Probing GPCR Dimerization Using Peptides.

G protein-coupled receptors (GPCRs) are the largest class of membrane proteins and the most common and extensively studied pharmacological target. Numerous studies over the last decade have confirmed that GPCRs do not only exist and function in their monomeric form but in fact, have the ability to form dimers or higher order oligomers with other GPCRs, as well as other classes of receptors. GPCR oligomers have become increasingly attractive to investigate as they have the ability to modulate the pharmacological responses of the receptors which in turn, could have important functional roles in diseases, such as cancer and several neurological & neuropsychiatric disorders. Despite the growing evidence in the field of GPCR oligomerisation, the lack of structural information, as well as targeting the 'undruggable' protein-protein interactions (PPIs) involved in these complexes, has presented difficulties. Outside the field of GPCRs, targeting PPIs has been widely studied, with a variety of techniques being investigated; from small-molecule inhibitors to disrupting peptides. In this review, we will demonstrate several physiologically relevant GPCR dimers and discuss an array of strategies and techniques that can be employed when targeting these complexes, as well as provide ideas for future development.

Modulation of dopamine D1 receptors via histamine H3 receptors is a novel therapeutic target for Huntington's disease.

Early Huntington's disease (HD) include over-activation of dopamine D1 receptors (D1R), producing an imbalance in dopaminergic neurotransmission and cell death. To reduce D1R over-activation, we present a strategy based on targeting complexes of D1R and histamine H3 receptors (H3R). Using an HD mouse striatal cell model and HD mouse organotypic brain slices we found that D1R-induced cell death signaling and neuronal degeneration, are mitigated by an H3R antagonist. We demonstrate that the D1R-H3R heteromer is expressed in HD mice at early but not late stages of HD, correlating with HD progression. In accordance, we found this target expressed in human control subjects and low-grade HD patients. Finally, treatment of HD mice with an H3R antagonist prevented cognitive and motor learning deficits and the loss of heteromer expression. Taken together, our results indicate that D1R - H3R heteromers play a pivotal role in dopamine signaling and represent novel targets for treating HD.

Design and development of stapled transmembrane peptides that disrupt the activity of G-protein-coupled receptor oligomers.

Membrane proteins can associate into larger complexes. Examples include receptor tyrosine complexes, ion channels, transporters, and G protein-coupled receptors (GPCRs). For the latter, there is abundant evidence indicating that GPCRs assemble into complexes, through both homo- and heterodimerization. However, the tools for studying and disrupting these complexes, GPCR or otherwise, are limited. Here, we have developed stabilized interference peptides for this purpose. We have previously reported that tetrahydrocannabinol-mediated cognitive impairment arises from homo- or heterooligomerization between the GPCRs cannabinoid receptor type 1 (CB1R) and 5-hydroxytryptamine 2A (5-HT2AR) receptors. Here, to disrupt this interaction through targeting CB1-5-HT2A receptor heteromers in HEK293 cells and using an array of biochemical techniques, including calcium and cAMP measurements, bimolecular fluorescence complementation assays, and CD-based helicity assessments, we developed a NanoLuc binary technology (NanoBiT)-based reporter assay to screen a small library of aryl-carbon-stapled transmembrane-mimicking peptides produced by solid-phase peptide synthesis. We found that these stapling peptides have increased α-helicity and improved proteolytic resistance without any loss of disrupting activity in vitro, suggesting that this approach may also have utility in vivo In summary, our results provide proof of concept for using NanoBiT to study membrane protein complexes and for stabilizing disrupting peptides to target such membrane complexes through hydrocarbon-mediated stapling. We propose that these peptides could be developed to target previously undruggable GPCR heteromers.

Singular Location and Signaling Profile of Adenosine A2A-Cannabinoid CB1 Receptor Heteromers in the Dorsal Striatum.

The dorsal striatum is a key node for many neurobiological processes such as motor activity, cognitive functions, and affective processes. The proper functioning of striatal neurons relies critically on metabotropic receptors. Specifically, the main adenosine and endocannabinoid receptors present in the striatum, ie, adenosine A2A receptor (A2AR) and cannabinoid CB1 receptor (CB1R), are of pivotal importance in the control of neuronal excitability. Facilitatory and inhibitory functional interactions between striatal A2AR and CB1R have been reported, and evidence supports that this cross-talk may rely, at least in part, on the formation of A2AR-CB1R heteromeric complexes. However, the specific location and properties of these heteromers have remained largely unknown. Here, by using techniques that allowed a precise visualization of the heteromers in situ in combination with sophisticated genetically modified animal models, together with biochemical and pharmacological approaches, we provide a high-resolution expression map and a detailed functional characterization of A2AR-CB1R heteromers in the dorsal striatum. Specifically, our data unveil that the A2AR-CB1R heteromer (i) is essentially absent from corticostriatal projections and striatonigral neurons, and, instead, is largely present in striatopallidal neurons, (ii) displays a striking G protein-coupled signaling profile, where co-stimulation of both receptors leads to strongly reduced downstream signaling, and (iii) undergoes an unprecedented dysfunction in Huntington's disease, an archetypal disease that affects striatal neurons. Altogether, our findings may open a new conceptual framework to understand the role of coordinated adenosine-endocannabinoid signaling in the indirect striatal pathway, which may be relevant in motor function and neurodegenerative diseases.

Design and Characterization of Superpotent Bivalent Ligands Targeting Oxytocin Receptor Dimers via a Channel-Like Structure.

Dimeric/oligomeric states of G-protein coupled receptors have been difficult to target. We report here bivalent ligands consisting of two identical oxytocin-mimetics that induce a three order magnitude boost in G-protein signaling of oxytocin receptors (OTRs) in vitro and a 100- and 40-fold gain in potency in vivo in the social behavior of mice and zebrafish. Through receptor mutagenesis and interference experiments with synthetic peptides mimicking transmembrane helices (TMH), we show that such superpotent behavior follows from the binding of the bivalent ligands to dimeric receptors based on a TMH1-TMH2 interface. Moreover, in this arrangement, only the analogues with a well-defined spacer length (∼25 Å) precisely fit inside a channel-like passage between the two protomers of the dimer. The newly discovered oxytocin bivalent ligands represent a powerful tool for targeting dimeric OTR in neurodevelopmental and psychiatric disorders and, in general, provide a framework to untangle specific arrangements of G-protein coupled receptor dimers.

Unveiling the "Three-Finger Pharmacophore" Required for p53-MDM2 Inhibition by Saturation-Transfer Difference (STD) NMR Initial Growth-Rates Approach.

Inhibitors of the p53-MDM2 protein-protein interaction are emerging as a new and validated approach to treating cancer. Herein, we describe the synthesis and inhibitory evaluation of a series of isoquinolin-1-one analogues, and highlight the utility of an initial growth-rates saturation-transfer difference (STD) NMR approach supported by protein-ligand docking to investigate p53-MDM2 inhibition. The approach is illustrated by the study of compound 1, providing key insights into the binding mode of this kind of MDM2 ligands and, more importantly, readily unveiling the previously proposed three-finger pharmacophore requirement for p53-MDM2 inhibition.

Identification of Small-Molecule Inhibitors of the Antiapoptotic Protein Myeloid Cell Leukaemia-1 (Mcl-1).

Protein-protein interactions (PPIs) control many cellular processes in cancer and tumour growth. Of significant interest is the role PPIs play in regulating apoptosis. The overexpression of the antiapoptosis regulating Bcl-2 family of proteins is commonly observed in several cancers, leading to resistance towards both radiation and chemotherapies. From this family, myeloid cell leukemia-1 (Mcl-1) has proven the most difficult to target, and one of the leading causes of treatment resistance. Exploiting the selective PPI between the apoptosis-regulating protein Noxa and Mcl-1, utilising a fluorescence polarization assay, we have identified four small molecules with the ability to modulate Mcl-1. The identified compounds were computationally modelled and docked against the Mcl-1 binding interface to obtain structural information about their binding sites allowing for future analogue design. When examined for their activity towards pancreatic cell lines that overexpress Mcl-1 (MiaPaCa-2 and BxPC-3), the identified compounds demonstrated growth inhibition, suggesting effective Mcl-1 modulation.

Small-Molecule and Peptide Inhibitors of the Pro-Survival Protein Mcl-1.

The ability of protein-protein interactions to regulate cellular processes in both beneficial and detrimental ways has made them obvious drug targets. The Bcl-2 family of proteins undergo a series of protein-protein interactions which regulate the intrinsic cell-death pathway. The pro-survival members of the Bcl-2 family, including Bcl-2, Bcl-xL , and Mcl-1, are commonly overexpressed in a number of human cancers. Effective modulators of members of the Bcl-2 family have been developed and are undergoing clinical trials, but the efficient modulation of Mcl-1 is still not represented in the clinic. In addition, Mcl-1 is a major cause of resistance to radio- and chemotherapies, including inhibitors that target other Bcl-2 family members. Subsequently, the inhibition of Mcl-1 has become of significant interest to the scientific community. This review covers the progress made to date in modulating the activity of Mcl-1, by both stapled peptides and small molecules. The development of peptides as drug candidates, and the advancement of experimental and computational techniques used to discover small molecules are also highlighted.

Solid-Phase Synthesis of Duocarmycin Analogues and the Effect of C-Terminal Substitution on Biological Activity.

The duocarmycins are potent antitumor agents with potential for use in the development of antibody-drug conjugates (ADCs) as well as being clinical candidates in their own right. In this article, we describe the synthesis of a duocarmycin monomer (DSA) that is suitably protected for utilization in solid-phase synthesis. The synthesis was performed on a large scale, and the resulting racemic protected Fmoc-DSA subunit was separated by supercritical fluid chromatography (SFC) into the single enantiomers; its application to solid-phase synthesis methodology gave a series of monomeric and extended duocarmycin analogues with amino acid substituents. The DNA sequence selectivity was similar to that in previous reports for both the monomeric and extended compounds. Substitution at the C-terminus of duocarmycin caused a decrease in antiproliferative activity for all of the compounds studied. An extended compound containing an alanine at the C-terminus was converted to the primary amide or to an extended structure containing a terminal tertiary amine, but this had no beneficial effects on biological activity.

Cognitive Impairment Induced by Delta9-tetrahydrocannabinol Occurs through Heteromers between Cannabinoid CB1 and Serotonin 5-HT2A Receptors.

Activation of cannabinoid CB1 receptors (CB1R) by delta9-tetrahydrocannabinol (THC) produces a variety of negative effects with major consequences in cannabis users that constitute important drawbacks for the use of cannabinoids as therapeutic agents. For this reason, there is a tremendous medical interest in harnessing the beneficial effects of THC. Behavioral studies carried out in mice lacking 5-HT2A receptors (5-HT2AR) revealed a remarkable 5-HT2AR-dependent dissociation in the beneficial antinociceptive effects of THC and its detrimental amnesic properties. We found that specific effects of THC such as memory deficits, anxiolytic-like effects, and social interaction are under the control of 5-HT2AR, but its acute hypolocomotor, hypothermic, anxiogenic, and antinociceptive effects are not. In biochemical studies, we show that CB1R and 5-HT2AR form heteromers that are expressed and functionally active in specific brain regions involved in memory impairment. Remarkably, our functional data shows that costimulation of both receptors by agonists reduces cell signaling, antagonist binding to one receptor blocks signaling of the interacting receptor, and heteromer formation leads to a switch in G-protein coupling for 5-HT2AR from Gq to Gi proteins. Synthetic peptides with the sequence of transmembrane helices 5 and 6 of CB1R, fused to a cell-penetrating peptide, were able to disrupt receptor heteromerization in vivo, leading to a selective abrogation of memory impairments caused by exposure to THC. These data reveal a novel molecular mechanism for the functional interaction between CB1R and 5-HT2AR mediating cognitive impairment. CB1R-5-HT2AR heteromers are thus good targets to dissociate the cognitive deficits induced by THC from its beneficial antinociceptive properties.

Identification of a new p53/MDM2 inhibitor motif inspired by studies of chlorofusin.

Previous studies on the natural product chlorofusin have shown that the full peptide and azaphilone structure are required for inhibition of the interaction between MDM2 and p53. In the current work, we utilized the cyclic peptide as a template and introduced an azidonorvaline amino acid in place of the ornithine/azaphilone of the natural product and carried out click chemistry with the resulting peptide. From this small library the first ever non-azaphilone containing chlorofusin analog with MDM2/p53 activity was identified. Further studies then suggested that the simple structure of the Fmoc-norvaline amino acid that had undergone a click reaction was also able to inhibit MDM2/p53 interaction. This is an example where studies of a natural product have led to the serendipitous identification of a new small molecule inhibitor of a protein-protein interaction.

Orexin-corticotropin-releasing factor receptor heteromers in the ventral tegmental area as targets for cocaine.

Release of the neuropeptides corticotropin-releasing factor (CRF) and orexin-A in the ventral tegmental area (VTA) play an important role in stress-induced cocaine-seeking behavior. We provide evidence for pharmacologically significant interactions between CRF and orexin-A that depend on oligomerization of CRF1 receptor (CRF1R) and orexin OX1 receptors (OX1R). CRF1R-OX1R heteromers are the conduits of a negative crosstalk between orexin-A and CRF as demonstrated in transfected cells and rat VTA, in which they significantly modulate dendritic dopamine release. The cocaine target σ1 receptor (σ1R) also associates with the CRF1R-OX1R heteromer. Cocaine binding to the σ1R-CRF1R-OX1R complex promotes a long-term disruption of the orexin-A-CRF negative crosstalk. Through this mechanism, cocaine sensitizes VTA cells to the excitatory effects of both CRF and orexin-A, thus providing a mechanism by which stress induces cocaine seeking.

Identification and characterisation of a G-quadruplex forming sequence in the promoter region of nuclear factor (erythroid-derived 2)-like 2 (Nrf2).

The transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates multiple antioxidants, Phase II detoxification enzymes and other cytoprotective enzymes in cells. Activation of Nrf2 is recognised as being of potential therapeutic benefit in inflammatory-diseases whereas more recently, it has become clear that the inhibition of Nrf2 may have benefit in the alleviation of resistance in some tumour types. A potential G-quadruplex forming sequence was identified in the promoter region of Nrf2, close to a number of putative transcription factor binding sites. Characterisation of the sequence 5'-d[GGGAAGGGAGCAAGGGCGGGAGGG]-3' using CD spectroscopy, imino proton NMR resonances and UV melting experiments demonstrated the formation of a parallel intramolecular G-quadruplex in the presence of K(+) ions. Incubation with 9-aminoacridine ligands induced a switch from antiparallel to parallel forms. The presence of a G-quadruplex forming sequence in the promoter region of Nrf2 suggests an approach to targeting the production of the protein through stabilisation of the structure, thereby avoiding resistance to antitumour drugs.

Non-covalent duplex to duplex crosslinking of DNA in solution revealed by single molecule force spectroscopy.

Small molecules that interact with DNA, disrupting the binding of transcription factors or crosslinking DNA into larger structures, have significant potential as cancer therapies and in nanotechnology. Bisintercalators, including natural products such as echinomycin and rationally designed molecules such as the bis-9-aminoacridine-4-carboxamides, are key examples. There is little knowledge of the propensity of these molecules to crosslink duplex DNA. Here we use single molecule force spectroscopy to assay the crosslinking capabilities of bisintercalators. We show that bis-9-aminoacridine-4-carboxamides with both rigid and flexible linkers are able to crosslink duplex strands of DNA, and estimate the equilibrium free energy of a 9-aminoacridine-4-carboxamide bisintercalator from DNA at 5.03 kJ mol(-1). Unexpectedly, we find that echinomycin and its synthetic analogue TANDEM are capable of sequence-specific crosslinking of the terminal base pairs of two duplex DNA strands. In the crowded environment of the nucleosome, small molecules that crosslink neighbouring DNA strands may be expected to have significant effects on transcription, while a small molecule that facilitates sequence-specific blunt-end ligation of DNA may find applications in the developing field of DNA nanotechnology.

A rapid screen for molecules that form duplex to duplex crosslinks in DNA.

We describe a gold nanoparticle based assay that can rapidly determine the crosslinking of DNA duplexes by ligands. Such compounds have potential in targeting highly compacted DNA such as that found in the nucleosome.

Synthesis of small molecules targeting multiple DNA structures using click chemistry.

The ability of small molecules to target DNA forms the basis of many clinically used antitumour agents. This study examines the effects of novel 9-aminoacridine carboxamides, synthesised by click chemistry based upon the reactions of either 9-(2-azidoethyl)amino or 9-propargylaminoacridine compounds, on various types of DNA tertiary structures. This gave either monomeric or dimeric compounds, the dimeric derivatives being the first unsymmetrical acridine dimers to be described. The compounds were assayed for duplex DNA, quadruplex DNA and four-way junction DNA binding. Their antiproliferative activity in the Human promyelocytic leukaemia cell line, HL60, was also assessed. Although for some of the compounds, notably the acridine 4-carboxamides, activity correlated with DNA binding affinity, for others it did not, with the rigidly linked dimers in particular showing a complicated relationship between 3- and 4-carboxamide structure and biological activity. The monomeric 3-carboxamides were more effective at stabilising G-quadruplex structures and also gave more hits in the four-way junction stabilisation assay. There is clear evidence from the binding of the 3-carboxamides that these compounds destabilise the open X form of the junction at lower concentrations and stabilise the X-stacked at higher concentrations. This might have implications for the biological activity of these compounds against proteins that bind to the Holliday junction (HJ).

A small molecule that induces assembly of a four way DNA junction at low temperature.

Small molecules that induce the formation of higher order DNA structures have potential therapeutic and nanotechnology applications. Screening of a click library has identified the first compound to induce the formation of a Holliday junction structure at room temperature without the need for a high temperature annealing step.

Design and synthesis of threading intercalators to target DNA.

Threading intercalators are high affinity DNA binding agents that bind by inserting a chromophore into the duplex and locating one group in each groove. The first threading intercalators that can be conjugated to acids, sulfonic acids and peptides to target them to duplex DNA are described, based upon the well studied acridine-3- or 4-carboxamides. Cellular uptake of the parent acridine is rapid and it can be visualized in the nucleus of cells. Both the parent compounds and their conjugates maintain antitumor activity.

Synthesis and evaluation of 9-aminoacridines derived from benzyne click chemistry.

A small set of 9-aminoacridine-3- and 4-carboxamides were synthesized efficiently using the benzyne/azide click chemistry. The products bind to duplex DNA but have different antitumour activity in the HL60 cell line.