Persistent of respiratory syncytial virus in human dendritic cells and influence of nitric oxide.

The annual epidemics of respiratory syncytial virus (RSV) infection are probably explained by poor herd immunity and the existence of a dormant reservoir of virus that is activated by an unknown trigger. The virus causes particular problems in infants, the elderly and patients with chronic obstructive airways disease (COPD). During two consecutive winters, human monocyte-derived dendritic cells (DCs) were exposed on a single occasion to one of two forms of RSV labelled with a fluorescent expresser genes (rgRSV or rrRSV) during the epidemic season. The cultures were maintained for many months, with fresh DCs being added at monthly intervals. The cultures were variously exposed to 600 parts per billion (ppb) nitric oxide for 15 min, nitric oxide (NO) donors and NO inhibitors outside the RSV epidemic season. The pattern of productive infection of DCs in vitro appeared to parallel the natural epidemics, in that DCs exhibited evidence of viral replication and productive infection only as manifested by intracellular fluorescence and infection of HeLa cells during the RSV epidemic season. When the long-term cultures were exposed to the above agents outside the RSV epidemic season there was again evidence of vigorous replication and productive infection, as shown by the reappearance of fluorescence and productive infection of HeLa cells. The results indicate that RSV may remain dormant in dendritic cells for prolonged periods and that replication appears to be activated by suppression of endogenous NO production. These observations may be key to our understanding of the mechanisms contributing to the annual epidemics of RSV infection.

An assessment of exposure indices in computed radiography for the posterior-anterior chest and the lateral lumbar spine.

Studies have indicated that computed radiography (CR) can increase radiation dose to the patient, leading to potential biological effects. Although manufacturers have set parameters to safeguard against overexposure, it is unclear whether these are being used by radiographers or if their recommended values are consistent with the ALARA principle. The research aims are to investigate (i) whether radiographers are producing images with exposure indices within the manufacturers recommended range (MRR); (ii) the phenomenon of exposure creep, and (iii) the relationship between exposure indices (EIs) and radiation dose. A retrospective analysis of exposure indices over an 18-month period for the posteroanterior (PA) chest and lateral (LAT) lumbar spine at two centres using Kodak 800 and 850 CR systems was conducted. A phantom study was performed to assess the relationship between EI and entrance surface dose (ESD) for fixed and varying tube potentials. Kodak recommends that images have EIs between 1700 and 1900. Thirty percent of LAT lumbar spine examinations at hospital B and 38% of PA chest examinations at hospital A were produced with EIs below 1700. In the phantom study, when using a varied tube potential (70-125 kVp) and maintaining a constant EI of 1550, ESD was reduced by 56%. All clinical and phantom images were assessed to be of a diagnostic quality. The retrospective results indicate that there is a potential to reduce the MRR and optimize patient dose. There is also evidence to suggest that EI is not a reliable indicator of patient dose. The authors recommend that staff training is essential on these newer systems.

Differentiation and immune function of human dendritic cells following infection by respiratory syncytial virus.

RSV causes annual epidemics of bronchiolitis in winter months resulting in the hospitalization of many infants and the elderly. Dendritic cells (DCs) play a pivotal role in coordinating immune responses to infection and some viruses skew, or subvert, the immune functions of DCs. RSV infection of DCs could alter their function and this could explain why protection after natural RSV infection is incomplete and of short duration. In this study, this interaction between DCs and RSV was investigated using a human primary culture model. DCs were generated from purified healthy adult volunteer peripheral blood monocytes. Effects of RSV upon DC phenotype with RSV primed DCs was measured using flow cytometry. Changes to viability and proliferation of cocultured DCs and T-cells were determined using microscopy with fluorescent dyes (Hoechst 33342 and propidium iodide). DC maturation was not prevented by the RSV challenge. RSV infected a fraction of DCs (10-30%) but the virus replicated slowly in these cells with only small reduction to cell viability. DCs challenged with RSV stimulated T-cell proliferation less well than lipopolysaccharide. This is the first study to demonstrate RSV infection of human monocyte derived DCs and suggests that the virus does not significantly interfere with the function of these cells and potentially may promote cellular rather than humoral responses.

Common chromosomal fragile site FRA16D sequence: identification of the FOR gene spanning FRA16D and homozygous deletions and translocation breakpoints in cancer cells.

Fluorescence in situ hybridization of a tile path of DNA subclones has previously enabled the cyto-genetic definition of the minimal DNA sequence which spans the FRA16D common chromosomal fragile site, located at 16q23.2. Homozygous deletion of the FRA16D locus has been reported in adenocarcinomas of stomach, colon, lung and ovary. We have sequenced the 270 kb containing the FRA16D fragile site and the minimal homozygously deleted region in tumour cells. This sequence enabled localization of some of the tumour cell breakpoints to regions which contain AT-rich secondary structures similar to those associated with the FRA10B and FRA16B rare fragile sites. The FRA16D DNA sequence also led to the identification of an alternatively spliced gene, named FOR (fragile site FRA16D oxidoreductase), exons of which span both the fragile site and the minimal region of homozygous deletion. In addition, the complete DNA sequence of the FRA16D-containing FOR intron reveals no evidence of additional authentic transcripts. Alternatively spliced FOR transcripts (FOR I, FOR II and FOR III) encode proteins which share N-terminal WW domains and differ at their C-terminus, with FOR III having a truncated oxidoreductase domain. FRA16D-associated deletions selectively affect the FOR gene transcripts. Three out of five previously mapped translocation breakpoints in multiple myeloma are also located within the FOR gene. FOR is therefore the principle genetic target for DNA instability at 16q23.2 and perturbation of FOR function is likely to contribute to the biological consequences of DNA instability at FRA16D in cancer cells.

Chromosomal fragile site FRA16D and DNA instability in cancer.

It has been proposed that common aphidicolin-inducible fragile sites, in general, predispose to specific chromosomal breakage associated with deletion, amplification, and/or translocation in certain forms of cancer. Although this appears to be the case for the fragile site FRA3B and may be the case for FRA7G, it is not yet clear whether this association is a general property of this class of fragile site. The major aim of the present study was to determine whether the FRA16D chromosomal fragile site locus has a role to play in predisposing DNA sequences within and adjacent to the fragile site to DNA instability (such as deletion or translocation), which could lead to or be associated with neoplasia. We report the localization of FRA16D within a contig of cloned DNA and demonstrate that this fragile site coincides with a region of homozygous deletion in a gastric adenocarcinoma cell line and is bracketed by translocation breakpoints in multiple myeloma, as reported previously (Chesi, M., et al., Blood, 91: 4457-4463, 1998). Therefore, given similar findings at the FRA3B and FRA7G fragile sites, it is likely that common aphidicolin-inducible fragile sites exhibit the general property of localized DNA instability in cancer cells.

Cure of human carcinoma xenografts by a single dose of pretargeted yttrium-90 with negligible toxicity.

A covalent conjugate (NR-LU-10/SA) was prepared between streptavidin (SA) and NR-LU-10, a mAb that binds an antigen expressed on the surface of most human carcinomas. NR-LU-10/SA was injected into nude mice bearing human tumor xenografts. Injection of biotinylated galactosyl-human serum albumin reduced the circulating levels of conjugate by 95%. Subsequent administration of (90)Y-1,4,7, 10-tetraazacyclododecane-1,4,7,10-tetraacetic acid-biotin achieved peak uptake at the tumor within 2 hr while >80% of the radioactivity was eliminated in the urine. A single dose of 600-800 microCi of (90)Y-1,4,7,10-tetraazacyclododecane-1,4,7,10-tetraacetic acid-biotin produced cures in 10/10 mice with established (>200 mm(3)) s.c. human small cell lung or colon cancer xenografts and 8/10 cures in mice with human breast cancer xenografts without significant toxicity.

Formation and structure of artificial cellulose spherulites via enzymatic polymerization.

The in-depth structural analysis of spherulites of artificial cellulose, formed by the enzymatic polymerization of cellobiosyl fluoride, is reported. Both positive- and negative-type spherulites were observed by polarization optical microscopy. Scanning electron microscopy revealed that the negative spherulites have a three-dimensional round shape, where platelike single crystals of the artificial cellulose originate radially from the center. Transmission electron microscopy confirmed that the cellulose chains orient vertically in the platelike crystals, explaining the observation of negative-type spherulites by polarization optical microscopy. Cellulose spherulites can be formed easily via the enzymatic polymerization process, and the occurrence of both positive- and negative-type spherulites is proposed, due to two independent polymerization mechanisms.

FRA10B structure reveals common elements in repeat expansion and chromosomal fragile site genesis.

A common mechanism for chromosomal fragile site genesis is not yet apparent. Folate-sensitive fragile sites are expanded p(CCG)n repeats that arise from longer normal alleles. Distamycin A or bromodeoxyuridine-inducible fragile site FRA16B is an expanded AT-rich approximately 33 bp repeat; however, the relationship between normal and fragile site alleles is not known. Here, we report that bromodeoxyuridine-inducible, distamycin A-insensitive fragile site FRA10B is composed of expanded approximately 42 bp repeats. Differences in repeat motif length or composition between different FRA10B families indicate multiple independent expansion events. Some FRA10B alleles comprise a mixture of different expanded repeat motifs. FRA10B fragile site and long normal alleles share flanking polymorphisms. Somatic and intergenerational FRA10B repeat instability analogous to that found in expanded trinucleotide repeats supports dynamic mutation as a common mechanism for repeat expansion.

Simplified preformed chelate protein radiolabeling with technetium-99m mercaptoacetamidoadipoylglycylglycine (N3S-adipate).

A simplified kiet has been developed for 99mTc protein radiolabeling using an N3S triamide mercaptide bifunctional chelating agent and the preformed chelate approach. The process combined N3S chelating agent, gluconate intermediate transfer agent, stannous reducing agent, and gentisic acid stabilizer into a lyophilized formulation. With sulfur donor atom hemithioacetal protection of the ligand, delta-2,3,5,6-tetrafluorothiophenyl alpha-S-(1-ethoxyethyl)mercaptoacetamido-L-adipoylglycylglycine , optimum 99mTc chelation was achieved in a single step. Subsequent reaction with NR-LU-10 antibody Fab fragment followed by purification via QAE Sephadex anion exchange resin filter afforded 99mTc-N3S-NR-LU-10 Fab conjugate with retained immunoreactivity and effective tumor targeting properties.

Genetic heterogeneity in familial acute myelogenous leukemia: evidence for a second locus at chromosome 16q21-23.2.

The identification of genes responsible for the rare cases of familial leukemia may afford insight into the mechanism underlying the more common sporadic occurrences. Here we test a single family with 11 relevant meioses transmitting autosomal dominant acute myelogenous leukemia (AML) and myelodysplasia for linkage to three potential candidate loci. In a different family with inherited AML, linkage to chromosome 21q22.1-22.2 was recently reported; we exclude linkage to 21q22.1-22.2, demonstrating that familial AML is a heterogeneous disease. After reviewing familial leukemia and observing anticipation in the form of a declining age of onset with each generation, we had proposed 9p21-22 and 16q22 as additional candidate loci. Whereas linkage to 9p21-22 can be excluded, the finding of a maximum two-point LOD score of 2.82 with the microsatellite marker D16S522 at a recombination fraction theta = 0 provides evidence supporting linkage to 16q22. Haplotype analysis reveals a 23.5-cM (17.9-Mb) commonly inherited region among all affected family members extending from D16S451 to D16S289. In order to extract maximum linkage information with missing individuals, incomplete informativeness with individual markers in this interval, and possible deviance from strict autosomal dominant inheritance, we performed nonparametric linkage analysis (NPL) and found a maximum NPL statistic corresponding to a P-value of .00098, close to the maximum conditional probability of linkage expected for a pedigree with this structure. Mutational analysis in this region specifically excludes expansion of the AT-rich minisatellite repeat FRA16B fragile site and the CAG trinucleotide repeat in the E2F-4 transcription factor. The "repeat expansion detection" method, capable of detecting dynamic mutation associated with anticipation, more generally excludes large CAG repeat expansion as a cause of leukemia in this family.

Human chromosomal fragile site FRA16B is an amplified AT-rich minisatellite repeat.

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)n trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATA TTATATATTATATCTAATAATATATC/ATA)n (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Life domains and adaptive strategies of a group of low-income, well older adults.

Older adults are at increased risk for a variety of physical and functional limitations that threaten their ability to lead independent and fulfilling lives. Consequently, they stand to benefit from personalized strategies of adaptation that enable them to achieve successful outcomes in their daily activities and desired goals. In the current investigation, a qualitative descriptive methodology was used to document the perceived life domains of importance and associated strategies of adaptation of 29 residents of Angelus Plaza, a federally subsidized apartment complex in downtown Los Angeles for low-income, well older adults. On the basis of interview data, 10 life domains were identified, and within each domain, a typology of adaptive strategies was derived. The domains were activities of daily living (ADL), adaptation to a multicultural environment, free time usage, grave illness and death-spirituality, health maintenance, mobility maintenance, personal finances, personal safety, psychological well-being and happiness, and relationships with others. Although the typology should not be generalized to a geriatric population, therapists may wish to refer to it to gain a sense of the extent to which certain adaptive strategies may be applicable to the lives of particular older adults to whom they deliver services. The teaching of these adaptive strategies could then be incorporated into an individualized treatment plan. The typology also provides a broad picture of the kinds of adaptive strategies used by the older adults as a way of coping and adapting to their setting. Although some of the domains do not differ from those typically addressed in occupational therapy textbooks on geriatric care (e.g., ADL, health maintenance), others seem uniquely tailored to the specifics of the Angelus Plaza context (e.g., personal safety). Finally, certain domains emerged that may be highly relevant to older adults in most settings but are not typically the focus of occupational therapy programs (e.g., grave illness and death-spirituality, relationships with others). The emergence of these domains from our data suggests that therapists may wish to consider them more in treatment if they are convinced that they possess local relevance.

Varying Photoperiod, Ribulose 1,5-Bisphosphate Carboxylase/Oxygenase and CO(2) Uptake in Thalassiosira fluviatilis (Bacillariophyceae).

The purpose of this research was to test the hypothesis that acclimation of the unicellular marine alga, Thalassiosira fluviatilis Hustedt, to short photoperiods results in decreased cellular concentrations of ribulose 1,5-bisphosphate carboxylase/oxygenase and decreased rates of light-saturated CO(2) uptake. Cells were acclimated to photoperiods of 6:18, 12:12, and 18:6 h:h light:dark, and concentrations of the large subunit of the enzyme and responses of CO(2) uptake to varying irradiance were measured. Concentrations of the large subunit, which weighed approximately 50 kilodaltons, were conserved while rates of CO(2) uptake under light saturation and limitation, and cellular contents of chlorophyll a increased as photoperiod decreased. Apparently, these cells acclimate to short photoperiods by increasing rates of CO(2) uptake under saturating irradiances by increasing in vivo activation of ribulose 1,5-bisphosphate carboxylase/oxygenase. Also, chlorophyll-specific concentrations and specific activities of the enzyme appear to be lower and higher, respectively, in diatomaceous algae than in higher plants.

A practical method for monitoring diagnostic radiation dosage in the newborn nursery.

Diagnostic radiation exposure in 133 consecutive newborns was studied using a TLD monitoring system. Eighty-eight per cent of dosimeters received less than 1 mSv (100 mrem) total exposure. The mean exposure per chest radiograph was 0.044 +/- 0.023 mSv (4.4 +/- 2.3 mrem). Abdominal surface exposure was 0.053 +/- 0.03 mSv (5.3 +/- 3.0 mrem) for boys and 0.044 +/- 0.021 mSv (4.4 +/- 2.1 mrem) for girls. The gonadal exposure, which was calculated from the abdominal exposure data, was 0.053 +/- 0.030 mSv (5.3 +/- 3.0 mrem) for boys and 0.026 +/- 0.012 mSv (2.6 +/- 1.2 mrem) for girls. The correction factor for beam attenuation over gonads in girls was 0.58. In general, the radiation received by these infants did not exceed the currently published protection limits.

Effects of Variations in Daylength and Temperature on Net Rates of Photosynthesis, Dark Respiration, and Excretion by Isochrysis galbana Parke.

The effects of variable daylength and temperature on net rates of photosynthesis, dark respiration, and excretion of a unicellular marine haptophyte, Isochrysis galbana Parke, were examined and related to division rates. Six combinations of daylength (18:6, 12:12, 6:18 light:dark, LD) and temperature (20, 25 C) were used. Daily rates of net photosynthesis were closely correlated to division rates, suggesting a direct relationship, and were maximal when cells were grown at 12:12 LD at both temperatures and 18:6 LD at 20 C. A daylength of 6 hours decreased daily rates by decreasing the time for carbon uptake. Further, cells grown with this daylength had maximal chlorophyll a contents, suggesting a physiological adaptation by photosynthetic units to short light periods. A photoperiod of 18:6 LD at 25 C decreased daily rates of net photosynthesis by reducing the hourly rate of net photosynthesis via an unidentified mechanism. The importance of rates of net dark respiration in controlling daily net photosynthesis was small, with carbon lost during dark periods varying between 4 and 14% of that gained during light periods. Also, the influence of net excretion was small, varying between 1.0 and 5.5% of daily net photosynthesis.

Radiographic artifacts caused by the laundering of flame-retardant materials.

Federal law now mandates the use of flame retardants in children's sleepwear, and regulations are pending in several areas to require their use in all hospital fabrics. These flame retardants produce radiographic artifacts due to their alteration of fabric surface properties. Knowledge of the cause of these problems and their solution should be of help in radiographic interpretation and should save patient expense and radiographic exposure.