Cleaning Oily Sludge Using Colloidal Gas Aphrons: Optimizing Process Conditions and Analyzing Mechanisms.

Colloidal gas aphrons (CGAs) are applied in pollutant removal due to their large specific surface area and high surface activity. The structure and properties of the prepared CGAs were investigated in the process of oil removal from oily sludge. The prepared CGAs had a liquid film thickness was 5-10 µm with high stability. CGA interfacial tension was as low as 3.157 mN/m. Then it was found that the oil removal rate of CGAs was higher than that of chemical treatments, showing that CGAs could increase the mass transfer surface area and provide additional attachment sites for pollutants, enhancing the oil removal. The treatment conditions of the oil removal were optimized through response surfaces, showing that under optimal treatment conditions, the oil removal rate of oily sludge reached 96.07%. Additionally, the interaction between surfactant concentration and temperature was the most significant of all of the influencing factors. The behavior and mechanism of CGAs in the cleaning process of oily sludge were further investigated using an inverted fluorescence microscope, SEM, FTIR, and two-dimensional fluorescence spectrometer, showing that pollutants transferred from the liquid film surface of CGAs to the inside the film, and CGAs could specifically adsorb negatively charged organic compounds and aromatic hydrocarbons. The results show that CGAs achieved liquid membrane solubilization. Many negatively charged organic compounds and aromatic hydrocarbons are adsorbed onto the CGAs liquid membrane surface via electrostatic and hydrophobic interactions and then migrated to the hydrophobic layer of the CGAs liquid membrane due to the distribution effect, thus enabling rapid pollutant migration between solid and liquid phases.

Dietary sodium acetate and sodium butyrate attenuate intestinal damage and improve lipid metabolism in juvenile largemouth bass (Micropterus salmoides) fed a high carbohydrate diet by reducing endoplasmic reticulum stress.

High-carbohydrate (HC) diets decrease the intestinal levels of sodium acetate (SA) and sodium butyrate (SB) and impair the gut health of largemouth bass; however, SA and SB have been shown to enhance immunity and improve intestinal health in farmed animals. Thus, the present study was to investigate the effects of dietary SA and SB on HC diet-induced intestinal injury and the potential mechanisms in juvenile largemouth bass. The experiment set five isonitrogenous and isolipidic diets, including a low-carbohydrate diet (9% starch) (LC), a high carbohydrate diet (18% starch) (HC), and the HC diet supplemented with 2 g/kg SA (HCSA), 2 g/kg SB (HCSB) or a combination of 1 g/kg SA and 1 g/kg SB (HCSASB). The feeding experiment was conducted for 8 weeks. A total of 525 juvenile largemouth bass with an initial body weight of 7.00 ± 0.20 g were used. The results showed that dietary SA and SB improved the weight gain rate and specific growth rate (P < 0.05) and ameliorated serum parameters (alkaline phosphatase, acid phosphatase, glutamate transaminase, and glutamic oxaloacetic transaminase) (P < 0.05). And, importantly, dietary SA and SB repaired the intestinal barrier by increasing the expression levels of zonula occludens-1, occludin, and claudin-7 (P < 0.05), reduced HC-induced intestinal damage, and alleviated intestinal inflammation and cell apoptosis by attenuating HC-induced intestinal endoplasmic reticulum stress (P < 0.05). Further results revealed that dietary SA and SB reduced HC-induced intestinal fat deposition by inhibiting adipogenesis and promoting lipolysis (P < 0.05). In summary, this study demonstrated that dietary SA and SB attenuated HC-induced intestinal damage and reduced excessive intestinal fat deposition in largemouth bass.

First report of grapevine asteroid mosaic-associated virus in grapevines in China.

Grapevine asteroid mosaic-associated virus (GAMaV), a member of the genus Marafivirus of the family Tymoviridae, was first described to infect grapevines in California (Abou Ghanem-Sabanadzovic et al. 2003). Since then, GAMaV has been reported from Greece, Japan, Canada, Uruguay, France, Hungary, Italy, Spain, Switzerland and Russia, and also in some free-living grapevines in North America (Kyriakopoulou, 1991; Morán et al., 2021; Reynard et al., 2022; Shvets et al., 2022; Thompson et al., 2021). GAMaV may be associated with grapevine asteroid mosaic disease (Martelli 2014). In August 2022, a grapevine cv. Cabernet Sauvignon exhibiting chlorotic mottling was collected in Ningxia, China. Total RNAs were extracted using RNAprep Pure Plant Plus Kit (DP441, TIANGEN BIOTECH, Beijing), and the ribosomal RNA were removed by the Epicentre Ribo-Zero rRNA Removal Kit (Epicentre, Madison, WI, USA). The ribosomal RNA-depleted RNAs were then used to construct a cDNA library using a TruSeq RNA Sample Prep Kit (Illumina, San Diego, CA, USA), which was sequenced on an Illumina NovaSeq 6000 platform (Biomarker Biology Technology), resulting in 39,297,567 paired-end clean reads (150 nt × 2). Reads mapping to the grapevine genome (GenBank accession no PN40024) were removed using hisat2 2.1.0 software. The 15,003,158 unmapped reads were de novo assembled into 70,512 contigs using the rnaviralSPAdes method in the SPAdes v3.15.3 software with default parameters and analyzed through BLASTn and BLASTx analysis. Five viruses and two viroids were identified: GAMaV (5 contigs), grapevine Pinot gris virus (3 contigs), grapevine berry inner necrosis virus (3 contigs) , grapevine rupestris stem pitting-associated virus (4 contigs), grapevine red globe virus (2 contigs), grapevine yellow speckle 1 viroid (4 contigs) and hop stunt viroid (3 contigs). The five contigs of GAMaV were 352 nt~2, 224 nt in length, which were assembled from 3, 308 reads and shared 85.56%~91.81% nt identity with the genome of the GAMaV isolate GV30 (KX354202) with 93.3% coverage. To further confirm the infection of GAMaV, we designed two pairs of primers, GAMaV-mel1a/1b (5'-CACCTCGCCCCCTACCTTGAC-3'/5'-AAGAGGACGCCTTTGCGGGAG-3') and GAMaV-cp1a/1b (5'-CTAGCGACGACCGCACTGATC-3'/5'-GTCGGTGTACGAGATTTGGTC-3'), which were used to amplify the 329-bp and 440-bp fragments in the helicase (Hel) domain and coat protein (CP) gene of GAMaV genome in RT-PCR, respectively. The amplified PCR products were cloned and sequenced and the two sequences (OQ676951 and OQ676958) showed 91.2% and 93.4% nt identity with the isolate GV30, respectively. Furthermore, 429 grapevine samples of 71 cultivars were collected from 21 provinces and tested by RT-PCR using the above primer pairs. The results showed that 1.4% (6/429) of the samples tested positive, including one 'Autumn seedless' grapevine (Liaoning province), two 'Dawuhezi' (Liaoning), one 'Cabernet Gernischt' (Liaoning) and two 'Cabernet Sauvignon' (Tianjing and Shandong respectively). The partial sequences of the Hel domain (OQ676952-57) and CP gene (OQ676959-61) obtained from the positive samples by sequencing showed 89.1% to 84.5% and 93.6% to 93.9% nt identity with the isolate GV30, respectively. Because these GAMaV-positive grapevines did not show distinct symptoms, GAMaV pathogenicity remains challenging to confirm. This is the first report of GAMaV in grapevines in China, extending the information on its geographical distribution.

Random copolymerization of trimethylene carbonate with L-lactide initiated by amine-bridged bis(phenolate) neodymium alkoxides.

Random copolymerization of trimethylene carbonate (TMC) with L-lactide (LA) under mild conditions is a challenging task in polymer synthesis. Two amino-bridged bis(phenolate) neodymium complexes were synthesized and employed as efficient initiators for the copolymerization of TMC and L-LA under mild conditions to give random copolymers. NMR monitoring experiments of the chain microstructure versus polymerization time confirmed that a TMC/LA random copolymer was generated by a random copolymerization.

Integrated Transcriptome and Metabolome Dissecting Interaction between Vitis vinifera L. and Grapevine Fabavirus.

Grapevine fabavirus (GFabV) is a novel member of the Fabavirus genus associated with chlorotic mottling and deformation symptoms in grapevines. To gain insights into the interaction between GFabV and grapevines, V. vinifera cv. 'Summer Black' infected with GFabV was investigated under field conditions through physiological, agronomic, and multi-omics approaches. GFabV induced significant symptoms on 'Summer Black', and caused a moderate decrease in physiological efficiency. In GFabV-infected plants, alterations in carbohydrate- and photosynthesis-related genes might trigger some defense responses. In addition, secondary metabolism involved in plant defense was progressively induced by GFabV. Jasmonic acid and ethylene signaling were down-regulated in GFabV-infected leaves and berries along with the expression of proteins related to LRR and protein kinases, suggesting that GFabV can block the defense in healthy leaves and berries. Furthermore, this study provided biomarkers for early monitoring of GFabV infection in grapevines, and contributed to a better understanding of the complex grapevine-virus interaction.

Effect of In Vitro Culture of Long Shoot Tip on Variant Structure and Titer of Grapevine Viruses.

Shoot tip culture is a very effective approach for studying plant viruses. In this study, we evaluated the numbers, diversity, and titer of grapevine viruses in in vitro grapevine plants after long shoot tip culture. Six virus-infected grapevine cultivars (Cabernet Franc, Cabernet Gernischt, Cabernet Sauvignon, Wink, Victoria, and Merlot) collected from six regions of China were used as the research materials. Approximately 1.5 cm long shoot tips were used for meristem culture. The average survival rate of the six grapevine cultivars was 45.7%. Merlot collected from Beijing showed the highest survival rate (80.0%). Regeneration was not achieved in Cabernet Gernischt collected from Liaoning province and Cabernet Sauvignon from Tianjin due to bacterial and fungal contamination. Virus detection conducted in the surviving regenerated plants showed that the virus infection status, including the viral numbers and the species present in plants grown in vitro, was the same as that in corresponding in vivo plants. Moreover, the analysis of sequence diversity and the mutation frequency in grapevine viruses in vitro indicated that the structure of grapevine viruses was stable in long shoot tip culture after four sub-culture passages. Further, the relative viral titer of in vitro grapevine plants was much higher than that of in vivo plants. These results aid in the investigation of viruses in woody plants.

First report of Vitis cryptic virus from grapevines in China.

Vitis cryptic virus (VCV) was recently identified on wild Vitis coignetiae in Japan in 2021, and was tentatively classified as a new member of the genus Deltapartitivirus, which is consistent with the two-segmented genome encoding RdRp and CP (Nabeshima et al., 2021). In June 2020, a grapevine cv. Jinhuanghou in a vineyard exhibiting chlorotic mottling (Figure S1) was collected in Xingcheng, Liaoning province of China. Total RNAs were extracted using RNAprep Pure Plant Plus Kit (DP441, TIANGEN BIOTECH, Beijing), and the ribosomal RNA were removed by the Epicentre Ribo-Zero rRNA Removal Kit (Epicentre, Madison, WI, USA). The ribosomal RNA-depleted RNA was then used to construct a cDNA library using a TruSeq RNA Sample Prep Kit (Illumina, San Diego, CA, USA), which was sequenced on an Illumina NovaSeq 6000 platform (Biomarker Biology Technology), resulting 60,208,348 paired-end clean reads (150 nt × 2). Reads mapping to the grapevine genome (PN40024 assembly 12X) were removed by hierarchical indexing using hisat2 2.1.0 software (Kim et al., 2019). The unmapped reads were de novo assembled into 116,809 contigs using the rnaviralSPAdes method in the SPAdes v3.15.3 software with default parameters (Prjibelski et al., 2020) and analyzed through BLAST analysis. Two viruses and two viroids were identified: VCV (2 contigs), grapevine emaravirus A (GEVA; 5 contigs), grapevine yellow speckle viroid 1 (GYSVd1; 1 contig) and hop stunt viroid (HSVd; 1 contig). The two contigs of VCV had lengths of 1575 nt and 1563 nt, and shared 95% and 90% nt identity with RNA1 and RNA2 genomes of the VCV isolate H1 (GenBank accession nos. LC602838-39) with 99% and 96% coverage respectively. To further confirm the infection of VCV, we designed two pairs of primers VCV-RP1a/1b (5'- TGGTCGAGAAGTTACTATACTCG -3'/5'- AGACCACAATATTGCTTTGGCTC -3') and VCV-CP1a/1b (5'-TTACGAAGTCCGCACTATTGC-3'/5'- AGCATACGGATAGCTCCTGAC-3'), which were to amplify the 297-bp and 279-bp fragments in the RdRp and CP gene encoded by RNA1 and RNA2 genomes of VCV respectively. The amplified PCR products were cloned and sequenced and the two sequences (OM460075-76) showed 93% and 91% nt identity with the genomic segments of the VCV isolate H1 respectively. The graft transmissibility of VCV was assessed in July 2021 by grafting the VCV-infected grapevine buds onto 2-year-old VCV-free 'Beta'grapevine seedlings with four replicates, the leaves of the first bud below the grafting site behaved chlorotic mottling symptoms (Figure S2) and tested positive for VCV two months after grafting. To further determine the incidence and distribution of VCV in China, 470 grapevine samples of 71 cultivars were collected from 21 provinces and tested by RT-PCR using primers VCV-RP1a/1b and VCV-CP1a/1b. The results showed that 2.6% (12/470) of the samples tested positive with both primers, including 10 'Jinhuanghou' grapevines (Jilin province), 1 'Zuoyouhong' (Jilin province) and 1 'Куртсет' grapevine (Liaoning province). This is the second report of VCV in the world, and confirm the graft transmissibility of VCV for the first time. Given the VCV infectivity in the two important cultivars in Jilin province and strong graft transmissibility, it is necessary to further study its pathogenicity and its effect on grapes. Unveiling the presence of VCV in China contributes to understanding the occurrence of the virus and developing management measures should they become necessary.

Genetic diversity analysis of grapevine rupestris stem pitting-associated virus from grapevine by colony PCR-SSCP and -RFLP.

We have developed methods for detecting the genetic diversity of grapevine rupestris stem pitting-associated virus (GRSPaV) based on restriction fragment length polymorphism (RFLP) and single stranded conformational polymorphism (SSCP) in the 905 nt 3' sequence. The amplicons were cloned from six grapevine cultivars, and colony polymerase chain reaction (colony PCR) using recombination bacteria was subsequently analyzed by RFLP and SSCP. Four haplotypes of SSCP and six haplotypes of Sac I RFLPs were defined. The two methods had a 40% discrepancy rate in showing the degree of diversity. All clones were sequenced and were used to construct a phylogenetic tree with seven previously reported GRSPaV sequences. In the tree, all the newly acquired sequences were divided into three clusters, I, II, and III, which corresponded to haplotypes I, II, and III of SSCP, respectively. Haplotype IV of SSCP was grouped into cluster II. A recombination analysis showed that haplotype IV has undergone a recombination event. Together, these results indicate that the SSCP assay is useful for the rapid identification of genetic diversity of GRSPaV. This is the first report of an analysis of the large fragment of GRSPaV by colony PCR-SSCP. Keywords: grapevine; grapevine rupestris stem pitting-associated virus (GRSPaV); RFLP; SSCP; genetic diversity analysis.

The role of auditory and vibration stimuli in zebrafish neurobehavioral models.

Strongly affecting human and animal physiology, sounds and vibration are critical environmental factors whose complex role in behavioral and brain functions necessitates further clinical and experimental studies. Zebrafish are a promising model organism for neuroscience research, including probing the contribution of auditory and vibration stimuli to neurobehavioral processes. Here, we summarize mounting evidence on the role of sound and vibration in zebrafish behavior and brain function, and outline future directions of translational research in this field. With the growing environmental exposure to noise and vibration, we call for more active use of zebrafish models for probing neurobehavioral and bioenvironmental consequences of acute and long-term exposure to sounds and vibration in complex biological systems.

High-Throughput Sequencing Indicates a Novel Marafivirus in Grapevine Showing Vein-Clearing Symptoms.

A putative new marafivirus was identified in a 'Jumeigui' grapevine exhibitting obvious vein-clearing symptoms by high-throughput sequencing, which tentatively named grapevine-associated marafivirus (GaMV). The nearly complete genomic sequence of GaMV was amplified by reverse transcription PCR, and the terminal sequences were determined using the rapid amplification of cDNA ends method. The nearly complete genome of GaMV is 6346 bp long, excluding the poly(A) tail, and shows 51.2-62.3% nucleotide identity with other members of the genera Marafivirus, Maculavirus and Tymovirus in the family Tymoviridae. Additionally, it includes five functional domains homologous to those found in members of these genera. A phylogenetic analysis showed that GaMV clustered with other species-related marafiviruses. These data support GaMV being a representative member of a novel species in the genus Marafivirus. Furthermore, GaMV was graft-transmissible and 26 of 516 (5.04%) grapevine samples from five provinces in China tested positive by reverse transcription PCR. The coat protein of GaMV isolates shared 91.7-100% and 96.7-100% identities at the nt and aa levels, respectively. The coat protein-based phylogenetic trees revealed three well-defined clusters.

First Report of Grapevine Kizil Sapak Virus in Grapevine in China.

Grapevine Kizil Sapak virus (GKSV) is a novel member of the family Betaflexiviridae classified into the proposed genus Fivivirus within the subfamily Trivirinae. It was first discovered in USA from a grapevine originating from Turkmenistan (Al Rwahnih et al. 2019) and later in France from a grapevine accession from Iran (Marais et al. 2020). In October 2019, an asymptomatic grapevine cv. 'Crimson Seedless' (native to USA) was collected from Xinjiang province in China and analyzed by high-throughput sequencing (HTS). Ribosome-depleted RNA preparations were used for library synthesis followed by HTS on an Illumina HiSeq X-ten platform. A total of 29,141,024 cleaned reads were obtained, and 7,878 contigs were generated using CLC Genomics Workbench 9.5 (QIAGEN). One long contig (7,328 bp) showed 88.2% nucleotide (nt) identity with the sequence of GKSV-127 (MN172165) via Blastx, with an average coverage of 284-X. Bioinformatic analysis of the remaining contigs showed the presence of Grapevine leafroll-associated virus 4, Grapevine rupestris vein feathering virus, Grapevine fabavirus, grapevine yellow speckle viroid-1 (GYSVd-1), GYSVd-2 and Hop stunt viroid in the sample. The presence of GKSV was checked by RT-PCR using the primer GKSV-F/R (Al Rwahnih et al. 2019); the 1,240 bp PCR product was cloned using a pTOPO-T vector (Aidlab, China) and sequenced. In pairwise comparison, the obtained nt sequences shared 92.6 to 95.2% identity to the corresponding HTS sequence, confirming the presence of GKSV in the sample. The complete GKSV genome sequence was obtained as two pieces of overlapping DNA sequence using primers GKSV-20A/20B (5'-TAGTCTGGATTTCCCTACCT/5'-CTCCCTAAACTGATTTGATG) and GKSV-25A/25B (5'-GCCACTGGTGAATGAAAAGA/5'-CTAAATGAATGGGCAGGTAT) designed based on the HTS-generated sequence. The 5' and 3' termini were determined by rapid amplification of cDNA ends using SMARTer RACE 5'/3' Kit (Takara, Dalian, China). The complete genome of GKSV isolate CS (MW582898) comprised 7,604 nt (without the polyA tail) and shared 77.8 to 89.2% identities with the other nine reported GKSV isolates, among which it shared the highest nt identity (89.2%) with GKSV-127. In phylogenetic analysis based on complete or nearly complete genome sequences of representative members of Betaflexiviridae, GKSV-CS clustered with the nine known GKSV isolates, forming a subclade with GKSV-127 (Supplementary Fig. 1). To determine the incidence and distribution of GKSV in China, 476 grapevine samples of 75 cultivars were collected from 20 provinces and tested by RT-PCR using primers GKSV-F/R (Al Rwahnih et al. 2019) and Vini-F1/R1 (Marais et al. 2020). The results showed that 0.42% (2 of 476) of the samples tested positive with both primers, including samples GKSV-CS and a 'Black Monukka' grape (native to India) also sampled from Xinjiang. Both PCR products of 'Black Monukka' were cloned and sequenced (MZ311588 to MZ311602) and they showed 85.1 to 88.9% nt identities to the GKSV-CS sequence. This is the first report of GKSV infecting grapevine in China. Although the pathogenicity of GKSV is yet to be determined, it has been found in several countries such as USA (Al Rwahnih et al. 2019), France (Marais et al. 2020) and China (this study). Both positive samples in this study were collected from Nanjiang region in Xinjiang province, indicating the sporadic occurrence of GKSV in this area.

Identification and Characterization of a Novel Emaravirus From Grapevine Showing Chlorotic Mottling Symptoms.

A novel negative-sense, single-stranded (ss) RNA virus was identified in a "Shennong Jinhuanghou" (SJ) grapevine showing severe chlorotic mottling symptoms by integrating high-throughput sequencing (HTS) and conventional Sanger sequencing of reverse transcription polymerase chain reaction (RT-PCR) products. The virus was provisionally named as "grapevine emaravirus A" (GEVA). GEVA had a genome comprising five genomic RNA segments, each containing a single open reading frame on the viral complementary strand and two untranslated regions with complementary 13- nt stretches at the 5' and 3' terminal ends. RNA1 (7,090 nt), RNA2 (2,097 nt), RNA3 (1,615 nt), and RNA4 (1,640 nt) encoded putative proteins P1-P4 that, based on their conserved motifs, were identified as the RNA-dependent RNA polymerase, glycoprotein, nucleocapsid protein, and movement protein, respectively. However, the functional role of protein P5 encoded by RNA5 (1,308 nt) could not be determined. Phylogenetic trees constructed based on amino acids of P1 to P4, allocated GEVA in clade I, together with other species-related emaraviruses. These data support the proposal that GEVA is a representative member of a novel species in the genus Emaravirus of the family Fimoviridae. Moreover, when GEVA was graft-transmitted to SJ and "Beta" grapevines, all grafted plants showed the same symptoms, similar to those observed in the source of the inoculum. This is the first report to our knowledge of an emaravirus infecting grapevine and its possible association with chlorotic mottling symptoms.

First report of apple rubbery wood virus 1 in apple in China.

More than 30 viral and subviral pathogens infect apple (Malus domestica, an important fruit crop in China) trees and rootstocks, posing a threat to its production. With advances in diagnostic technologies, new viruses including apple rubbery wood virus 1 (ARWV-1), apple rubbery wood virus 2 (ARWV-2), apple luteovirus 1 (ALV), and citrus virus A (CiVA) have been detected (Beatriz et al. 2018; Rott et al. 2018; Hu et al. 2021). ARWV-1 (family Phenuiviridae) is a negative-sense single-stranded RNA virus with three RNA segments (large [L], medium [M], and small [S]). It causes apple rubbery wood disease (Rott et al. 2018) and is found in apple rootstocks, causing leaf yellowing and mottle symptoms in Korea (Lim et al. 2018). To determine virus prevalence in apple trees in China, 200 apple leaf and shoot samples were collected from orchards in Hebei (n = 26), Liaoning (n = 40), Shandong (n = 100), Yunnan (n = 25), Shanxi (n = 4) and Inner Mongolia (5) in 2020. Total RNA was extracted from the shoot phloem or leaf tissues (Hu et al., 2015) and subjected to reverse transcription (RT)-PCR to detect apple chlorotic leaf spot virus (ACLSV), apple stem pitting virus (ASPV), apple stem grooving virus (ASGV), apple necrotic mosaic virus (ApNMV), apple scar skin viroid (ASSVd), ARWV-2, ARWV-1, ALVand CiVA using primers specific to respective viruses (Supplementary Table 1). The prevalence of ACLSV, ASPV, ASGV, ApNMV, ASSVd, ARWV-2, ARWV-1, ALV and CiVA was found to be 75.5%, 85.5%, 86.0%, 43.0%, 4.0%, 48.5%, 10.5%, 0% and 0%, respectively (Supplementary Table 2). Among the 21 positive samples for ARWV-1, three, five and 13 samples were from Hebei, Liaoning and Shandong, respectively. Five ARWV-1-positive samples (cultivars Xinhongjiangjun, Xiangfu-1, Xiangfu-2 and Tianhong) showed leaf mosaic symptoms. To confirm the RT-PCR assay, the projected ARWV-1 amplicons from cvs. Xiangfu-1 and Tianhong were cloned into the pMD18-T vector (Takara, Dalian, China), and three clones of each sample were sequenced. BLASTn analyses demonstrated that the sequences (accession nos. MW507810-MW507811) shared 96.9%-98.9% identity withARWV-1 sequences (MH714536, MF062127, and MF062138) in GenBank. An lncRNA library was prepared for high-throughput sequencing (HTS) with the Illumina HiSeq platform using Xiangfu-1 RNA. A total of 71,613,294 reads were obtained. De novo assembly of the reads revealed 135 viral sequence contigs of ACLSV, ASGV, ASPV, ApNMV, ARWV-1, and ARWV-2. The sequences of contig-100_88981 (302 nt) and contig-100_25701 (834 nt) (accession nos. MW507821 and MW507820) matched those of segment S from ARWV-1, whereas the sequences of contig-100_6542 (1,660 nt) and contig-100_27 (7,364 nt) (accession nos. MW507819 and MW507818) matched those of segments M and L, respectively. To confirm the HTS results, fragments of segments L (744 bp), M (747 bp), and S (554 bp) from Xiangfu-1 and Tianhong were amplified (Supplementary Table 1) and sequenced. The sequences (accession nos. MW507812-MW507817) showed 94.8%-99.9% nucleotide identity with the corresponding segments of ARWV-1. Co-infection of ARWV-1 with ApNMV and/or ARWV-2 was confirmed in 17/21 ARWV-1-positive samples. The prevalence of ARWV-1/ApNMV, ARWV-1/ARWV-2, and ARWV-1/ApNMV/ARWV-2 infections was 61.9%, 71.4%, and 52.4%, respectively. To our knowledge, this is the first report of ARWV-1 infecting apple trees in China. Further research is needed to determine whether and how ARWV-1 affects apple yield and quality.

Effects of acute and chronic arecoline in adult zebrafish: Anxiolytic-like activity, elevated brain monoamines and the potential role of microglia.

Arecoline is a naturally occurring psychoactive alkaloid with partial agonism at nicotinic and muscarinic acetylcholine receptors. Arecoline consumption is widespread, making it the fourth (after alcohol, nicotine and caffeine) most used substance by humans. However, the mechanisms of acute and chronic action of arecoline in-vivo remain poorly understood. Animal models are a valuable tool for CNS disease modeling and drug screening. Complementing rodent studies, the zebrafish (Danio rerio) emerges as a promising novel model organism for neuroscience research. Here, we assessed the effects of acute and chronic arecoline on adult zebrafish behavior and physiology. Overall, acute and chronic arecoline treatments produced overt anxiolytic-like behavior (without affecting general locomotor activity and whole-body cortisol levels), with similar effects also caused by areca nut water extracts. Acute arecoline at 10 mg/L disrupted shoaling, increased social preference, elevated brain norepinephrine and serotonin levels and reduced serotonin turnover. Acute arecoline also upregulated early protooncogenes c-fos and c-jun in the brain, whereas chronic treatment with 1 mg/L elevated brain expression of microglia-specific biomarker genes egr2 and ym1 (thus, implicating microglial mechanisms in potential effects of long-term arecoline use). Finally, acute 2-h discontinuation of chronic arecoline treatment evoked withdrawal-like anxiogenic behavior in zebrafish. In general, these findings support high sensitivity of zebrafish screens to arecoline and related compounds, and reinforce the growing utility of zebrafish for probing molecular mechanisms of CNS drugs. Our study also suggests that novel anxiolytic drugs can eventually be developed based on arecoline-like molecules, whose integrative mechanisms of CNS action may involve monoaminergic and neuro-immune modulation.

Studying CNS effects of Traditional Chinese Medicine using zebrafish models.

ETHNOPHARMACOLOGICAL RELEVANCE: Although Traditional Chinese Medicine (TCM) has a millennia-long history of treating human brain disorders, its complex multi-target mechanisms of action remain poorly understood. Animal models are currently widely used to probe the effects of various TCMs on brain and behavior. The zebrafish (Danio rerio) has recently emerged as a novel vertebrate model organism for neuroscience research, and is increasingly applied for CNS drug screening and development. AIM OF THE STUDY: As zebrafish models are only beginning to be applied to studying TCM, we aim to provide a comprehensive review of the TCM effects on brain and behavior in this fish model species. MATERIALS AND METHODS: A comprehensive search of published literature was conducted using biomedical databases (Web of Science, Pubmed, Sciencedirect, Google Scholar and China National Knowledge Internet, CNKI), with key search words zebrafish, brain, Traditional Chinese Medicine, herbs, CNS, behavior. RESULTS: We recognize the developing utility of zebrafish for studying TCM, as well as outline the existing model limitations, problems and challenges, as well as future directions of research in this field. CONCLUSIONS: We demonstrate the growing value of zebrafish models for studying TCM, aiming to improve our understanding of TCM' therapeutic mechanisms and potential in treating brain disorders.

Decoding the role of zebrafish neuroglia in CNS disease modeling.

Neuroglia, including microglia and astrocytes, is a critical component of the central nervous system (CNS) that interacts with neurons to modulate brain activity, development, metabolism and signaling pathways. Thus, a better understanding of the role of neuroglia in the brain is critical. Complementing clinical and rodent data, the zebrafish (Danio rerio) is rapidly becoming an important model organism to probe the role of neuroglia in brain disorders. With high genetic and physiological similarity to humans and rodents, zebrafish possess some common (shared), as well as some specific molecular biomarkers and features of neuroglia development and functioning. Studying these common and zebrafish-specific aspects of neuroglia may generate important insights into key brain mechanisms, including neurodevelopmental, neurodegenerative, neuroregenerative and neurological processes. Here, we discuss the biology of neuroglia in humans, rodents and fish, its role in various CNS functions, and further directions of translational research into the role of neuroglia in CNS disorders using zebrafish models.

Development of a Full-Length Infectious cDNA Clone of the Grapevine Berry Inner Necrosis Virus.

Grapevine berry inner necrosis virus (GINV) belongs to the genus Trichovirus in the family Betaflexiviridae. The GINV isolate LN_BETA_RS was obtained from a "Beta" grapevine (Vitis riparia × Vitis labrusca) exhibiting chlorotic mottling and ring spot in Xingcheng, Liaoning Province, China. To verify the correlation between GINV and grapevine chlorotic mottling and ring spot disease, we constructed an infectious cDNA clone of GINV isolate LN_BETA_RS using the seamless assembly approach. Applied treatments of agroinfiltration infectious cDNA confirmed systemic GINV infection of the Nicotianaoccidentalis 37B by reverse transcription polymerase chain reaction (RT-PCR) and transmission electron microscopy, exhibiting chlorotic mottling symptoms on leaves. Infectious cDNA was also transmitted to new healthy N. occidentalis plants through rub-inoculation. Moreover, the cDNA clone was agroinfiltrated into "Beta" and "Thompson Seedless" grapevine plantlets, and the inoculated grapevines exhibited leaf chlorotic mottling and ringspot during the two years of observation. GINV-inoculated "Beta" grapevines had serious leaf chlorotic mottling and ringspot symptoms on the whole plant, while relatively few symptoms were observed on the leaves of agroinoculated "Thompson Seedless" grapevines in early spring and only weak ring spot gradually appeared later in the top young leaves. Our experiments fulfilled Koch's postulates and revealed the causative role of GINV in grapevine chlorotic mottling and ring spot disease.

First report of apple rubbery wood virus 2 infection of apples in China.

Apple (Malus) is one of the most widely grown fruit trees worldwide, and viral diseases can severely inhibit its growth and development. Apple rubbery wood virus 2 (ARWV-2, family Phenuiviridae) is a negative-sense single-stranded RNA virus whose genome comprises three RNA segments (large: L, medium: M, and small: S) (Rott et al. 2018). This virus is associated with apple rubbery wood disease (Rott et al. 2018) and has previously been found in pear (Pyrus spp.) in China (Wang et al. 2019). In autumn 2019, six trees (one each of cvs. Honglu, Hongzhengzhu, Jinxiuhaitang, Liquanduanfu, Huahong-1, and Huahong-2) showing mosaic disease-like symptoms in the leaves and two trees (one each of cvs. Qingming-1 and Qingming-2) showing rusty skin symptoms (i.e., a large number of irregular rust spots on the peel's surface) in the fruits were found in Xingcheng, Liaoning province, China. Shoots of the diseased plants were collected, and total RNA was extracted from the phloem of the samples as described by Hu et al. (2015). Reverse transcription (RT)-PCR was used to detect various viruses including apple chlorotic leaf spot virus (ACLSV), apple stem pitting virus (ASPV), apple stem grooving virus (ASGV), apple necrotic mosaic virus (ApNMV), and ARWV-2 as well as apple scar skin viroid (ASSVd) using their respective primers (Supplementary Table 1). ACLSV, ASPV and ASGV were detected in all samples. ApNMV was detected in the six trees with leaf mosaic symptoms and ASSVd was detected in the two trees with apple rusty skin symptoms. Moreover, five trees (cvs. Honglu, Hongzhengzhu, Jinxiuhaitang, Qingming-1, and Qingming-2) tested positive for ARWV-2 in the RT-PCR assay. The PCR products of ARWV-2 from Honglu and Qingming-2 were cloned into the pMD18-T vector (Takara, Dalian, China), and one clone of each of the samples was sequenced. BLASTn analyses showed that they shared 98.2%-99.2% nt identity with ARWV-2 sequences (MT901298-MT901299) deposited in the GenBank database. A small RNAs (sRNAs) library was prepared for high-throughput sequencing (HTS) with the Solexa-Illumina platform using phloem tissue collected from a Qingming-2 tree in which apples with rusty skin symptoms were observed. A total of 3,7746,671 reads were obtained from the library. De novo assembly of the reads yielded 1,378 viral sequence contigs. Of those, 20 contigs with lengths ranging from 82 to 387 nt were mapped to the reference genome of ARWV-2 (accession nos. MT733339-MT733344, MT901300-MT901313). In addition, contigs of ACLSV, ASPV, ASGV, ApNMV and ASSVd were detected. To further confirm the HTS results, partial length fragments of segments L (717 bp), M (645 bp), and S (657 bp) of the ARWV-2 genome were amplified from Qingming-2 using primers (Supplementary Table 1) and sequenced. The resulting sequences, which have been deposited in GenBank under the accession numbers MT364372-MT364374, showed 97.2%, 97.8%, and 98.0% nt identity, respectively, with the corresponding segments of ARWV-2 isolate R7 (accession nos. MF062144-MF062146). To understand the infection status of apple trees in China with regard to ARWV-2, 116 apple shoot samples were randomly collected from commercial orchards in Liaoning, Shanxi, and Shandong provinces and subjected to RT-PCR to detect ARWV-2, ACLSV, ASGV, ASPV, ASSVd and ApNMV. In total, 49 (42.2%) of the 116 samples tested positive for ARWV-2, suggesting that this virus is wide spread in apple trees in China (Supplementary Table 2). The mixed-infection rates of ARWV-2/ApNMV and ARWV-2/ASSVd were 18.1% (21/116) and 3.4% (4/116), respectively. Among the 46 ARWV-2-positive samples, seven had mosaic disease-like symptoms in the leaves and three had rusty skin symptoms in the fruits. To our knowledge, this is the first report of ARWV-2 infection in apples showing rusty skin symptoms, as well as the first report of ARWV-2 infection in domestic apples in China. Further research is needed to understand the distribution of ARWV-2 in apple orchards throughout China, to confirm the relationship of ARWV-2 with different symptoms and to evaluate how ARWV-2 affects the performance and quality of apple.

Delayed behavioral and genomic responses to acute combined stress in zebrafish, potentially relevant to PTSD and other stress-related disorders: Focus on neuroglia, neuroinflammation, apoptosis and epigenetic modulation.

Stress is a common trigger of stress-related illnesses, such as anxiety, phobias, depression and post-traumatic stress disorder (PTSD). Various animal models successfully reproduce core behaviors of these clinical conditions. Here, we develop a novel zebrafish model of stress (potentially relevant to human stress-related disorders), based on delayed persistent behavioral, endocrine and genomic responses to an acute severe 'combined' stressor. Specifically, one week after adult zebrafish were exposed to a complex combined 90-min stress, we assessed their behaviors in the novel tank and the light-dark box tests, as well as whole-body cortisol and brain gene expression, focusing on genomic biomarkers of microglia, astrocytes, neuroinflammation, apoptosis and epigenetic modulation. Overall, stressed fish displayed persistent anxiety-like behavior, elevated whole-body cortisol, as well as upregulated brain mRNA expression of genes encoding the glucocorticoid receptor, neurotrophin BDNF and its receptors (TrkB and P75), CD11b (a general microglial biomarker), COX-2 (an M1-microglial biomarker), CD206 (an M2-microglial biomarker), GFAP (a general astrocytal biomarker), C3 (an A1-astrocytal biomarker), S100α10 (an A2-astrocytal biomarker), as well as pro-inflammatory cytokines IL-6, IL-1ß, IFN-γ and TNF-α. Stress exposure also persistently upregulated the brain expression of several key apoptotic (Bax, Caspase-3, Bcl-2) and epigenetic genes (DNMT3a, DNMT3b, HAT1, HDAC4) in these fish. Collectively, the present model not only successfully recapitulates lasting behavioral and endocrine symptoms of clinical stress-related disorders, but also implicates changes in neuroglia, neuroinflammation, apoptosis and epigenetic modulation in long-term effects of stress pathogenesis in vivo.

Behavioral and physiological effects of acute and chronic kava exposure in adult zebrafish.

Kava kava (Piper methysticum) is a medicinal plant containing kavalactones that exert potent sedative, analgesic and anti-stress action. However, their pharmacological effects and molecular targets remain poorly understood. The zebrafish (Danio rerio) has recently emerged as a powerful new model organism for neuroscience research and drug discovery. Here, we evaluate the effects of acute and chronic exposure to kava and kavalactones on adult zebrafish anxiety, aggression and sociality, as well as on their neurochemical, neuroendocrine and genomic responses. Supporting evolutionarily conserved molecular targets, acute kava and kavalactones evoked dose-dependent behavioral inhibition, upregulated brain expression of early protooncogenes c-fos and c-jun, elevated brain monoamines and lowered whole-body cortisol. Chronic 7-day kava exposure evoked similar behavioral effects, did not alter cortisol levels, and failed to evoke withdrawal-like states upon discontinuation. However, chronic kava upregulated several microglial (iNOS, Egr-2, CD11b), astrocytal (C3, C4B, S100a), epigenetic (ncoa-1) and pro-inflammatory (IL-1ß, IL-6, TNFa) biomarker genes, downregulated CD206 and IL-4, and did not affect major apoptotic genes in the brain. Collectively, this study supports robust, evolutionarily conserved behavioral and physiological effects of kava and kavalactones in zebrafish, implicates brain monoamines in their acute effects, and provides novel important insights into potential role of neuroglial and epigenetic mechanisms in long-term kava use.