Repeated loss of the ability of a wild pepper disease resistance gene to function at high temperatures suggests that thermoresistance is a costly trait.

Specificity in plant-pathogen gene-for-gene (GFG) interactions is determined by the recognition of pathogen proteins by the products of plant resistance (R) genes. The evolutionary dynamics of R genes in plant-virus systems is poorly understood. We analyse the evolution of the L resistance locus to tobamoviruses in the wild pepper Capsicum annuum var. glabriusculum (chiltepin), a crop relative undergoing incipient domestication. The frequency, and the genetic and phenotypic diversity, of the L locus was analysed in 41 chiltepin populations under different levels of human management over its distribution range in Mexico. The frequency of resistance was lower in Cultivated than in Wild populations. L-locus genetic diversity showed a strong spatial structure with no isolation-by-distance pattern, suggesting environment-specific selection, possibly associated with infection by the highly virulent tobamoviruses found in the surveyed regions. L alleles differed in recognition specificity and in the expression of resistance at different temperatures, broad-spectrum recognition of P0 + P1 pathotypes and expression above 32°C being ancestral traits that were repeatedly lost along L-locus evolution. Overall, loss of resistance co-occurs with incipient domestication and broad-spectrum resistance expressed at high temperatures has apparent fitness costs. These findings contribute to understand the role of fitness trade-offs in plant-virus coevolution.

An extensive survey of phytoviral RNA 3' uridylation identifies extreme variations and virus-specific patterns.

Viral RNAs can be uridylated in eukaryotic hosts. However, our knowledge of uridylation patterns and roles remains rudimentary for phytoviruses. Here, we report global 3' terminal RNA uridylation profiles for representatives of the main families of positive single-stranded RNA phytoviruses. We detected uridylation in all 47 viral RNAs investigated here, revealing its prevalence. Yet, uridylation levels of viral RNAs varied from 0.2% to 90%. Unexpectedly, most poly(A) tails of grapevine fanleaf virus (GFLV) RNAs, including encapsidated tails, were strictly monouridylated, which corresponds to an unidentified type of viral genomic RNA extremity. This monouridylation appears beneficial for GFLV because it became dominant when plants were infected with nonuridylated GFLV transcripts. We found that GFLV RNA monouridylation is independent of the known terminal uridylyltransferases (TUTases) HEN1 SUPPRESSOR 1 (HESO1) and UTP:RNA URIDYLYLTRANSFERASE 1 (URT1) in Arabidopsis (Arabidopsis thaliana). By contrast, both TUTases can uridylate other viral RNAs like turnip crinkle virus (TCV) and turnip mosaic virus (TuMV) RNAs. Interestingly, TCV and TuMV degradation intermediates were differentially uridylated by HESO1 and URT1. Although the lack of both TUTases did not prevent viral infection, we detected degradation intermediates of TCV RNA at higher levels in an Arabidopsis heso1 urt1 mutant, suggesting that uridylation participates in clearing viral RNA. Collectively, our work unveils an extreme diversity of uridylation patterns across phytoviruses and constitutes a valuable resource to further decipher pro- and antiviral roles of uridylation.

Characterization of Grapevine Fanleaf Virus Isolates in 'Chardonnay' Vines Exhibiting Severe and Mild Symptoms in Two Vineyards.

Fanleaf degeneration is a complex viral disease of Vitis spp. that detrimentally impacts fruit yield and reduces the productive lifespan of most vineyards worldwide. In France, its main causal agent is grapevine fanleaf virus (GFLV). In the past, field experiments were conducted to explore cross-protection as a management strategy of fanleaf degeneration, but results were unsatisfactory because the mild virus strain negatively impacted fruit yield. In order to select new mild GFLV isolates, we examined two old 'Chardonnay' parcels harbouring vines with distinct phenotypes. Symptoms and agronomic performances were monitored over the four-year study on 21 individual vines that were classified into three categories: asymptomatic GFLV-free vines, GFLV-infected vines severely diseased and GFLV-infected vines displaying mild symptoms. The complete coding genomic sequences of GFLV isolates in infected vines was determined by high-throughput sequencing. Most grapevines were infected with multiple genetically divergent variants. While no specific molecular features were apparent for GFLV isolates from vines displaying mild symptoms, a genetic differentiation of GFLV populations depending on the vineyard parcel was observed. The mild symptomatic grapevines identified during this study were established in a greenhouse to recover GFLV variants of potential interest for cross-protection studies.

ICTV Virus Taxonomy Profile: Secoviridae 2022.

Members of the family Secoviridae are non-enveloped plant viruses with mono- or bipartite linear positive-sense ssRNA genomes with a combined genome of 9 to 13.7 kb and icosahedral particles 25-30 nm in diameter. They are related to picornaviruses and are members of the order Picornavirales. Genera in the family are distinguished by the host range, vector, genomic features and phylogeny of the member viruses. Most members infect dicotyledonous plants, and many cause serious disease epidemics. This is a summary of the International Committee on Taxonomy of Viruses (ICTV) report on the family Secoviridae, which is available at ictv.global/report/secoviridae.

Severe Stunting Symptoms upon Nepovirus Infection Are Reminiscent of a Chronic Hypersensitive-like Response in a Perennial Woody Fruit Crop.

Virus infection of plants can result in various degrees of detrimental impacts and disparate symptom types and severities. Although great strides have been made in our understanding of the virus-host interactions in herbaceous model plants, the mechanisms underlying symptom development are poorly understood in perennial fruit crops. Grapevine fanleaf virus (GFLV) causes variable symptoms in most vineyards worldwide. To better understand GFLV-grapevine interactions in relation to symptom development, field and greenhouse trials were conducted with a grapevine genotype that exhibits distinct symptoms in response to a severe and a mild strain of GFLV. After validation of the infection status of the experimental vines by high-throughput sequencing, the transcriptomic and metabolomic profiles in plants infected with the two viral strains were tested and compared by RNA-Seq and LC-MS, respectively, in the differentiating grapevine genotype. In vines infected with the severe GFLV strain, 1023 genes, among which some are implicated in the regulation of the hypersensitive-type response, were specifically deregulated, and a higher accumulation of resveratrol and phytohormones was observed. Interestingly, some experimental vines restricted the virus to the rootstock and remained symptomless. Our results suggest that GFLV induces a strain- and cultivar-specific defense reaction similar to a hypersensitive reaction. This type of defense leads to a severe stunting phenotype in some grapevines, whereas others are resistant. This work is the first evidence of a hypersensitive-like reaction in grapevine during virus infection.

Evidence of differential spreading events of grapevine pinot Gris virus in Italy using datamining as a tool.

Since its identification in 2003, grapevine Pinot gris virus (GPGV, Trichovirus) has now been detected in most grape-growing countries. So far, little is known about the epidemiology of this newly emerging virus. In this work, we used datamining as a tool to monitor in-silico the sanitary status of three vineyards in Italy. All data used in the study were recovered from a work that was already published and for which data were publicly available as SRA (Sequence Read Archive, NCBI) files. While incomplete, knowledge gathered from this work was still important, with evidence of differential accumulation of the virus in grapevine according to year, location, and variety-rootstock association. Additional data regarding GPGV genetic diversity were collected. Some advantages and pitfalls of datamining are discussed.

First report of Grapevine enamovirus 1 in Vitis vinifera cultivar 'Meunier' in France.

Grapevine enamovirus 1 (GEV-1) is a member of the genus Enamovirus in the family Solemoviridae. GEV-1 was first described in 2017 in a few grapevine cultivars in Brazil (Silva et al. 2017) and subsequently in China (Ren et al. 2021). We first identified GEV-1 using high throughput sequencing (Illumina, NOVASeq SP, TruSeq mRNA stranded 2*150 bp) of ribosomal RNA depleted total RNAs extracts using RNeasy Plant mini kit) (Qiagen) from a Vitis vinifera 'Meunier' leaf sample collected in a more than 20 year old commercial vineyard in the Champagne region of France in 2019. Analyses of the 47,573,330 total reads were performed using CLC Genomics Workbench 12.0 software (Qiagen) as previously described (Hily et al. 2018). The GEV-1 genome, determined only from the HTS data (isolate GEV-1-Fr; GenBank accession No. MW760844), is 6 262 nucleotides (nt) long and fully covered with 5,706 reads (mapping parameters of 0,5 in length and 0,7 in similarity fractions using CLC). Compared with the previously determined sequences (NC_034836 and KX645875) from Brazil, the GEV-1-Fr sequence contain a few indels, including a deletion of 9 nt in the 5' untranslated region (UTR), an insertion of 3 nt located in the overlapping region of the open reading frame (ORF)1 and ORF2, and a single nt insertion in the non-coding region between ORF2 and ORF3. These indels also exist within the sequence of isolate SD-CG from China (MT536978). However, GEV-1-Fr contains a unique 45 nt insertion in the 3'-UTR, although this needs to be verified using standard assays. Overall, GEV-1-Fr exhibits 88.7, 89.1 and 93.3 % identity at the nt level with isolates from Brazil (NC_034836, KX645875) and China (MT536978), respectively. The GEV-1-infected 'Meunier' grapevine showed symptoms of light chlorotic patterns on the leaves that were probably due to the presence of other co-infecting viruses, including Grapevine fanleaf virus, Grapevine Pinot gris virus, Grapevine rupestris stem pitting-associated virus and Grapevine fleck virus. The detection of GEV-1 was further confirmed in the 'Meunier' grapevine via RT-PCR using newly designed primer pairs Fwd_GEV_5600: GCAAGGAGCAGCCCTATAATGCT and Rev_GEV_6075: CTAGTCGATACGATCTATAGGCGAGG that amplified a 474 bp fragment of ORF5. We also designed a TaqManTM assay in OFR5 with the following primers and probe; Fwd_GEV_5662: ACAAGTGCCYGTTTCCATAG, Probe_GEV_5724-FAM: TTTACCGAGGACTATGACGCCGC, Rev_GEV_5772: CACCGGCTCCATAACCATT. Among all the samples from different grapevine cultivars and geographic regions in France that were tested with the TaqMan assay (N=188), only the original 'Meunier' plant from Champagne was positive for GEV-1. To our knowledge, this is the first report of GEV-1 in France and in European vineyards in general. Although many aspects of the virus biology are yet to be elucidated, our results expand its geographical range. New GEV-1 detection primers can be developed, considering its genetic diversity, to facilitate its detection and further define its evolutionary history. Compared to the original sequences (NC_034836 and KX645875) in Brazil a few indels have been identified, including a deletion of 9nt located in the 5' untranslated region (UTR), an insertion of 3nt located in the overlapping region of the open reading frame (ORF)1 and ORF2 and a single nucleotide insertion in the non-coding region between ORF2 and ORF3. All indels were already described in the Chinese sequence (MT536978). However, this new GEV-1-Fr isolate is the only one that displays a 45nt insertion in the 3'-UTR. Overall, GEV-1-Fr exhibits 88.7, 89.1 and 93.3 % identity with isolates from Brazil (NC_034836, KX645875) and China (MT536978), respectively. No specific symptoms were observed in the GEV-1-infected 'Meunier' grapevine other than light chlorotic patterns on the leaves that were probably due to the presence of other virus, as this plant was co-infected with grapevine fanleaf virus (GFLV), grapevine Pinot gris virus (GPGV), grapevine rupestris stem pitting-associated virus (GRSPaV) and grapevine fleck virus (GFkV). The detection of GEV-1 was further confirmed via RT-PCR using newly designed primer pairs located in the 'aphid transmission protein' producing a 474 nt amplicon; Fwd_GEV_5600: GCAAGGAGCAGCCCTATAATGCT; Rev_GEV_6075: CTAGTCGATACGATCTATAGGCGAGG. GEV-1 was detected in all cuttings (N=15) obtained from the original plant. We also designed a tool for a TaqManTM-based detection in the same genome region as mentioned above; Fwd_GEV_5662: ACAAGTGCCYGTTTCCATAG; Probe_GEV_5724-FAM: TTTACCGAGGACTATGACGCCGC; Rev_GEV_5772: CACCGGCTCCATAACCATT. Among all the samples from different grapevine cultivars and geographic regions in France that were tested with the TaqMan assay (N=188), only the original 'Meunier' plant from Champagne was found positive for GEV-1 in gapevine in France.

Characterization of a DCL2-Insensitive Tomato Bushy Stunt Virus Isolate Infecting Arabidopsis thaliana.

Tomato bushy stunt virus (TBSV), the type member of the genus Tombusvirus in the family Tombusviridae is one of the best studied plant viruses. The TBSV natural and experimental host range covers a wide spectrum of plants including agricultural crops, ornamentals, vegetables and Nicotiana benthamiana. However, Arabidopsis thaliana, the well-established model organism in plant biology, genetics and plant-microbe interactions is absent from the list of known TBSV host plant species. Most of our recent knowledge of the virus life cycle has emanated from studies in Saccharomyces cerevisiae, a surrogate host for TBSV that lacks crucial plant antiviral mechanisms such as RNA interference (RNAi). Here, we identified and characterized a TBSV isolate able to infect Arabidopsis with high efficiency. We demonstrated by confocal and 3D electron microscopy that in Arabidopsis TBSV-BS3Ng replicates in association with clustered peroxisomes in which numerous spherules are induced. A dsRNA-centered immunoprecipitation analysis allowed the identification of TBSV-associated host components including DRB2 and DRB4, which perfectly localized to replication sites, and NFD2 that accumulated in larger viral factories in which peroxisomes cluster. By challenging knock-out mutants for key RNAi factors, we showed that TBSV-BS3Ng undergoes a non-canonical RNAi defensive reaction. In fact, unlike other RNA viruses described, no 22nt TBSV-derived small RNA are detected in the absence of DCL4, indicating that this virus is DCL2-insensitive. The new Arabidopsis-TBSV-BS3Ng pathosystem should provide a valuable new model for dissecting plant-virus interactions in complement to Saccharomyces cerevisiae.

Structural basis of nanobody recognition of grapevine fanleaf virus and of virus resistance loss.

Grapevine fanleaf virus (GFLV) is a picorna-like plant virus transmitted by nematodes that affects vineyards worldwide. Nanobody (Nb)-mediated resistance against GFLV has been created recently, and shown to be highly effective in plants, including grapevine, but the underlying mechanism is unknown. Here we present the high-resolution cryo electron microscopy structure of the GFLV-Nb23 complex, which provides the basis for molecular recognition by the Nb. The structure reveals a composite binding site bridging over three domains of one capsid protein (CP) monomer. The structure provides a precise mapping of the Nb23 epitope on the GFLV capsid in which the antigen loop is accommodated through an induced-fit mechanism. Moreover, we uncover and characterize several resistance-breaking GFLV isolates with amino acids mapping within this epitope, including C-terminal extensions of the CP, which would sterically interfere with Nb binding. Escape variants with such extended CP fail to be transmitted by nematodes linking Nb-mediated resistance to vector transmission. Together, these data provide insights into the molecular mechanism of Nb23-mediated recognition of GFLV and of virus resistance loss.

Detection of Multiple Variants of Grapevine Fanleaf Virus in Single Xiphinema index Nematodes.

Grapevine fanleaf virus (GFLV) is responsible for a widespread disease in vineyards worldwide. Its genome is composed of two single-stranded positive-sense RNAs, which both show a high genetic diversity. The virus is transmitted from grapevine to grapevine by the ectoparasitic nematode Xiphinema index. Grapevines in diseased vineyards are often infected by multiple genetic variants of GFLV but no information is available on the molecular composition of virus variants retained in X. index following nematodes feeding on roots. In this work, aviruliferous X. index were fed on three naturally GFLV-infected grapevines for which the virome was characterized by RNAseq. Six RNA-1 and four RNA-2 molecules were assembled segregating into four and three distinct phylogenetic clades of RNA-1 and RNA-2, respectively. After 19 months of rearing, single and pools of 30 X. index tested positive for GFLV. Additionally, either pooled or single X. index carried multiple variants of the two GFLV genomic RNAs. However, the full viral genetic diversity found in the leaves of infected grapevines was not detected in viruliferous nematodes, indicating a genetic bottleneck. Our results provide new insights into the complexity of GFLV populations and the putative role of X. index as reservoirs of virus diversity.

Comparison of Serological and Molecular Methods With High-Throughput Sequencing for the Detection and Quantification of Grapevine Fanleaf Virus in Vineyard Samples.

Grapevine fanleaf virus (GFLV) is the main causal agent of fanleaf degeneration, the most damaging viral disease of grapevine. GFLV is included in most grapevine certification programs that rely on robust diagnostic tools such as biological indexing, serological methods, and molecular techniques, for the identification of clean stocks. The emergence of high throughput sequencing (HTS) offers new opportunities for detecting GFLV and other viruses in grapevine accessions of interest. Here, two HTS-based methods, i.e., RNAseq and smallRNAseq (focusing on the 21 to 27 nt) were explored for their potential to characterize the virome of grapevine samples from two 30-year-old GFLV-infected vineyards in the Champagne region of France. smallrnaseq was optimal for the detection of a wide range of viral species within a sample and RNAseq was the method of choice for full-length viral genome assembly. The implementation of a protocol to discriminate between low GFLV titer and in silico contamination (intra-lane contamination due to index misassignment) during data processing was critical for data analyses. Furthermore, we compared the performance of semi-quantitative DAS-ELISA (double antibody enzyme-linked immunosorbent assay), RT-qPCR (Reverse transcription-quantitative polymerase chain reaction), Immuno capture (IC)-RT-PCR, northern blot for viral small interfering RNA (vsiRNA) detection and RNAseq for the detection and quantification of GFLV. While detection limits were variable among methods, as expected, GFLV diagnosis was consistently achieved with all of these diagnostic methods. Together, this work highlights the robustness of DAS-ELISA, the current method routinely used in the French grapevine certification program, for the detection of GFLV and offers perspectives on the potential of HTS as an approach of high interest for certification.

Grapevine virus T diversity as revealed by full-length genome sequences assembled from high-throughput sequence data.

RNASeq or double-stranded RNA based approaches allowed the reconstruction of a total of 9 full-length or near full-length genomes of the recently discovered grapevine virus T (GVT). In addition, datamining of publicly available grapevine RNASeq transcriptome data allowed the reconstruction of a further 14 GVT genomes from five grapevine sources. Together with four GVT sequences available in Genbank, these novel sequences were used to analyse GVT diversity. GVT shows a very limited amount of indels variation but a high level of nucleotide and aminoacid polymorphism. This level is comparable to that shown in the closely related grapevine rupestris stem pitting-associated virus (GRSPaV). Further analyses showed that GVT mostly evolves under conservative selection pressure and that recombination has contributed to its evolutionary history. Phylogenetic analyses allow to identify at least seven clearly separated groups of GVT isolates. Analysis of the only reported PCR GVT-specific detection primer pair indicates that it is likely to fail to amplify some GVT isolates. Taken together these results point at the distinctiveness of GVT but also at the many points it shares with GRSPaV. They constitute the first pan-genomic analysis of the diversity of this novel virus.

High-Throughput Sequencing and the Viromic Study of Grapevine Leaves: From the Detection of Grapevine-Infecting Viruses to the Description of a New Environmental Tymovirales Member.

In the past decade, high-throughput sequencing (HTS) has had a major impact on virus diversity studies as well as on diagnosis, providing an unbiased and more comprehensive view of the virome of a wide range of organisms. Rather than the serological and molecular-based methods, with their more "reductionist" view focusing on one or a few known agents, HTS-based approaches are able to give a "holistic snapshot" of the complex phytobiome of a sample of interest. In grapevine for example, HTS is powerful enough to allow for the assembly of complete genomes of the various viral species or variants infecting a sample of known or novel virus species. In the present study, a total RNAseq-based approach was used to determine the full genome sequences of various grapevine fanleaf virus (GFLV) isolates and to analyze the eventual presence of other viral agents. From four RNAseq datasets, a few complete grapevine-infecting virus and viroid genomes were de-novo assembled: (a) three GFLV genomes, 11 grapevine rupestris stem-pitting associated virus (GRSPaV) and six viroids. In addition, a novel viral genome was detected in all four datasets, consisting of a single-stranded, positive-sense RNA molecule of 6033 nucleotides. This genome displays an organization similar to Tymoviridae family members in the Tymovirales order. Nonetheless, the new virus shows enough differences to be considered as a new species defining a new genus. Detection of this new agent in the original grapevines proved very erratic and was only consistent at the end of the growing season. This virus was never detected in the spring period, raising the possibility that it might not be a grapevine-infecting virus, but rather a virus infecting a grapevine-associated organism that may be transiently present on grapevine samples at some periods of the year. Indeed, the Tymoviridae family comprises isometric viruses infecting a wide range of hosts in different kingdoms (Plantae, Fungi, and Animalia). The present work highlights the fact that even though HTS technologies produce invaluable data for the description of the sanitary status of a plant, in-depth biological studies are necessary before assigning a new virus to a particular host in such metagenomic approaches.

Virus preparations from the mixed-infected P70 Pinot Noir accession exhibit GLRaV-1/GVA 'end-to-end' particles.

P70 is a Pinot Noir grapevine accession that displays strong leafroll disease symptoms. A high-throughput sequencing (HTS)-based analysis established that P70 was mixed-infected by two variants of grapevine leafroll-associated virus 1 (GLRaV-1, genus Ampelovirus) and one of grapevine virus A (GVA, genus Vitivirus) as well as by two viroids (hop stunt viroid [HSVd] and grapevine yellow speckle viroid 1 [GYSVd1]) and four variants of grapevine rupestris stem pitting-associated virus (GRSPaV). Immunogold labelling using gold particles of two different diameters revealed the existence of 'hybrid' particles labelled at one end as GLRaV-1, with the rest labelled as GVA. In this work, we suggest that immunogold labelling can provide information about the biology of the viruses, going deeper than just genomic information provided by HTS, from which no recombinant or 'chimeric' GLRaV-1/GVA sequences had been identified in the dataset. Our observations suggest an unknown interaction between members of two different viral species that are often encountered together in a single grapevine, highlighting potential consequences in the vector biology and epidemiology of leafroll and rugose-wood diseases.

A genome-wide diversity study of grapevine rupestris stem pitting-associated virus.

Over the last decade, many scientific disciplines have been impacted by the dawn of new sequencing techniques (HTS: high throughput sequencing). Plant pathology and more specifically virology have been greatly transformed by this 'metagenomics' paradigm shift. Such tools significantly facilitate disease diagnostics with tremendous sensitivity, providing invaluable information such as an exhaustive list of viruses being present in a sample as well as their relative concentration. In addition, many new plant viruses have been discovered. Using RNAseq technology, in silico reconstruction of complete viral genome sequences is easily attainable. This step is of importance for taxonomy, population structure analyses, phylogeography and viral evolution studies. Here, after assembling 81 new near-complete genome sequences of grapevine rupestris stem pitting-associated virus (GRSPaV), we performed a genome-wide diversity study of this ubiquitous virus of grapevine worldwide.

A complex virome unveiled by deep sequencing analysis of RNAs from a French Pinot Noir grapevine exhibiting strong leafroll symptoms.

We have characterized the virome of a grapevine Pinot Noir accession (P70) that displayed, over the year, very stable and strong leafroll symptoms. For this, we have used two extraction methods (dsRNA and total RNA) coupled with the high throughput sequencing (HTS) Illumina technique. While a great disparity in viral sequences were observed, both approaches gave similar results, revealing a very complex infection status. Five virus and viroid isolates [Grapevine leafroll-associated viruse-1 (GLRaV-1), Grapevine virus A (GVA), Grapevine rupestris stem pitting-associated virus (GRSPaV), Hop stunt viroid (HSVd) and Grapevine yellow speckle viroid 1 (GYSVd1)] were detected in P70 with a grand total of eleven variants being identified and de novo assembled. A comparison between both extraction methods regarding their power to detect viruses and the ease of genome assembly is also provided.

Metagenomic-based impact study of transgenic grapevine rootstock on its associated virome and soil bacteriome.

For some crops, the only possible approach to gain a specific trait requires genome modification. The development of virus-resistant transgenic plants based on the pathogen-derived resistance strategy has been a success story for over three decades. However, potential risks associated with the technology, such as horizontal gene transfer (HGT) of any part of the transgene to an existing gene pool, have been raised. Here, we report no evidence of any undesirable impacts of genetically modified (GM) grapevine rootstock on its biotic environment. Using state of the art metagenomics, we analysed two compartments in depth, the targeted Grapevine fanleaf virus (GFLV) populations and nontargeted root-associated microbiota. Our results reveal no statistically significant differences in the genetic diversity of bacteria that can be linked to the GM trait. In addition, no novel virus or bacteria recombinants of biosafety concern can be associated with transgenic grapevine rootstocks cultivated in commercial vineyard soil under greenhouse conditions for over 6 years.

Overexpression of the CYP51A1 Gene and Repeated Elements are Associated with Differential Sensitivity to DMI Fungicides in Venturia inaequalis.

The involvement of overexpression of the CYP51A1 gene in Venturia inaequalis was investigated for isolates exhibiting differential sensitivity to the triazole demethylation inhibitor (DMI) fungicides myclobutanil and difenoconazole. Relative expression (RE) of the CYP51A1 gene was significantly greater (P < 0.0001) for isolates with resistance to both fungicides (MRDR phenotype) or with resistance to difenoconazole only (MSDR phenotype) compared with isolates that were resistant only to myclobutanil (MRDS phenotype) or sensitive to both fungicides (MSDS phenotype). An average of 9- and 13-fold increases in CYP51A1 RE were observed in isolates resistant to difenoconazole compared with isolates with MRDS and MSDS phenotypes, respectively. Linear regression analysis between isolate relative growth on myclobutanil-amended medium and log10 RE revealed that little to no variability in sensitivity to myclobutanil could be explained by CYP51A1 overexpression (R(2) = 0.078). To investigate CYP51A1 upstream anomalies associated with CYP51A1 overexpression or resistance to difenoconazole, Illumina sequencing was conducted for three isolates with resistance to difenoconazole and one baseline isolate. A repeated element, "EL 3,1,2", with the properties of a transcriptional enhancer was identified two to four times upstream of CYP51A1 in difenoconazole-resistant isolates but was not found in isolates with the MRDS phenotype. These results suggest that different mechanisms may govern resistance to different DMI fungicides in the triazole group.

Environment and host genotype determine the outcome of a plant-virus interaction: from antagonism to mutualism.

It has been hypothesized that plant-virus interactions vary between antagonism and conditional mutualism according to environmental conditions. This hypothesis is based on scant experimental evidence, and to test it we examined the effect of abiotic factors on the Arabidopsis thaliana-Cucumber mosaic virus (CMV) interaction. Four Arabidopsis genotypes clustering into two allometric groups were grown under six environments defined by three temperature and two light-intensity conditions. Plants were either CMV-infected or mock-inoculated, and the effects of environment and infection on temporal and resource allocation life-history traits were quantified. Life-history traits significantly differed between allometric groups over all environments, with group 1 plants tolerating abiotic stress better than those of group 2. The effect of CMV infection on host fitness (virulence) differed between genotypes, being lower in group 1 genotypes. Tolerance to abiotic stress and to infection was similarly achieved through life-history trait responses, which resulted in resource reallocation from growth to reproduction. Effects of infection varied according to plant genotype and environment from detrimental to beneficial for host fitness. These results are highly relevant and demonstrate that plant viruses can be pleiotropic parasites along the antagonism-mutualism continuum, which should be considered in analyses of the evolution of plant-virus interactions.

The relationship between host lifespan and pathogen reservoir potential: an analysis in the system Arabidopsis thaliana--cucumber mosaic virus.

Identification of the determinants of pathogen reservoir potential is central to understand disease emergence. It has been proposed that host lifespan is one such determinant: short-lived hosts will invest less in costly defenses against pathogens, so that they will be more susceptible to infection, more competent as sources of infection and/or will sustain larger vector populations, thus being effective reservoirs for the infection of long-lived hosts. This hypothesis is sustained by analyses of different hosts of multihost pathogens, but not of different genotypes of the same host species. Here we examined this hypothesis by comparing two genotypes of the plant Arabidopsis thaliana that differ largely both in life-span and in tolerance to its natural pathogen Cucumber mosaic virus (CMV). Experiments with the aphid vector Myzus persicae showed that both genotypes were similarly competent as sources for virus transmission, but the short-lived genotype was more susceptible to infection and was able to sustain larger vector populations. To explore how differences in defense against CMV and its vector relate to reservoir potential, we developed a model that was run for a set of experimentally-determined parameters, and for a realistic range of host plant and vector population densities. Model simulations showed that the less efficient defenses of the short-lived genotype resulted in higher reservoir potential, which in heterogeneous host populations may be balanced by the longer infectious period of the long-lived genotype. This balance was modulated by the demography of both host and vector populations, and by the genetic composition of the host population. Thus, within-species genetic diversity for lifespan and defenses against pathogens will result in polymorphisms for pathogen reservoir potential, which will condition within-population infection dynamics. These results are relevant for a better understanding of host-pathogen co-evolution, and of the dynamics of pathogen emergence.