopherol/tocotrienol and γ-tocopherol/tocotrienol metabolism were assessed in equine serum (POC and validation) and urine (POC only) using liquid chromatography tandem mass spectrometry (LC-MS/MS). Quantitative reverse-transcriptase PCR (qRT-PCR) and droplet digital (dd)-PCR were used to assay expression and genomic copy number of a CYP4F2 equine ortholog. RESULTS: Metabolic rate of α-tocopherol was increased in eNAD/EDM horses (POC,P < .0001; validation, P = .03), with no difference in the metabolic rate of γ-tocopherol. Horses with eNAD/EDM had increased expression of the CYP4F2 equine orthologue (P = .02) but no differences in copy number. CONCLUSIONS AND CLINICAL IMPORTANCE: Increased α-tocopherol metabolism in eNAD/EDM-affected QHs provides novel insight into alterations in vitamin E processing in eNAD/EDM and highlights the need for high-dose supplementation to prevent the clinical phenotype in genetically susceptible horses.

Postmortem diagnoses of spinal ataxia in 316 horses in California.

OBJECTIVE: To determine period prevalences of postmortem diagnoses for spinal cord or vertebral column lesions as underlying causes of ataxia (spinal ataxia) in horses. ANIMALS: 2,861 client-owned horses (316 with ataxia [ataxic group] and 2,545 without ataxia [control group]). PROCEDURES: The medical records database of the University of California-Davis Veterinary Medical Teaching Hospital was searched to identify horses necropsied between January 1, 2005, and December 31, 2017. Results were compared between the ataxic and control groups and between various groups of horses in the ataxic group. Period prevalences were determined for the most common causes of ataxia. RESULTS: 2,861 horses underwent full necropsy, and the period prevalences for the most common definitive diagnoses for ataxia were 2.7% (77/2,861) for cervical vertebral compressive myelopathy (CVCM), 1.3% (38/2,861) for equine neuroaxonal dystrophy or equine degenerative myeloencephalopathy (eNAD-EDM), and 0.9% (25/2,861) for trauma; the period prevalence of ataxia of unknown origin was 2.0% (56/2,861). Horses in the ataxic group (vs the control group) were more likely to have been warmblood horses (OR, 2.70) and less likely to have been Arabian horses (OR, 0.53). In the ataxic group, horses < 5 (vs ≥ 5) years of age had greater odds of CVCM (OR, 2.82) or eNAD-EDM (OR, 6.17) versus trauma or ataxia of unknown origin. Horses in the ataxic group with CVCM were more likely Thoroughbreds (OR, 2.54), whereas horses with eNAD-EDM were more likely American Quarter Horses (OR, 2.95) and less likely Thoroughbreds (OR, 0.11). CONCLUSIONS AND CLINICAL RELEVANCE: Results indicated that breed distributions differed for horses with CVCM versus eNAD-EDM; therefore, breed should be considered in the clinical evaluation of spinal ataxia in horses.

Generation of a Biobank From Two Adult Thoroughbred Stallions for the Functional Annotation of Animal Genomes Initiative.

Following the successful creation of a biobank from two adult Thoroughbred mares, this study aimed to recapitulate sample collection in two adult Thoroughbred stallions as part of the Functional Annotation of the Animal Genome (FAANG) initiative. Both stallions underwent thorough physical, lameness, neurologic, and ophthalmic (including electroretinography) examinations prior to humane euthanasia. Epididymal sperm was recovered from both stallions immediately postmortem and cryopreserved. Aseptically collected full thickness skin biopsies were used to isolate, culture and cryopreserve dermal fibroblasts. Serum, plasma, cerebrospinal fluid, urine, and gastrointestinal content from various locations were collected and cryopreserved. Under guidance of a board-certified veterinary anatomic pathologist, 102 representative tissue samples were collected from both horses. Whole tissue samples were flash-frozen and prioritized tissues had nuclei isolated and cryopreserved. Spatially contemporaneous samples of each tissue were submitted for histologic examination. Antemortem and gross pathologic examination revealed mild abnormalities in both stallions. One stallion (ECA_UCD_AH3) had unilateral thoracic limb lameness and bilateral chorioretinal scars. The second stallion (ECA_UCD_AH4) had subtle symmetrical pelvic limb ataxia, symmetrical prostatomegally, and moderate gastrointestinal nematodiasis. DNA from each was whole-genome sequenced and genotyped using the GGP Equine 70K SNP array. The genomic resources and banked biological samples from these animals augments the existing resource available to the equine genomics community. Importantly we may now improve the resolution of tissue-specific gene regulation as affected by sex, as well as add sex-specific tissues and gametes.

Determination of vitamin E and its metabolites in equine urine using liquid chromatography-mass spectrometry.

Equine neuroaxonal dystrophy/degenerative myeloencephalopathy (eNAD/EDM) is a hereditary, deteriorating central nervous disease in horses. Currently, the only way to confirm eNAD/EDM is through a postmortem histological evaluation of the central nervous system. Vitamin E, specifically the isoform alpha-tocopherol (α-TP), is known to protect eNAD/EDM susceptible horses from developing the clinical phenotype. While vitamin E is an essential nutrient in the diet of horses, there are no diagnostic tests able to quantitate vitamin E and its metabolites in urine. An ultra-performance liquid chromatography-atmospheric-pressure chemical ionization mass spectrometry (UPLC-APCI-MS/MS) method was developed and validated following acidic hydrolysis and solid phase extraction to quantitate vitamin E and its metabolites in equine urine. A blank control horse urine matrix was used and spiked with different concentrations of analytes to form a standard curve using either alpha-tocopherol-d6 or chlorpropamide as the internal standard. Inter-day and intra-day statistics were performed to evaluate the method for accuracy (90% to 116%) and precision (0.75% to 14%). Matrix effects, percent recovery, and stability were also assessed. The method successfully analyzed alpha-carboxyethyl hydroxychroman (α-CEHC), alpha-carboxymethylbutyl hydroxychromans (α-CMBHC), gamma-carboxyethyl hydroxychroman γ-CEHC, and α-TP concentrations in urine to determine a baseline levels of analytes in healthy horses, and can be used to determine concentrations of vitamin E metabolites in equine urine allowing for its evaluation as a diagnostic approach in the treatment of eNAD/EDM.

A nonsense variant in Rap Guanine Nucleotide Exchange Factor 5 (RAPGEF5) is associated with equine familial isolated hypoparathyroidism in Thoroughbred foals.

Idiopathic hypocalcemia in Thoroughbred (TB) foals causes tetany and seizures and is invariably fatal. Based upon the similarity of this disease with human familial hypoparathyroidism and occurrence only in the TB breed, we conducted a genetic investigation on two affected TB foals. Familial hypoparathyroidism was identified, and pedigree analysis suggested an autosomal recessive (AR) mode of inheritance. We performed whole-genome sequencing of the two foals, their unaffected dams and four unaffected, unrelated TB horses. Both homozygosity mapping and an association analysis were used to prioritize potential genetic variants. Of the 2,808 variants that significantly associated with the phenotype using an AR mode of inheritance (P<0.02) and located within a region of homozygosity, 1,507 (54%) were located in a 9.7 Mb region on chr4 (44.9-54.6 Mb). Within this region, a nonsense variant (RAPGEF5 c.2624C>A,p.Ser875*) was significantly associated with the hypoparathyroid phenotype (Pallelic = 0.008). Affected foals were homozygous for the variant, with two additional affected foals subsequently confirmed in 2019. Necropsies of all affected foals failed to identify any histologically normal parathyroid glands. Because the nonsense mutation in RAPGEF5 was near the C-terminal end of the protein, the impact on protein function was unclear. Therefore, we tested the variant in our Xenopus overexpression model and demonstrated RAPGEF5 loss-of-function. This RAPGEF5 variant represents the first genetic variant for hypoparathyroidism identified in any domestic animal species.

Comparison of Poly-A+ Selection and rRNA Depletion in Detection of lncRNA in Two Equine Tissues Using RNA-seq.

Long non-coding RNAs (lncRNAs) are untranslated regulatory transcripts longer than 200 nucleotides that can play a role in transcriptional, post-translational, and epigenetic regulation. Traditionally, RNA-sequencing (RNA-seq) libraries have been created by isolating transcriptomic RNA via poly-A+ selection. In the past 10 years, methods to perform ribosomal RNA (rRNA) depletion of total RNA have been developed as an alternative, aiming for better coverage of whole transcriptomic RNA, both polyadenylated and non-polyadenylated transcripts. The purpose of this study was to determine which library preparation method is optimal for lncRNA investigations in the horse. Using liver and cerebral parietal lobe tissues from two healthy Thoroughbred mares, RNA-seq libraries were prepared using standard poly-A+ selection and rRNA-depletion methods. Averaging the two biologic replicates, poly-A+ selection yielded 327 and 773 more unique lncRNA transcripts for liver and parietal lobe, respectively. More lncRNA were found to be unique to poly-A+ selected libraries, and rRNA-depletion identified small nucleolar RNA (snoRNA) to have a higher relative expression than in the poly-A+ selected libraries. Overall, poly-A+ selection provides a more thorough identification of total lncRNA in equine tissues while rRNA-depletion may allow for easier detection of snoRNAs.

Genome-Wide Association Study and Subsequent Exclusion of ATCAY as a Candidate Gene Involved in Equine Neuroaxonal Dystrophy Using Two Animal Models.

Equine neuroaxonal dystrophy/equine degenerative myeloencephalopathy (eNAD/EDM) is an inherited neurodegenerative disorder of unknown etiology. Clinical signs of neurological deficits develop within the first year of life in vitamin E (vitE) deficient horses. A genome-wide association study (GWAS) was carried out using 670,000 SNP markers in 27 case and 42 control Quarter Horses. Two markers, encompassing a 2.5 Mb region on ECA7, were associated with the phenotype (p = 2.05 × 10-7 and 4.72 × 10-6). Within this region, caytaxin (ATCAY) was identified as a candidate gene due to its known role in Cayman Ataxia and ataxic/dystonic phenotypes in mouse models. Whole-genome sequence data in four eNAD/EDM and five unaffected horses identified 199 associated variants within the ECA7 region. MassARRAY® genotyping was performed on these variants within the GWAS population. The three variants within ATCAY were not concordant with the disease phenotype. No difference in expression or alternative splicing was identified using qRT-PCR in brainstem across the ATCAY transcript. Atcayji-hes mice were then used to conduct functional analysis in a second animal model. Histologic lesions were not identified in the central nervous system of Atcayji-hes mice. Additionally, supplementation of homozygous Atcayji-hes mice with 600 IU/day of dl-α-tocopheryl acetate (vitE) during gestation, lactation, and adulthood did not improve the phenotype. ATCAY has therefore been excluded as a candidate gene for eNAD/EDM.

Functionally Annotating Regulatory Elements in the Equine Genome Using Histone Mark ChIP-Seq.

One of the primary aims of the Functional Annotation of ANimal Genomes (FAANG) initiative is to characterize tissue-specific regulation within animal genomes. To this end, we used chromatin immunoprecipitation followed by sequencing (ChIP-Seq) to map four histone modifications (H3K4me1, H3K4me3, H3K27ac, and H3K27me3) in eight prioritized tissues collected as part of the FAANG equine biobank from two thoroughbred mares. Data were generated according to optimized experimental parameters developed during quality control testing. To ensure that we obtained sufficient ChIP and successful peak-calling, data and peak-calls were assessed using six quality metrics, replicate comparisons, and site-specific evaluations. Tissue specificity was explored by identifying binding motifs within unique active regions, and motifs were further characterized by gene ontology (GO) and protein-protein interaction analyses. The histone marks identified in this study represent some of the first resources for tissue-specific regulation within the equine genome. As such, these publicly available annotation data can be used to advance equine studies investigating health, performance, reproduction, and other traits of economic interest in the horse.

TRIM39-RPP21 Variants (∆19InsCCC) Are Not Associated with Juvenile Idiopathic Epilepsy in Egyptian Arabian Horses.

Juvenile idiopathic epilepsy (JIE) is an inherited disease characterized by recurrent seizures during the first year of life in Egyptian Arabian horses. Definitive diagnosis requires an electroencephalogram (EEG) performed by a veterinary specialist. A recent study has suggested that a 19 base-pair deletion, along with a triple-C insertion, in intron five of twelve (∆19InsCCC; chr20:29542397-29542425: GTTCAGGGGACCACATGGCTCTCTATAGA>TATCTTAAGACCC) of the Tripartite Motif-Containing 39-Ribonuclease p/mrp 21kDa Subunit (TRIM39-RPP21) gene is associated with JIE. To confirm this association, a new sample set consisting of nine EEG-phenotyped affected and nine unaffected Egyptian Arabian horses were genotyped using Sanger sequencing. There was no significant genotypic (P = 1.00) or allelic (P = 0.31) association with the ∆19InsCCC variant and JIE status. The previously reported markers in TRIM39-RPPB1 are therefore not associated with JIE in well-phenotyped samples. The ∆19InsCCC variant is a common variant that happens to be positioned in a highly polymorphic region in the Arabian breed.