Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 20 de 22
Filtrar
Mais filtros










Base de dados
Intervalo de ano de publicação
1.
Acta Biomater ; 177: 62-76, 2024 03 15.
Artigo em Inglês | MEDLINE | ID: mdl-38237713

RESUMO

The existing strategies for myocardial infarction therapy mainly focus on reinstating myocardial blood supply, often disregarding the intrinsic and intricate microenvironment created by elevated levels of reactive oxygen species (ROS) that accompanies myocardial infarction. This microenvironment entails cardiomyocytes apoptosis, substantial vascular cell death, excessive inflammatory infiltration and fibrosis. In such situation, the present study introduces a zinc-based nanozyme injectable multifunctional hydrogel, crafted from ZIF-8, to counteract ROS effects after myocardial infarction. The hydrogel exhibits both superoxide dismutase (SOD)-like and catalase (CAT)-like enzymatic activities, proficiently eliminating surplus ROS in the infarcted region and interrupting ROS-driven inflammatory cascades. Furthermore, the hydrogel's exceptional immunomodulatory ability spurs a notable transformation of macrophages into the M2 phenotype, effectively neutralizing inflammatory factors and indirectly fostering vascularization in the infarcted region. For high ROS and demanding for zinc of the infarcted microenvironment, the gradual release of zinc ions as the hydrogel degrades further enhances the bioactive and catalytic performance of the nanozymes, synergistically promoting cardiac function post myocardial infarction. In conclusion, this system of deploying catalytic nanomaterials within bioactive matrices for ROS-related ailment therapy not only establishes a robust foundation for biomedical material development, but also promises a holistic approach towards addressing myocardial infarction complexities. STATEMENT OF SIGNIFICANCE: Myocardial infarction remains the leading cause of death worldwide. However, the existing strategies for myocardial infarction therapy mainly focus on reinstating myocardial blood supply. These therapies often ignore the intrinsic and intricate microenvironment created by elevated levels of reactive oxygen species (ROS). Hence, we designed an injectable Zn-Based nanozyme hydrogel with ROS scavenging activity for myocardial infarction therapy. ALG-(ZIF-8) can significantly reduce ROS in the infarcted area and alleviate the ensuing pathological process. ALG-(ZIF-8) gradually releases zinc ions to participate in the repair process and improves cardiac function. Overall, this multifunctional hydrogel equipped with ZIF-8 makes full use of the characteristics of clearing ROS and slowly releasing zinc ions, and we are the first to test the therapeutic efficacy of Zinc-MOFs crosslinked-alginate hydrogel for myocardial infarction.


Assuntos
Hidrogéis , Infarto do Miocárdio , Humanos , Hidrogéis/farmacologia , Hidrogéis/uso terapêutico , Espécies Reativas de Oxigênio , Infarto do Miocárdio/terapia , Zinco/farmacologia , Zinco/uso terapêutico , Íons
2.
Adv Sci (Weinh) ; 10(36): e2303033, 2023 Dec.
Artigo em Inglês | MEDLINE | ID: mdl-37964406

RESUMO

Myocardial infarction (MI) is a major cause of mortality worldwide. The major limitation of regenerative therapy for MI is poor cardiac retention of therapeutics, which results from an inefficient vascular network and poor targeting ability. In this study, a two-layer intrinsically magnetic epicardial patch (MagPatch) prepared by 3D printing with biocompatible materials like poly (glycerol sebacate) (PGS) is designed, poly (ε-caprolactone) (PCL), and NdFeB. The two-layer structure ensured that the MagPatch multifariously utilized the magnetic force for rapid vascular reconstruction and targeted drug delivery. MagPatch accumulates superparamagnetic iron oxide (SPION)-labelled endothelial cells, instantly forming a ready-implanted organization, and rapidly reconstructs a vascular network anastomosed with the host. In addition, the prefabricated vascular network within the MagPatch allowed for the efficient accumulation of SPION-labelled therapeutics, amplifying the therapeutic effects of cardiac repair. This study defined an extendable therapeutic platform for vascularization-based targeted drug delivery that is expected to assist in the progress of regenerative therapies in clinical applications.


Assuntos
Infarto do Miocárdio , Poliésteres , Humanos , Poliésteres/química , Células Endoteliais , Materiais Biocompatíveis/química , Fenômenos Magnéticos
3.
Biomaterials ; 302: 122364, 2023 11.
Artigo em Inglês | MEDLINE | ID: mdl-37883909

RESUMO

A challenge in treating cardiac injury is the low heart-specificity of the drugs. Nanostructured lipid carriers (NLCs) are a relatively new format of lipid nanoparticles which have been used to deliver RNA and drugs. However, lipid nanoparticles exhibit higher affinity to the liver than the heart. To improve the delivery efficiency of NLCs into the heart, NLCs can be embedded into a scaffold and be locally released. In this study, a cardiac extracellular matrix (ECM) hydrogel-NLC composite was developed as a platform for cardiac repair. ECM-NLC composite gels at physiological conditions and releases payloads into the heart over weeks. ECM-NLC hydrogel carrying colchicine, an anti-inflammation agent, improved cardiac repair after myocardial infarction in mice. Transcriptome analysis indicated that Egfr downstream effectors participated in ECM-NLC-colchicine induced heart repair. In conclusion, ECM-NLC hydrogel is a potential platform for sustained and localized delivery of biomolecules into the heart, and loading appropriate medicines further increases the therapeutic efficacy of ECM-NLC hydrogel for cardiovascular diseases.


Assuntos
Infarto do Miocárdio , Nanoestruturas , Camundongos , Animais , Hidrogéis , Portadores de Fármacos , Anti-Inflamatórios , Lipídeos , Infarto do Miocárdio/tratamento farmacológico , Colchicina , Tamanho da Partícula
4.
Materials (Basel) ; 16(4)2023 Feb 07.
Artigo em Inglês | MEDLINE | ID: mdl-36837037

RESUMO

The formation and evolution of adiabatic shear behaviors, as well as the corresponding mechanical properties of a near-Ti-6Al-3Nb-2Zr-1Mo (Ti-6321) alloy during dynamic compression process, were systematically investigated by the split Hopkinson pressure bar (SHPB) compression tests in this paper. Ti-6321 samples containing three types of microstructures, i.e., equiaxed microstructure, duplex microstructure and Widmanstätten microstructure, were prepared to investigate the relationship between microstructures and dynamic mechanical behaviors under different strain rates in a range from 1000 s-1 to 3000 s-1. It was found by the dynamic strain-stress relation that the Ti-6321 alloys containing equiaxed microstructure, duplex microstructure and Widmanstätten microstructure all exhibited a strong strain-hardening effect. The samples containing equiaxed microstructure exhibited a larger flow stress than samples containing duplex microstructure and Widmanstätten microstructure. The adiabatic shearing behaviors in Ti-6321 alloy are significantly influenced by different types of microstructures. The formation of adiabatic shearing bands occurs in equiaxed microstructure when the strain rate is increased to 2000 s-1. The adiabatic shear bands are formed in duplex microstructure when the strain rate reaches 3000 s-1. However, the initiation of adiabatic shear bands is found in Widmanstätten microstructure under the strain rate of 1000 s-1. The Widmanstätten microstructure shows a larger sensitivity to adiabatic shearing than the equiaxed microstructure and duplex microstructure samples.

5.
Acad Radiol ; 30 Suppl 1: S220-S229, 2023 09.
Artigo em Inglês | MEDLINE | ID: mdl-36610930

RESUMO

OBJECTIVES: To prolong the survival, the value of a computed tomography-based radiomic score (RS) in stratifying survival and guiding personalized chemotherapy strategies in far-advanced gastric cancer (FGC) was investigated. MATERIALS AND METHODS: This retrospective multicenter study enrolled 283 FGC patients (cT4a/bNxM0-1) from three centers. Patients from one center were randomly divided into the training (n = 166) and internal validation (n = 83) cohorts, whereas the external validation cohort (n = 34) consisted of patients from the two other centers. The RS was calculated for each patient to predict progression-free survival (PFS). Features from the primary tumor and main metastasis (peritoneum, liver, and lymph node) were integrated in the training cohort and then validated for its ability to stratify PFS and overall survival (OS) in the validation cohort. The association between the RS and efficacy of neoadjuvant intraperitoneal and systemic (NIPS) therapy was also explored. RESULTS: The RS demonstrated a favorable prognostic ability to predict PFS in all cohorts (training: C-index 0.83, 95% confidence interval [CI]: 0.788-0.872; internal validation: C-index 0.75, 95% CI: 0.682-0.818; external validation: C-index 0.76, 95% CI: 0.669-0.851; all p < 0.05), as well as an excellent ability to stratify the PFS and OS in both the whole population and metastatic subgroups (p < 0.05). Patients with a low score were more likely to undergo surgery after perioperative chemotherapy (p < 0.05). Furthermore, only high-scoring patients with peritoneal metastasis benefited from NIPS. CONCLUSION: The RS may be an effective risk stratifier for the outcomes of FGC patients and may be used to select patients who can benefit from NIPS therapy.


Assuntos
Neoplasias Gástricas , Humanos , Neoplasias Gástricas/diagnóstico por imagem , Neoplasias Gástricas/patologia , Prognóstico , Intervalo Livre de Progressão , Estudos Retrospectivos , Tomografia Computadorizada por Raios X
6.
Ann Transl Med ; 10(10): 603, 2022 May.
Artigo em Inglês | MEDLINE | ID: mdl-35722368

RESUMO

Background: The precise etiology of approximately 50% of patients with recurrent spontaneous abortion (RSA) is unclear, known as unexplained recurrent spontaneous abortion (URSA). This study identified the genetic polymorphisms in patients with URSA. Methods: Genomic DNA was extracted from 30 couples with URSA and 9 couples with normal reproductive history for whole exome sequencing. Variations in annotation, filtering, and prediction of harmfulness and pathogenicity were examined. Furthermore, predictions of the effects of changes in protein structure, Sanger validation, and functional enrichment analyses were performed. The missense mutated genes with significant changes in protein function, and genes with mutations of premature stop, splice site, frameshift, and in-frame indel were selected as candidate mutated genes related to URSA. Results: In 30 unrelated couples with URSA, 50%, 20%, and 30% had 2, 3, and more than 4 miscarriages, respectively. Totally, 971 maternal and 954 paternal mutations were found to be pathogenic or possibly pathogenic after preliminary filtering. Total variations were not associated with age nor the number of miscarriages. In 28 patients (involving 23 couples), 22 pathogenic or possibly pathogenic variants of 19 genes were found to be strongly associated with URSA, with an abnormality rate of 76.67%. Among these, 12 missense variants showed obvious changes in protein functions, including ANXA5 (c.949G>C; p.G317R), APP (c.1530G>C; p.K510N), DNMT1 (c.2626G>A; p.G876R), FN1 (c.5621T>C; p.M1874T), MSH2 (c.1168G>A; p.L390F), THBS1 (c.2099A>G; p.N700S), KDR (c.2440G>A; p.D814N), POLR2B (c.406G>T; p.G136C), ITGB1 (c.655T>C; p.Y219H), PLK1 (c.1210G>T; p.A404S), COL4A2 (c.4808 A>C; p.H1603P), and LAMA4 (c.3158A>G; p.D1053G). Six other genes with mutations of premature stop, splice site, frameshift, and in-frame indel were also identified, including BUB1B (c.1648C>T; p.R550*) and MMP2 (c.1462_1464delTTC; p.F488del) from the father, and mutations from mother and/or father including BPTF (c.396_398delGGA; p.E138 del and c.429_431GGA; p.E148del), MECP2 (c.21_23delCGC; p.A7del), LAMA2 (HGVS: NA; Exon: NA; SPLICE_SITE, DONOR), and SOX21 (c.640 _641insT; p. A214fs, c.644dupC; p. A215fs and c.644_645ins ACGCGTCTTCTTCCCGCAGTC; p. A215dup). Conclusions: These pathogenic or potentially pathogenic mutated genes may be potential biomarkers for URSA and may play an auxiliary role in the treatment of URSA.

7.
Adv Sci (Weinh) ; 9(21): e2200856, 2022 07.
Artigo em Inglês | MEDLINE | ID: mdl-35603964

RESUMO

Fibrotic diseases remain a substantial health burden with few therapeutic approaches. A hallmark of fibrosis is the aberrant activation and accumulation of myofibroblasts, which is caused by excessive profibrotic cytokines. Conventional anticytokine therapies fail to undergo clinical trials, as simply blocking a single or several antifibrotic cytokines cannot abrogate the profibrotic microenvironment. Here, biomimetic nanoparticles based on autologous skin fibroblasts are customized as decoys to neutralize multiple fibroblast-targeted cytokines. By fusing the skin fibroblast membrane onto poly(lactic-co-glycolic) acid cores, these nanoparticles, termed fibroblast membrane-camouflaged nanoparticles (FNPs), are shown to effectively scavenge various profibrotic cytokines, including transforming growth factor-ß, interleukin (IL)-11, IL-13, and IL-17, thereby modulating the profibrotic microenvironment. FNPs are sequentially prepared into multiple formulations for different administration routines. As a proof-of-concept, in three independent animal models with various organ fibrosis (lung fibrosis, liver fibrosis, and heart fibrosis), FNPs effectively reduce the accumulation of myofibroblasts, and the formation of fibrotic tissue, concomitantly restoring organ function and indicating that FNPs are a potential broad-spectrum therapy for fibrosis management.


Assuntos
Fibroblastos , Nanopartículas , Animais , Fibrose , Miofibroblastos/patologia , Fator de Crescimento Transformador beta
9.
Photoacoustics ; 26: 100344, 2022 Jun.
Artigo em Inglês | MEDLINE | ID: mdl-35282297

RESUMO

Myocardial infarction (MI) is a major cause of morbidity and mortality worldwide. Modern therapeutic strategies targeting the infarct border area have been shown to benefit overall cardiac function after MI. However, there is no non-invasive diagnostic technique to precisely demarcate the MI boundary till to now. In this study, the feasibility of demarcating the MI border using dual-wavelength photoacoustic spectral analysis (DWPASA) was investigated. To quantify specific molecular characteristics before and after MI, "the ratio of the areas of the power spectral densities (R APSD)" was computed from the DWPASA results. Compared to the normal tissue, MI tissue was shown to contain more collagen, resulting in higher R APSD values (p < 0.001). Cross-sectional MI lengths and the MI area border demarcated in two dimensions by DWPASA were in substantial agreement with Masson staining (ICC = 0.76, p < 0.001, IoU = 0.72). R APSD has been proved that can be used as an indicator of disease evolution to distinguish normal and pathological tissues. These findings indicate that the DWPASA method may offer a new diagnostic solution for determining MI borders.

10.
Bioact Mater ; 7: 401-411, 2022 Jan.
Artigo em Inglês | MEDLINE | ID: mdl-34466741

RESUMO

Cardiovascular diseases such as myocardial infarction (MI) are among the major causes of death worldwide. Although intramyocardial injection of hydrogels can effectively enhance the ventricular wall, this approach is limited because of its restriction to the poor vascularization in the infarcted myocardium. Here, we reported a new type of hydrogel composed of alginate (ALG) and hyaluronic acid (HA) with lyophilized platelet-rich fibrin (Ly-PRF) for releasing abundant growth factors to realize their respective functions. The results of in vitro studies demonstrated favorable mechanical property and release ability of ALG-HA with Ly-PRF. When injected into the infarcted myocardium, this composite hydrogel preserved heart function and the Ly-PRF within the hydrogel promoted angiogenesis and increased vascular density in both infarcted and border zone, which rescued the ischemic myocardium. These beneficial effects were also accompanied by macrophage polarization and regulation of myocardial fibrosis. Moreover, the autologous origin of Ly-PRF with ALG-HA hydrogel offers myriad advantages including safety profile, easiness to obtain and cost-effectiveness. Overall, this study demonstrated the versatile therapeutic effects of a novel composite hydrogel ALG-HA with Ly-PRF, which optimizes a promising vascularized substitution strategy for improving cardiac function after MI.

11.
Nat Commun ; 12(1): 4395, 2021 07 20.
Artigo em Inglês | MEDLINE | ID: mdl-34285224

RESUMO

The unique properties of self-healing materials hold great potential in the field of biomedical engineering. Although previous studies have focused on the design and synthesis of self-healing materials, their application in in vivo settings remains limited. Here, we design a series of biodegradable and biocompatible self-healing elastomers (SHEs) with tunable mechanical properties, and apply them to various disease models in vivo, in order to test their reparative potential in multiple tissues and at physiological conditions. We validate the effectiveness of SHEs as promising therapies for aortic aneurysm, nerve coaptation and bone immobilization in three animal models. The data presented here support the translation potential of SHEs in diverse settings, and pave the way for the development of self-healing materials in clinical contexts.


Assuntos
Implantes Absorvíveis , Materiais Biocompatíveis/uso terapêutico , Engenharia Biomédica , Poliuretanos/uso terapêutico , Animais , Aneurisma Aórtico/cirurgia , Materiais Biocompatíveis/química , Modelos Animais de Doenças , Elastômeros/química , Fixação de Fratura/métodos , Fraturas Ósseas/cirurgia , Humanos , Masculino , Teste de Materiais , Camundongos , Transferência de Nervo/métodos , Traumatismos dos Nervos Periféricos/cirurgia , Poliuretanos/química , Ratos , Suínos , Porco Miniatura
12.
Redox Biol ; 44: 102020, 2021 08.
Artigo em Inglês | MEDLINE | ID: mdl-34077894

RESUMO

RATIONALE: Oxidative stress plays a critical role in the development of cardiac remodeling and heart failure. Lutein, the predominant nonvitamin A carotenoid, has been shown to have profound effects on oxidative stress. However, the effect of lutein on angiotensin II (Ang II)-induced cardiac remodeling and heart failure remains unknown. OBJECTIVE: The aim of this study was to determine whether lutein is involved in cardiac remodeling and to elucidate the underlying molecular mechanisms. METHODS AND RESULTS: In vitro experiments with isolated neonatal rat cardiomyocytes (NRCMs) and cardiac fibroblasts (CFs) revealed that lutein significantly attenuated Ang II-induced collagen expression in CFs, and cardiomyocyte hypertrophy. The Ang II-induced increases in superoxide generation, inflammation and apoptosis in cultured CFs were strikingly prevented by lutein. In vivo, fibrosis, hypertrophic cardiomyocyte and superoxide generation were analyzed, and lutein was demonstrated to confer resistance to Ang II-induced cardiac remodeling in mice. Mechanistically, RNA sequencing revealed that interleukin-11 (IL-11) expression was significantly upregulated in mouse hearts in response to Ang II infusion and was significantly suppressed in the hearts of lutein-treated mice. Furthermore, IL-11 overexpression blocked the effects of lutein on fibrosis and oxidative stress in CFs and impaired the protective effect of lutein on cardiac remodeling. Notably, we discovered that lutein could reduce Ang II-induced IL-11 expression, at least partly through the regulation of activator protein (AP)-1 expression and activity. CONCLUSIONS: Lutein has potential as a treatment for cardiac remodeling and heart failure via the suppression of IL-11 expression.


Assuntos
Angiotensina II , Fator de Transcrição AP-1 , Animais , Cardiomegalia/patologia , Fibrose , Interleucina-11 , Luteína , Camundongos , Camundongos Endogâmicos C57BL , Miocárdio/patologia , Ratos , Remodelação Ventricular
13.
Nat Med ; 27(3): 480-490, 2021 03.
Artigo em Inglês | MEDLINE | ID: mdl-33723455

RESUMO

Despite advances in technologies for cardiac repair after myocardial infarction (MI), new integrated therapeutic approaches still need to be developed. In this study, we designed a perfusable, multifunctional epicardial device (PerMed) consisting of a biodegradable elastic patch (BEP), permeable hierarchical microchannel networks (PHMs) and a system to enable delivery of therapeutic agents from a subcutaneously implanted pump. After its implantation into the epicardium, the BEP is designed to provide mechanical cues for ventricular remodeling, and the PHMs are designed to facilitate angiogenesis and allow for infiltration of reparative cells. In a rat model of MI, implantation of the PerMed improved ventricular function. When connected to a pump, the PerMed enabled targeted, sustained and stable release of platelet-derived growth factor-BB, amplifying the efficacy of cardiac repair as compared to the device without a pump. We also demonstrated the feasibility of minimally invasive surgical PerMed implantation in pigs, demonstrating its promise for clinical translation to treat heart disease.


Assuntos
Procedimentos Cirúrgicos Cardíacos/instrumentação , Infarto do Miocárdio/terapia , Próteses e Implantes , Animais , Materiais Biocompatíveis , Desenho de Equipamento , Neovascularização Fisiológica , Suínos , Remodelação Ventricular
14.
Biomaterials ; 258: 120254, 2020 11.
Artigo em Inglês | MEDLINE | ID: mdl-32805499

RESUMO

Coronary artery bypass graft (CABG) has been confirmed to effectively improve the prognosis of coronary artery disease, which is a major public health concern worldwide. As the most frequently used conduits in CABG, saphenous vein grafts have the disadvantage of being susceptible to restenosis due to intimal hyperplasia. To meet the urgent clinical demand, adopting external stents (eStents) and illuminating the potential mechanisms underlying their function are important for preventing vein graft failure. Here, using 4-axis printing technology, we fabricated a novel biodegradable and flexible braided eStent, which exerts excellent inhibitory effect on intimal hyperplasia. The stented grafts downregulate Yes-associated protein (YAP), indicating that the eStent regulates vein graft remodeling via the Hippo-YAP signaling pathway. Further, as a drug-delivery vehicle, a rapamycin (RM)-coated eStent was designed to amplify the inhibitory effect of eStent on intimal hyperplasia through the synergistic effects of the Hippo and mammalian target of rapamycin (mTOR) signaling pathways. Overall, this study uncovers the underlying mechanisms of eStent function and identifies a new therapeutic target for the prevention of vein graft restenosis.


Assuntos
Stents , Túnica Íntima , Ponte de Artéria Coronária , Oclusão de Enxerto Vascular/patologia , Humanos , Hiperplasia/patologia , Veia Safena/patologia , Transdução de Sinais , Túnica Íntima/patologia
15.
Sci Adv ; 6(25): eaaz3621, 2020 06.
Artigo em Inglês | MEDLINE | ID: mdl-32596444

RESUMO

Cardiovascular disorders are still the primary cause of mortality worldwide. Although intramyocardial injection can effectively deliver agents to the myocardium, this approach is limited because of its restriction to needle-mediated injection and the minor retention of agents in the myocardium. Here, we engineered phase-transition microneedles (MNs) coated with adeno-associated virus (AAV) and achieved homogeneous distribution of AAV delivery. Bioluminescence imaging revealed the successful delivery and transfection of AAV-luciferase. AAV-green fluorescent protein-transfected cardiomyocytes were homogeneously distributed on postoperative day 28. AAV-vascular endothelial growth factor (VEGF)-loaded MNs improved heart function by enhancing VEGF expression, promoting functional angiogenesis, and activating the Akt signaling pathway. The results indicated the superiority of MNs over direct muscle injection. Consequently, MNs might emerge as a promising tool with great versatility for delivering various agents to treat ischemic myocardial disease.


Assuntos
Cardiomiopatias , Isquemia Miocárdica , Dependovirus/genética , Técnicas de Transferência de Genes , Terapia Genética/métodos , Vetores Genéticos/genética , Humanos , Isquemia Miocárdica/genética , Isquemia Miocárdica/terapia , Fator A de Crescimento do Endotélio Vascular/genética , Fatores de Crescimento do Endotélio Vascular/genética
16.
Aging (Albany NY) ; 12(6): 5362-5383, 2020 03 25.
Artigo em Inglês | MEDLINE | ID: mdl-32209725

RESUMO

Reactive oxygen species (ROS) play a pivotal role in the development of pathological cardiac hypertrophy. Delphinidin, a natural flavonoid, was reported to exert marked antioxidative effects. Therefore, we investigated whether delphinidin ameliorates pathological cardiac hypertrophy via inhibiting oxidative stress. In this study, male C57BL/6 mice were treated with DMSO or delphinidin after surgery. Neonatal rat cardiomyocytes (NRCMs) were treated with angiotensin II (Ang II) and delphinidin in vitro. Eighteen-month-old mice were administered delphinidin to investigate the effect of delphinidin on aging-related cardiac hypertrophy. Through analyses of hypertrophic cardiomyocyte growth, fibrosis and cardiac function, delphinidin was demonstrated to confer resistance to aging- and transverse aortic constriction (TAC)-induced cardiac hypertrophy in vivo and attenuate Ang II-induced cardiomyocyte hypertrophy in vitro by significantly suppressing hypertrophic growth and the deposition of fibrosis. Mechanistically, delphinidin reduced ROS accumulation upon Ang II stimulation through the direct activation of AMP-activated protein kinase (AMPK) and subsequent inhibition of the activity of Rac1 and expression of p47phox. In addition, excessive levels of ERK1/2, P38 and JNK1/2 phosphorylation induced by oxidative stress were abrogated by delphinidin. Delphinidin was conclusively shown to repress pathological cardiac hypertrophy by modulating oxidative stress through the AMPK/NADPH oxidase (NOX)/mitogen-activated protein kinase (MAPK) signaling pathway.


Assuntos
Proteínas Quinases Ativadas por AMP/metabolismo , Antocianinas/farmacologia , Cardiomegalia/metabolismo , Angiotensina II/farmacologia , Animais , Fibrose/metabolismo , Masculino , Camundongos , Camundongos Endogâmicos C57BL , Miócitos Cardíacos/metabolismo , NADPH Oxidases/metabolismo , Estresse Oxidativo , Fosforilação , Ratos , Espécies Reativas de Oxigênio/metabolismo , Transdução de Sinais , Proteínas Quinases p38 Ativadas por Mitógeno/metabolismo
17.
Ann Transl Med ; 8(4): 102, 2020 Feb.
Artigo em Inglês | MEDLINE | ID: mdl-32175395

RESUMO

BACKGROUND: The poor long-term patency ratio of vein grafts prevents patients from benefiting from coronary artery bypass graft (CABG). It is reported that external venous stents have notably improved the patency ratio of stented vein grafts in animal models. The most crucial influence on stented grafts' fate is the size of the stents. This study aims to investigate the effects on intimal hyperplasia and inflammation of vein graft by using different sizes of stents and explore the potential mechanism. METHODS: Two different sizes of external stents were fabricated through 3D printing technology. Male SD rats were divided into three groups. In the control group rat's autologous left jugular vein was grafted on the ipsilateral artery directly. In the stent groups, grafts were surrounded by two different-sized stents before anastomosing with arteries. The patency ratio and diameter of the grafts were examined by ultrasound. Masson staining was used to characterize intimal hyperplasia. The expression of inflammatory factors was detected by immunohistochemical staining. Moreover, TUNEL staining was used to label apoptotic cells. RESULTS: The two sizes of external stents were fabricated by 3D printing technology. In the control group, the intima area and wall thickness dramatically increased 8 weeks after implantation. While in the stent groups, these data only slightly increased, especially in the 1.5 mm-stent group. The expressions of inflammatory factors in TNF signaling were more remarkable than in the control group. On the contrary, the expressions were rarely detected in the stent groups. Similarly, the number of TUNEL positive cells dramatically decreased by using the appropriate-sized stent. CONCLUSIONS: In this study, we concluded that the appropriate sizes of external stents could effectively inhibit vein graft neointima formation, attenuate inflammatory reaction and reduce cell apoptosis, which might improve the long-term patency ratio of vein grafts.

18.
ACS Appl Mater Interfaces ; 11(42): 38429-38439, 2019 Oct 23.
Artigo em Inglês | MEDLINE | ID: mdl-31573790

RESUMO

Implanted medical biomaterials are closely in contact with host biological systems via biomaterial-cell/tissue interactions, and these interactions play pivotal roles in regulating cell functions and tissue regeneration. However, many biomaterials degrade over time, and these degradation products also have been shown to interact with host cells/tissue. Therefore, it may prove useful to specifically design implanted biomaterials with degradation products which greatly improve the performance of the implant. Herein, we report an injectable, citrate-containing polyester hydrogel which can release citrate as a cell regulator via hydrogel degradation and simultaneously show sustained release of an encapsulated growth factor Mydgf. By coupling the therapeutic effect of the hydrogel degradation product (citrate) with encapsulated Mydgf, we observed improved postmyocardial infarction (MI) heart repair in a rat MI model. Intramyocardial injection of our Mydgf-loaded citrate-containing hydrogel was shown to significantly reduce scar formation and infarct size, increase wall thickness and neovascularization, and improve heart function. This bioactive injectable hydrogel-mediated combinatorial approach offers myriad advantages including potential adjustment of delivery rate and duration, improved therapeutic effect, and minimally invasive administration. Our rational design combining beneficial degradation product and controlled release of therapeutics provides inspiration toward the next generation of biomaterials aiming to revolutionize regenerative medicine.


Assuntos
Materiais Biocompatíveis/química , Ácido Cítrico/química , Hidrogéis/química , Interleucinas/química , Animais , Materiais Biocompatíveis/farmacologia , Materiais Biocompatíveis/uso terapêutico , Adesão Celular/efeitos dos fármacos , Proliferação de Células/efeitos dos fármacos , Modelos Animais de Doenças , Ecocardiografia , Coração/diagnóstico por imagem , Células Endoteliais da Veia Umbilical Humana , Humanos , Hidrogéis/farmacologia , Interleucinas/uso terapêutico , Camundongos , Infarto do Miocárdio/diagnóstico por imagem , Infarto do Miocárdio/tratamento farmacológico , Infarto do Miocárdio/patologia , Células NIH 3T3 , Neovascularização Fisiológica/efeitos dos fármacos , Polietilenoglicóis/química , Tomografia por Emissão de Pósitrons , Ratos , Reologia
19.
Acta Biomater ; 97: 321-332, 2019 10 01.
Artigo em Inglês | MEDLINE | ID: mdl-31523025

RESUMO

For the surgical treatment of coronary artery disease, renal artery stenosis and other peripheral vascular diseases, there is significant demand for small diameter (inner diameter <6 mm) vascular grafts. However, autologous grafts are not always available when the substitute vascular grafts are severely diseased. In our previous work, hybrid small-diameter vascular grafts were successfully fabricated by combining electrospun polycaprolactone (PCL) and decellularized rat aorta (DRA). However, histological assessments of these grafts revealed the development of intimal hyperplasia, indicating potential negative impacts on the long-term patency of these grafts. To address this challenge, PCL nanofibers blended with rapamycin (RM) were electrospun outside the decellularized vascular graft to fabricate a RM-loaded hybrid tissue-engineered vascular graft (RM-HTEV), endowing the graft with a drug delivery function to prevent intimal hyperplasia. RM-HTEV possessed superior mechanical properties compared to DRA and exhibited a sustained drug release profile. To evaluate the applicability of RM-HTEV in vivo, abdominal aorta transplantation was performed on rats. Doppler sonography showed that the grafts were functional for up to 8 weeks in vivo. Moreover, histological analysis of explanted grafts 12 weeks postimplantation demonstrated that RM-HTEV significantly decreased neo-intimal hyperplasia compared with HTEV, without impairing reendothelialization and M2 macrophage polarization. Overall, RM-HTEV represents a promising strategy for developing small-diameter vascular grafts with great clinical translational potential. STATEMENT OF SIGNIFICANCE: In this study, a new type of rapamycin-loaded hybrid tissue-engineered vascular graft (RM-HTEV) was fabricated using electrospinning technology. The unique hybrid bi-layer structure endowed the RM-HTEV with multi-functionality: the exterior rapamycin-loaded electrospun PCL nanofibrous layer enhanced the mechanical properties of the graft and possessed drug releasing property; the interior decellularized aorta layer with porous structure could facilitate cell proliferation and migration. In in vivo implantation experiment, RM-HTEV exhibited satisfying long-term patency rate and significantly inhibited intimal hyperplasia without impairing re-endothelialization and M2 macrophage polarization. This strategy is expected to be a promising strategy for developing bioactive small-diameter vascular grafts with great clinical translational potential.


Assuntos
Aorta Abdominal , Bioprótese , Prótese Vascular , Sistemas de Liberação de Medicamentos , Sirolimo , Túnica Íntima , Enxerto Vascular , Animais , Aorta Abdominal/metabolismo , Aorta Abdominal/patologia , Aorta Abdominal/transplante , Hiperplasia , Masculino , Ratos , Ratos Sprague-Dawley , Sirolimo/farmacocinética , Sirolimo/farmacologia , Túnica Íntima/metabolismo , Túnica Íntima/patologia
20.
Adv Healthc Mater ; 8(10): e1900065, 2019 05.
Artigo em Inglês | MEDLINE | ID: mdl-30941925

RESUMO

Myocardial remodeling, including ventricular dilation and wall thinning, is an important pathological process caused by myocardial infarction (MI). To intervene in this pathological process, a new type of cardiac scaffold composed of a thermoset (poly-[glycerol sebacate], PGS) and a thermoplastic (poly-[ε-caprolactone], PCL) is directly printed by employing fused deposition modeling 3D-printing technology. The PGS-PCL scaffold possesses stacked construction with regular crisscrossed filaments and interconnected micropores and exhibits superior mechanical properties. In vitro studies demonstrate favorable biodegradability and biocompatibility of the PGS-PCL scaffold. When implanted onto the infarcted myocardium, this scaffold improves and preserves heart function. Furthermore, the scaffold improves several vital aspects of myocardial remodeling. On the morphological level, the scaffold reduces ventricular wall thinning and attenuated infarct size, and on the cellular level, it enhances vascular density and increases M2 macrophage infiltration, which might further contribute to the mitigated myocardial apoptosis rate. Moreover, the flexible PGS-PCL scaffold can be tailored to any desired shape, showing promise for annular-shaped restraint device application and meeting the demands for minimal invasive operation. Overall, this study demonstrates the therapeutic effects and versatile applications of a novel 3D-printed, biodegradable and biocompatible cardiac scaffold, which represents a promising strategy for improving myocardial remodeling after MI.


Assuntos
Infarto do Miocárdio/patologia , Impressão Tridimensional , Alicerces Teciduais/química , Remodelação Ventricular , Animais , Materiais Biocompatíveis/química , Materiais Biocompatíveis/metabolismo , Materiais Biocompatíveis/farmacologia , Materiais Biocompatíveis/uso terapêutico , Sobrevivência Celular/efeitos dos fármacos , Decanoatos/química , Módulo de Elasticidade , Glicerol/análogos & derivados , Glicerol/química , Macrófagos/citologia , Macrófagos/imunologia , Macrófagos/metabolismo , Masculino , Infarto do Miocárdio/terapia , Miocárdio/patologia , Miócitos Cardíacos/citologia , Miócitos Cardíacos/metabolismo , Neovascularização Fisiológica , Poliésteres/química , Polímeros/química , Ratos , Ratos Sprague-Dawley , Resistência à Tração , Engenharia Tecidual
SELEÇÃO DE REFERÊNCIAS
DETALHE DA PESQUISA