Modulation of 11beta-hydroxysteroid dehydrogenase expression by bombesin: a possible mechanism for glucocorticoid resistance in androgen independent prostate cancer.

Treatment with glucocorticoids is one of a limited number of options for androgen independent prostate cancer. Neuroendocrine differentiation has been shown to contribute to androgen-independent prostate cancer progression. To study the potential link between neuroendocrine differentiation and the glucocorticoid action, we investigated the effects of the product of neuroendocrine differentiation--bombesin on glucocorticoid metabolizing enzymes--11beta-hydroxysteroid dehydrogenases in PC-3 cells. Our Western analysis, RT-PCR, and activity assays demonstrate that while 18-hour exposure to bombesin reduces 11beta-hydroxy-steroid dehydrogenases-1 profiles (activities 25% less, protein level 29% lower, mRNA levels 45% lower), contrarily it increases 11beta-hydroxysteroid dehydrogenases-2 profiles (activities 34%, protein levels 100%, mRNA levels 120%). Blockade bombesin action with bombesin receptor antagonists and the enzyme degrading bombesin prevented these changes, suggesting the observed modulations were bombesin receptor-specific. In addition, bombesin increased the amounts of interleukin-8 and mRNA of vascular endothelial growth factor receptor 2, which were lowered in the presence of cortisol, suggesting that neuropeptide blockade may extend the benefits of glucocorticoids in treating androgen-independent prostate cancer.

Kap promoter analysis in vivo: a regulatory role for a truncated L1 repeat.

Reporter gene expression directed by a 1542-base pair (bp) fragment of the Kap promoter is specific to the proximal tubules of the kidney and androgen-regulated. In the present study, the characteristics of the androgen response from the 1542-bp promoter were examined in vivo. The estrogen response in the kidney and uterus was also examined. The reporter gene expression was assayed in lines of transgenic mice generated from a truncated promoter construct in which the L1 repeat, present at the distal portion of the 1542-bp, had been deleted. The pattern of androgen response of the reporter gene is similar to that of the endogenous Kap. Reporter gene expression in the 1542-bp promoter does not respond to estrogen in the kidney, while perinatal expression in the uterus does occur. Truncation of the L1 results in loss of reporter gene expression. We conclude that L1 sequences present near the Kap promoter have a regulatory function.

Identification of the oxidative 3alpha-hydroxysteroid dehydrogenase activity of rat Leydig cells as type II retinol dehydrogenase.

Dihydrotestosterone (DHT) is the most potent naturally occurring androgen, and its production in the testis may have important consequences in developmental and reproductive processes. In the rat testis, three factors can contribute to intracellular DHT levels: 1) synthesis of DHT from T by 5alpha-reductase, 2) conversion of DHT to 5alpha-androstane-3alpha, 17beta-diol (3alpha-DIOL) by the reductive activity of 3alpha-hydroxysteroid dehydrogenase (3alpha-HSD), and 3) conversion of 3alpha-DIOL by an oxidative 3alpha-HSD activity. While the type I 3alpha-HSD enzyme (3alpha-HSD1 or AKR1C9) is an oxidoreductase in vitro and could theoretically be responsible for factors 2 and 3, we have shown previously that rat Leydig cells have two 3alpha-HSD activities: a cytosolic NADP(H)- dependent activity, characteristic of 3alpha-HSD1, and a microsomal NAD(H)-dependent activity. The two activities were separable by both developmental and biochemical criteria, but the identity of the second enzyme was unknown. To identify the microsomal NAD(H)-dependent 3alpha-HSD in rat Leydig cells, degenerate primers were used to amplify a number of short-chain alcohol dehydrogenases. Sequence analysis of cloned PCR products identified retinol dehydrogenase type II (RoDH2) as the prevalent species in purified Leydig cells. RoDH2 cDNA was subcloned into expression vectors and transiently transfected into CHOP and COS-1 cells. Its properties were compared with transiently transfected 3alpha-HSD1. When measured in intact CHOP and COS-1 cells, RoDH2 cDNA produced a protein that catalyzed the conversions of 3alpha-DIOL to DHT and androsterone to androstanedione, but not the reverse reactions. Therefore, the 3alpha-HSD activity of RoDH2 was exclusively oxidative. In contrast, type I 3alpha-HSD cDNA produced a protein that was exclusively a 3alpha-HSD reductase. In cell homogenates and subcellular fractions, RoDH2 catalyzed both 3alpha-HSD oxidation and reduction reactions that were NAD(H) dependent, and the enzyme activities were located in the microsomes. Type I 3alpha-HSD also catalyzed both oxidation and reduction, but was located in the cytosol and was NADP(H) dependent. We conclude that type I 3alpha-HSD and RoDH2 have distinct 3alpha-HSD activities with opposing catalytic directions, thereby controlling the rates of DHT production by Leydig cells.

Identification and characterization of two androgen response regions in the human neutral endopeptidase gene.

Transcription of the human neutral endopeptidase 24.11 (NEP) gene is androgen regulated in prostate cancer cells. Homology search identified a sequence GTCACAaagAGTTCT similar to the ARE consensus sequence GGTACAnnnTGTTCT within the 3'-untranslated region of the NEP mRNA. A double-stranded radiolabelled oligonucleotide containing this NEP-ARE sequence formed a DNA-protein complex with nuclear proteins from LNCaP cells or COS-7 cells co-transfected with an androgen receptor (AR) expression vector, and with full-length AR synthesized by baculovirus in mobility shift assays. Unlabeled NEP-ARE or consensus ARE but not mutated NEP-ARE replaced radiolabelled NEP-ARE. Steroid-dependent enhancement of transcription was assayed by transfecting ptkCAT reporter constructs containing the NEP-ARE into CV-1/AR cells and prostate cancer cells (PC-3/AR). Enhancement of chloramphenicol acetyltransferase (CAT) activity was increased four-fold by androgen, seven-fold by dexamethasone and three-fold by progesterone in CV-1/AR cells, and the NEP-ARE bound to glucocorticoid and progesterone receptor in mobility shift assays. We next performed DNase-I footprinting analysis of the NEP promoter and identified a 23 bp sequence GGTGCGGGTCGGAGGGATGCCCA (NEP-ARR) which was protected from DNase I cleavage by nuclear extracts from COS-7 cells expressing AR. This sequence was 62.5% homologous to an androgen responsive region (PSA-ARR) identified in the promoter of the prostate specific antigen (PSA) gene. A double-stranded radiolabelled oligonucleotide containing this NEP-ARR sequence formed DNA-protein complex with AR but not GR proteins. Unlabeled NEP-ARR, PSA-ARR and NEP-ARE replaced radiolabelled NEP-ARR. Steroid-dependent enhancement of transcription assays in PC-3/AR cells revealed that the enhancement of CAT activity was increased 2.3-fold by androgen, but not by glucocorticoid or progesterone. In a thymidine kinase promoter, the NEP-ARE and NEP-ARR together stimulated a five-fold increase in promoter activity in PC cells. These data suggest that steroid regulation of the NEP gene involves at least two elements including a typical ARE which binds androgen, progesterone and glucocorticoid receptors, and a unique ARR which only binds androgen receptor.

Opposing changes in 3alpha-hydroxysteroid dehydrogenase oxidative and reductive activities in rat leydig cells during pubertal development.

The enzyme 3alpha-hydroxysteroid dehydrogenase (3alpha-HSD) has an important role in androgen metabolism, catalyzing the interconversion of dihydrotestosterone (DHT) and 5alpha-androstane-3alpha,17beta-diol (3alpha-DIOL). The net direction of this interconversion will affect the amount of biologically active ligand available for androgen receptor binding. We hypothesize that in Leydig cells, differential expression of 3alpha-HSD enzymes favoring one of the two directions is a mechanism by which DHT levels are controlled. In order to characterize 3alpha-HSD in rat Leydig cells, the following properties were analyzed: rates of oxidation (3alpha-DIOL to DHT) and reduction (DHT to 3alpha-DIOL) and preference for the cofactors NADP(H) and NAD(H) (i.e., the oxidized and reduced forms of both pyridine nucleotides) in Leydig cells isolated on Days 21, 35, and 90 postpartum. Levels of 3alpha-HSD protein were measured by immunoblotting using an antibody directed against the liver type of the enzyme. Levels of 3alpha-HSD protein and rates of reduction were highest on Day 21 and lowest on Day 90. The opposite was true for the rate of 3alpha-HSD oxidation, which was barely detectable on Day 21 and highest on Day 90 (59.08 +/- 6.35 pmol/min per 10(6) cells, mean +/- SE). Therefore, the level of 3alpha-HSD protein detectable by liver enzyme was consistent with reduction but not with oxidation. There was a clear partitioning of NADP(H)-dependent activity into the cytosolic fraction of Leydig cells, whereas on Days 35 and 90, Leydig cells also contained a microsomal NAD(H)-activated 3alpha-HSD. We conclude that 1) the cytosolic 3alpha-HSD in Leydig cells on Day 21 behaves as a unidirectional NADPH-dependent reductase; 2) by Day 35, a microsomal NAD(H)-dependent enzyme activity is present and may account for predominance of 3alpha-HSD oxidation over reduction and the resultant high capacity of Leydig cells on Day 90 to synthesize DHT from 3alpha-DIOL.

The effects of a single bout of strength training on ambulatory blood pressure levels in 24 mildly hypertensive men.

Twenty-four mildly hypertensive sedentary men were randomly assigned to one or two control conditions of health education or a treatment of a single bout of strength training. The men were rotated through the conditions until each man had participated in the treatment and both control conditions. Blood pressure was measured every 15 minutes for the 24-hour period following participation in each condition using an ambulatory blood pressure monitoring system. Compared to the control conditions, systolic blood pressure and blood pressure load were reduced for at least 1 hour after exercise, and diastolic blood pressure and blood pressure load were reduced for at least 3 minutes and 1 hour, respectively, after exercise.

Developmental changes in glucocorticoid receptor and 11beta-hydroxysteroid dehydrogenase oxidative and reductive activities in rat Leydig cells.

Glucocorticoids directly regulate testosterone production in Leydig cells through a glucocorticoid receptor (GR)-mediated repression of the genes that encode testosterone biosynthetic enzymes. The extent of this action is determined by the numbers of GR within the Leydig cell, the intracellular concentration of glucocorticoid, and 11beta-hydroxysteroid dehydrogenase (11betaHSD) activities that interconvert corticosterone (in the rat) and its biologically inert derivative, 11-dehydrocorticosterone. As glucocorticoid levels remain stable during pubertal development, GR numbers and 11betaHSD activities are the primary determinants of glucocorticoid action. Therefore, in the present study, levels of GR and 11betaHSD messenger RNA (mRNA) and protein were measured in rat Leydig cells at three stages of pubertal differentiation: mesenchymal-like progenitors (PLC) on day 21, immature Leydig cells (ILC) that secrete 5alpha-reduced androgens on day 35, and adult Leydig cells (ALC) that are fully capable of testosterone biosynthesis on day 90. Numbers of GR, measured by [3H]dexamethasone binding, in purified cells were 6.34 +/- 0.27 (x 10(3) sites/cell; mean +/- SE) for PLC, 30.45 +/- 0.74 for ILC, and 32.54 +/- 0.84 for ALC. Although GR binding was lower in PLC, steady state levels for GR mRNA were equivalent at all three stages (P > 0.05). Oxidative and reductive activities of 11betaHSD were measured by assaying the conversion of radiolabeled substrates in incubations of intact Leydig cells. Both oxidative and reductive activities were barely detectable in PLC, intermediate in ILC, and highest in ALC. The ratio of the two activities favored reduction in PLC and ILC and oxidation in ALC (oxidation/reduction, 0.33 +/- 0.33 for PLC, 0.43 +/- 0.05 for ILC, and 2.12 +/- 0.9 for ALC, with a ratio of 1 indicating equivalent rates for both activities). The mRNA and protein levels of type I 11betaHSD in Leydig cells changed in parallel with 11betaHSD reductive activity, which increased gradually during the transition from PLC to ALC, compared with the sharp rise that was seen in oxidative activity. We conclude that Leydig cells at all developmental stages have GR and that their ability to respond to glucocorticoid diminishes as net 11betaHSD activity switches from reduction to oxidation. This provides a mechanism for the Leydig cell to regulate its intracellular concentration of corticosterone, thereby varying its response to this steroid during pubertal development.

The kidney androgen-regulated protein promoter confers renal proximal tubule cell-specific and highly androgen-responsive expression on the human angiotensinogen gene in transgenic mice.

Transgenic mice were generated containing a 1542-base pair fragment of the kidney androgen-regulated protein (KAP) promoter fused to the human angiotensinogen (HAGT) gene with the goal of specifically targeting inducible expression of renin-angiotensin system components to the kidney. High level expression of both KAP-HAGT and endogenous KAP mRNA was evident in the kidney of male mice from two independent transgenic lines. Renal expression of the transgene in female mice was undetectable under basal conditions but could be strongly induced by administration of testosterone. Testosterone treatment did not cause a transcriptional induction in any other tissues examined. However, an analysis of six androgen target tissues in males revealed that the transgene was expressed in epididymis. No other extra-renal expression of the transgene was detected. In situ hybridization demonstrated that expression of HAGT (and KAP) mRNA in males and testosterone-treated females was restricted to proximal tubule epithelial cells in the renal cortex. Although there was no detectable human angiotensinogen protein in plasma, it was evident in the urine, consistent with a pathway of synthesis in proximal tubule cells and release into the tubular lumen. These results demonstrate that 1542 base pairs of the KAP promoter is sufficient to drive expression of a heterologous reporter gene in a tissue-specific, cell-specific, and androgen-regulated fashion in transgenic mice.

Androgen receptor CAG repeat lengths in prostate cancer: correlation with age of onset.

The androgen receptor (AR) is a structurally conserved member of the nuclear receptor superfamily. The amino-terminal domain is required for transcriptional activation and contains a region of polyglutamine encoded by CAG trinucleotide repeats. In humans, the number of CAG repeats is polymorphic; the average number is 22 in Caucasian males. Expansion of CAG repeats in the AR has clinical implications for human disease. As androgen influences prostate cancer growth, polymorphisms in CAG repeat length may affect the clinical course of patients with prostate cancer. To test for an association between clinical parameters of human prostate cancer and CAG repeat length, we analyzed normal lymphocyte DNA from 109 patients. The CAG region of the AR was amplified by the PCR. Reaction products were then amplified using end-labeled internal primers, cut at the internal PstI site and assayed on sequencing gels using a sequence ladder as a size standard. Sequence analysis of several samples validated this method for measurement of CAG repeat number. The median age of patients was 63 yr (range, 42-83), with 104 Caucasian, 2 African American, 1 Asian, and 2 other racial origin. The median repeat length was 25 for patients with stage A, 22 for patients with stage B, 22 for patients with stage C, and 23 for patients presenting with stage D disease. A significant correlation between CAG repeat length and age at onset was observed, whereas correlations with stage, level of prostate-specific antigen at diagnosis, and time to prostate-specific antigen relapse were not significant. Shorter CAG repeat lengths may be associated with the development of prostate cancer in men at a younger age. These data suggest that CAG repeat length can affect the risk of developing prostate cancer.

Genetic variations in human testosterone-estradiol binding globulin.

The human testosterone-estradiol-binding globulin (hTeBG) is a plasma heterogeneous glycoprotein with high affinity for a number of circulating steroid hormones. The heterogeneity originates from differential glycosylation of a common protein precursor. Analysis of desialylated hTeBG by isoelectric focusing (IEF) has revealed that microheterogeneity could be partly attributed to variability in sialic acid content or rearrangement of amino acid composition. We have studied this possibility by the analysis of desialylated serum hTeBG by Western blotting of proteins previously separated on IEF-gels. Two distinct well-defined IEF patterns were identified. The most frequent consisted of two major IEF-bands of equal color intensity. The other pattern consisting of four IEF-bands was present in only 5.55% of the total serum samples analyzed. Family studies showed that these phenotypes were autosomally inherited with a simple Mendelian transmission and allele frequencies had an excellent agreement between the observed and expected phenotypes. Androgen affinity constants and serum concentrations of hTeBG variant were similar to those of normal hTeBG. Molecular analyses of each of the exons of hTeBG gene by denaturing gradient gel electrophoresis revealed the presence of a point mutation in exon 8. The studies presented herein confirm and extend previous reports on the existence of structural variants of hTeBG. In addition, the mutation reported in this study is probably the same as that recently identified within numerous ethnic groups throughout the world, thus further supporting the concept of a two allele gene worldwide concoding hTeBG.

Molecular characterization of a genetic variant of the steroid hormone-binding globulin gene in heterozygous subjects.

Steroid hormone-binding globulin in human serum displays different isoelectric focusing (IEF) patterns among individuals, suggesting genetic variation in the gene for this extracellular steroid carrier protein. Analysis of allele frequencies and family studies suggested the existence of two codominant alleles of the gene. Subsequent determination of the molecular basis of a variant of the gene was carried out using DNA from homozygous individuals from a single Belgian family. It was of interest to characterize other variant individuals to determine whether all variants identified by IEF phenotyping were caused by the same mutation or whether other mutations occurred in the gene in different populations. Previous studies identified Mexican subjects who were heterozygous for the variant IEF phenotype. Denaturing gradient gel electrophoresis was used to localize the mutation in these subjects and to purify the variant allele for DNA sequence analysis. The results show that the mutation in this population is identical to that identified in the Belgian family, and no other mutations were detected in the gene. These data represent the first analysis of steroid hormone-binding globulin gene variation in heterozygous subjects and further support the conclusion of biallelism of the gene worldwide.

Effects of luteinizing hormone (LH) and androgen on steady state levels of messenger ribonucleic acid for LH receptors, androgen receptors, and steroidogenic enzymes in rat Leydig cell progenitors in vivo.

Adult Leydig cells differentiate postnatally from mesenchymal-like progenitor cells. The relative scarcity of LH receptors (LHRs) in progenitor cells indicates that additional hormones may be important in the initial phases of Leydig cell differentiation. High levels of androgen receptor (AR) in progenitor cells point to a role for androgen in these cells. In the present study, an LHRH antagonist, [Ac-D2Nal1,4C1DPhe2,D3Pal3,Arg5,DGlu6(anis ole adduct), DAla10]GnRH (NalGlu; 250 micrograms/kg body weight), was used to suppress endogenous secretion of both LH and androgen during days 14 to 21 postpartum in vivo. To examine the effects of LH and androgen on regulation of Leydig cell progenitors (PLCs), exogenous LH (5 micrograms/day), testosterone (T; 30 micrograms/day), or both were administered to NalGlu-treated rats. After 7 days of treatment, we examined the effects on testis weight, Leydig cell morphology, and T production. The steady state messenger RNA (mRNA) levels for LHR, AR, cytochrome P450 17 alpha-hydroxylase, and 3 alpha-hydroxysteroid dehydrogenase in purified PLCs were measured by reverse transcription-polymerase chain reaction, with ribosomal protein S16 as the internal control. Treatment with NalGlu significantly decreased testis weight, resulted in an abundance of mesenchymal-like cells over immature Leydig cells, lowered T production, and reduced the levels of several Leydig cell mRNAs. Treatment with exogenous LH or T maintained testis weight and Leydig cell morphology in NalGlu-treated rats. The mRNA levels for LHR, AR, and 3 alpha-hydroxysteroid dehydrogenase were significantly increased by LH or T. P450 17 alpha-hydroxylase mRNA levels were elevated by LH to control level but strikingly reduced by T. Combined treatment with LH and T further increased basal T production but did not elevate mRNAs beyond the levels obtained with each hormone alone. LH and androgen act similarly in PLCs in promoting Leydig cell differentiation with respect to morphological and molecular landmarks. These findings support the hypothesis that androgen as well as LH is involved in the differentiation of immature Leydig cells from mesenchymal-like progenitors.

Androgen receptor gene mutations in human prostate cancer.

We screened human prostate cancer tissues for the presence of somatic mutations in the hormone binding domain of the androgen receptor (AR) gene. Exons E-H were amplified from genomic DNA using the polymerase chain reaction and analyzed by denaturing gradient gel electrophoresis (DGGE), which separates DNA fragments that differ by only a single base. We detected a mutation in exon E of the hormone binding domain in 1 of 26 specimens of untreated organ-confined stage B prostate cancer. The mutation was not detectable in peripheral blood lymphocyte DNA. Lymphocyte DNA (wild-type AR) migrated in DGGE as a single band. The tumor DNA migrated in DGGE as four bands, consistent with the presence of cells with mutant AR plus cells with wild-type AR and indicating that the tumor contained a somatic mutation. To our knowledge, a somatic AR gene mutation has not been reported previously. Sequencing revealed a G----A substitution in codon 730, changing valine to methionine. Codon 730 is in a region highly conserved among all steroid receptors. The abundance of the mutated fragment (about 50% of the DNA in the specimen) indicates its presence in cells with a growth advantage. A somatic mutation could be detected by DGGE if it represented at least 10% of the sample. Failure to detect mutations in other specimens analyzed may be due to this limit of sensitivity, the presence of mutations in other parts of the AR, or a low frequency of mutations in early stage disease.

The effects of deletions in the central helix of calmodulin on enzyme activation and peptide binding.

Using site-directed mutagenesis we have expressed in Escherichia coli three engineered calmodulins (CaM) containing deletions in the solvent-exposed region of the central helix. These are CaM delta 84, Glu-84 removed; CaM delta 83-84, Glu-83 and Glu-84 removed; and CaM delta 81-84, Ser-81 through Glu-84 removed. The abilities of these proteins to activate skeletal muscle myosin light chain kinase, plant NAD kinase, and bovine brain calcineurin activities were determined, as were their abilities to bind a synthetic peptide based on the calmodulin-binding domain of skeletal muscle myosin light chain kinase. Similar results were obtained with all three deletion proteins. Vm values for enzymes activated by the deletion proteins are all within 10-20% of those values obtained with bacterial control calmodulin. Relative to bacterial control values, changes in Kact or Kd values associated with the deletions are all less than an order of magnitude: Kact values for NAD kinase and myosin light chain kinase are increased 5-7-fold, Kd values for binding of the synthetic peptide are increased 4-7-fold, and Kact values for calcineurin are increased only 1-3-fold. In assays of NAD kinase and myosin light chain kinase activation some differences between bovine calmodulin and bacterial control calmodulin were observed. With NAD kinase, Kact values for the bacterial control protein are increased 4-fold relative to values for bovine calmodulin, and Vm values are increased by 50%; with myosin light chain kinase, Kact values are increased 2-fold and Vm values are decreased 10-15% relative to those values obtained with bovine calmodulin. These differences between bacterial control and bovine calmodulins probably can be attributed to known differences in postranslational processing of calmodulin in bacterial and eucaryotic cells. No differences between bovine and control calmodulins were observed in assays of calcineurin activation or peptide binding. Our observations indicate that contacts with the deleted residues, Ser-81 through Glu-84, are not critical in the calmodulin-target complexes we have evaluated. Formation of these calmodulin-target complexes also does not appear to be greatly affected by the global alterations in the structure of calmodulin that are associated with the deletions. In models in which the central helix is maintained in the altered calmodulins, each deleted residue causes the two lobes of calmodulin to be twisted 100 degrees relative to one another and brought 1.5 A closer together.(ABSTRACT TRUNCATED AT 400 WORDS)

Two calmodulin genes are expressed in Arbacia punctulata. An ancient gene duplication is indicated.

Calmodulin is highly conserved, and only in the sea urchin Arbacia punctulata have two distinct isotypes been reported. We have isolated and sequenced two cDNAs from a lambda gt 11 library constructed from RNA from ovary tissue of A. punctulata. One clone, designated alpha, encodes a calmodulin isotype previously designated A. It encodes an amino acid sequence that is identical with calmodulin of most vertebrates in positions 1 through 141; however, it does not encode the last seven amino acids. The other clone, designated beta, starts with an open reading frame and encodes the B form of calmodulin from position 11 through the C-terminal position 148. It has only four differences from vertebrate calmodulin, occurring at positions 78 (Asp, beta Glu), 99 (Tyr, beta Phe), 143 (Gln, beta Ala) and 147 (Ala, beta Ser). The nucleic acid sequences of the alpha and beta cDNAs differ at 46 nucleotide positions that are distributed throughout their coding sequences. We conclude that the corresponding mRNAs are not derived from post-transcriptional processing of a single gene, and we infer that they are transcribed from two non-allelic genes. The gene duplication is inferred to have occurred prior to the divergence of the vertebrates and the echinoderms. The expression of these calmodulin mRNAs in ovary tissue and eggs of a single animal differs as judged by hybridization of probes to RNA immobilized to filters.