Interactions of piRNAs with the mRNA of Candidate Genes in Esophageal Squamous Cell Carcinoma.

Recently, a database of human piRNAs (piwi-interacting RNAs) was created, which allows the study of the binding of many piRNAs to the mRNAs of genes involved in many diseases, including cancer. In the present work, we identified the piRNAs that can interact with candidate esophageal squamous cell carcinoma (ESCC) genes. The binding of 480 thousand piRNAs with the mRNAs of 66 candidate ESCC genes was studied. Bioinformatic studies found that piRNAs bind only to the mRNAs of nine candidate genes: AURKA, BMP7, GCOM1, ERCC1, MTHFR, SASH1, SIX4, SULT1A1, and TP53. It has been shown that piRNAs can bind to mRNA by overlapping nucleotide sequences in limited 3'UTR and 5'UTR regions called clusters of binding sites (BSs). The existence of clusters of piRNA BSs significantly reduces the proportion of the nucleotide sequences of these sites in the mRNA of target genes. Competition between piRNAs occurs for binding to the mRNA of target genes. Individual piRNAs and groups of piRNAs that have separate BSs and clusters of BSs in the mRNAs of two or more candidate genes have been identified in the mRNAs of these genes. This organization of piRNAs BSs indicates the interdependence of the expression of candidate genes through piRNAs. Significant differences in the ability of genes to interact with piRNAs prevent the side effects of piRNAs on genes with a lack of the ability to bind such piRNAs. Individual piRNAs and sets of piRNAs are proposed and recommended for the diagnosis and therapy of ESCC.

Endogenous piRNAs Can Interact with the Omicron Variant of the SARS-CoV-2 Genome.

Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), which caused the COVID-19 pandemic, can still infect populations in many countries around the globe. The Omicron strain is the most mutated variant of SARS-CoV-2. The high transmissibility of the strain and its ability to evade immunity necessitate a priority study of its properties in order to quickly create effective means of preventing its spread. The current research aimed to examine the in silico interaction between PIWI-interacting RNAs (piRNAs) and the SARS-CoV-2 genome (gRNA) to identify endogenous piRNAs and propose synthetic piRNAs with strong antiviral activity for drug development. This study used validated bioinformatic approaches regarding the interaction of more than eight million piRNAs with the SARS-CoV-2 genome. The piRNAs' binding sites (BSs) in the 5'UTR were located with overlapping nucleotide sequences termed clusters of BSs. Several BSs clusters have been found in the nsp3, nsp7, RNA-dependent RNA polymerase, endoRNAse, S surface glycoprotein, ORF7a, and nucleocapsid. Sixteen synthetic piRNAs that interact with gRNA have been proposed with free binding energy ranging from -170 kJ/mol to -175 kJ/mol, which can be used to create drugs that suppress the reproduction of SARS-CoV-2.

In Silico Study of piRNA Interactions with the SARS-CoV-2 Genome.

A prolonged pandemic with numerous human casualties requires a rapid search for means to control the various strains of SARS-CoV-2. Since only part of the human population is affected by coronaviruses, there are probably endogenous compounds preventing the spread of these viral pathogens. It has been shown that piRNA (PIWI-interacting RNAs) interact with the mRNA of human genes and can block protein synthesis at the stage of translation. Estimated the effects of piRNA on SARS-CoV-2 genomic RNA (gRNA) in silico. A cluster of 13 piRNA binding sites (BS) in the SARS-CoV-2 gRNA region encoding the oligopeptide was identified. The second cluster of BSs 39 piRNAs also encodes the oligopeptide. The third cluster of 24 piRNA BS encodes the oligopeptide. Twelve piRNAs were identified that strongly interact with the gRNA. Based on the identified functionally important endogenous piRNAs, synthetic piRNAs (spiRNAs) are proposed that will suppress the multiplication of the coronavirus even more strongly. These spiRNAs and selected endogenous piRNAs have little effect on human 17494 protein-coding genes, indicating a low probability of side effects. The piRNA and spiRNA selection methodology created for the control of SARS-CoV-2 (NC_045512.2) can be used to control all strains of SARS-CoV-2.

Bioinformatics Analysis of the Interaction of miRNAs and piRNAs with Human mRNA Genes Having di- and Trinucleotide Repeats.

The variability of nucleotide repeats is considered one of the causes of diseases, but their biological function is not understood. In recent years, the interaction of miRNAs and piRNAs with the mRNAs of genes responsible for developing neurodegenerative and oncological diseases and diabetes have been actively studied. We explored candidate genes with nucleotide repeats to predict associations with miRNAs and piRNAs. The parameters of miRNAs and piRNA binding sites with mRNAs of human genes having nucleotide repeats were determined using the MirTarget program. This program defines the start of the initiation of miRNA and piRNA binding to mRNAs, the localization of miRNA and piRNA binding sites in the 5'-untranslated region (5'UTR), coding sequence (CDS) and 3'-untranslated region (3'UTR); the free energy of binding; and the schemes of nucleotide interactions of miRNAs and piRNAs with mRNAs. The characteristics of miRNAs and piRNA binding sites with mRNAs of 73 human genes were determined. The 5'UTR, 3'UTR and CDS of the mRNAs of genes are involved in the development of neurodegenerative, oncological and diabetes diseases with GU, AC dinucleotide and CCG, CAG, GCC, CGG, CGC trinucleotide repeats. The associations of miRNAs, piRNAs and candidate target genes could be recommended for developing methods for diagnosing diseases, including neurodegenerative diseases, oncological diseases and diabetes.

piRNA and miRNA Can Suppress the Expression of Multiple Sclerosis Candidate Genes.

Multiple sclerosis (MS) is a common inflammatory demyelinating disease with a high mortality rate. MS is caused by many candidate genes whose specific involvement has yet to be established. The aim of our study was to identify endogenous miRNAs and piRNAs involved in the regulation of MS candidate gene expression using bioinformatic methods. A program was used to quantify the interaction of miRNA and piRNA nucleotides with mRNA of the target genes. We used 7310 miRNAs from three databases and 40,000 piRNAs. The mRNAs of the candidate genes revealed miRNA binding sites (BSs), which were located separately or formed clusters of BSs with overlapping nucleotide sequences. The miRNAs from the studied databases were generally bound to mRNAs in different combinations, but miRNAs from only one database were bound to the mRNAs of some genes. For the first time, a direct interaction between the complete sequence of piRNA nucleotides and the nucleotides of their mRNA BSs of target genes was shown. One to several clusters of BSs of miRNA and piRNA were identified in the mRNA of ADAM17, AHI1, CD226, EOMES, EVI5, IL12B, IL2RA, KIF21B, MGAT5, MLANA, SOX8, TNFRSF1A, and ZBTB46 MS candidate genes. These piRNAs form the expression regulation system of the MS candidate genes to coordinate the synthesis of their proteins. Based on these findings, associations of miRNAs, piRNAs, and candidate genes for MS diagnosis are recommended.

Predicting Associations of miRNAs and Candidate Gastric Cancer Genes for Nanomedicine.

Nanoscale miRNAs regulate the synthesis of most human proteins involved in differentiation, proliferation, cell cycle, apoptosis, and other processes associated with the growth and the development of an organism. miRNAs also play a number of important roles in the development of gastric cancer. In this work, we studied the quantitative characteristics of miRNA interactions with 69 candidate gastric cancer genes using bioinformatics approaches. To this end, the MirTarget program was used, which determines the characteristics of miRNA binding to mRNA in the 5'UTR, CDS, and 3'UTR. Associations of miRNAs with alternative target genes and associations of genes with alternative miRNAs were established. The cluster organization of miRNA binding sites (BSs) in mRNA was revealed, leading to the emergence of miRNA competition for binding to the mRNA of a target gene. Groups of target genes with clusters of overlapping BSs include miR-5095, miR-619-5p, miR-1273 family, miR-466, ID01030.3p-miR, ID00436.3p-miR, miR-574-5p, and ID00470.5p-miR. In the defined associations of target genes and miRNAs, miRNA BSs are organized into clusters of multiple BSs, which facilitate the design and the development of a system of chips that can be used to control the state of miRNA and target genes associations in gastric cancer.

Evolutionary Changes in the Interaction of miRNA With mRNA of Candidate Genes for Parkinson's Disease.

Parkinson's disease (PD) exhibits the second-highest rate of mortality among neurodegenerative diseases. PD is difficult to diagnose and treat due to its polygenic nature. In recent years, numerous studies have established a correlation between this disease and miRNA expression; however, it remains necessary to determine the quantitative characteristics of the interactions between miRNAs and their target genes. In this study, using novel bioinformatics approaches, the quantitative characteristics of the interactions between miRNAs and the mRNAs of candidate PD genes were established. Of the 6,756 miRNAs studied, more than one hundred efficiently bound to mRNA of 61 candidate PD genes. The miRNA binding sites (BS) were located in the 5'-untranslated region (5'UTR), coding sequence (CDS) and 3'-untranslated region (3'UTR) of the mRNAs. In the mRNAs of many genes, the locations of miRNA BS with overlapping nucleotide sequences (clusters) were identified. Such clusters substantially reduced the proportion of nucleotide sequences of miRNA BS in the 5'UTRs, CDSs, and 3'UTRs. The organization of miRNA BS into clusters leads to competition among miRNAs to bind mRNAs. Differences in the binding characteristics of miRNAs to the mRNAs of genes expressed at different rates were identified. Single miRNA BS, polysites for the binding for one miRNA, and multiple BS for two or more miRNAs in one mRNA were identified. Evolutionary changes in the BS of miRNAs and their clusters in 5'UTRs, CDSs and 3'UTRs of mRNA of orthologous candidate PD genes were established. Based on the quantitative characteristics of the interactions between miRNAs and mRNAs candidate PD genes, several associations recommended as markers for the diagnosis of PD.

Identification of Bovine miRNAs with the Potential to Affect Human Gene Expression.

Milk and other products from large mammals have emerged during human evolution as an important source of nutrition. Recently, it has been recognized that exogenous miRNAs (mRNA inhibited RNA) contained in milk and other tissues of the mammalian body can enter the human body, which in turn have the ability to potentially regulate human metabolism by affecting gene expression. We studied for exogenous miRNAs from Bos taurus that are potentially contain miRNAs from milk and that could act postprandially as regulators of human gene expression. The interaction of 17,508 human genes with 1025 bta-miRNAs, including 245 raw milk miRNAs was studied. The milk bta-miR-151-5p, bta-miR-151-3p, bta-miRNA-320 each have 11 BSs (binding sites), and bta-miRNA-345-5p, bta-miRNA-614, bta-miRNA-1296b and bta-miRNA-149 has 12, 14, 15 and 26 BSs, respectively. The bta-miR-574-5p from cow's milk had 209 human genes in mRNAs from one to 25 repeating BSs. We found 15 bta-miRNAs that have 100% complementarity to the mRNA of 13 human target genes. Another 12 miRNAs have BSs in the mRNA of 19 human genes with 98% complementarity. The bta-miR-11975, bta-miR-11976, and bta-miR-2885 BSs are located with the overlap of nucleotide sequences in the mRNA of human genes. Nucleotide sequences of BSs of these miRNAs in 5'UTR mRNA of human genes consisted of GCC repeats with a total length of 18 nucleotides (nt) in 18 genes, 21 nt in 11 genes, 24 nt in 14 genes, and 27-48 nt in nine genes. Nucleotide sequences of BSs of bta-miR-11975, bta-miR-11976, and bta-miR-2885 in CDS mRNA of human genes consisted of GCC repeats with a total length of 18 nt in 33 genes, 21 nt in 13 genes, 24 nt in nine genes, and 27-36 nt in 11 genes. These BSs encoded polyA or polyP peptides. In only one case, the polyR (SLC24A3 gene) was encoded. The possibility of regulating the expression of human genes by exogenous bovine miRNAs is discussed.

In silico Prediction of miRNA Interactions With Candidate Atherosclerosis Gene mRNAs.

The involvement of genes and miRNAs in the development of atherosclerosis is a challenging problem discussed in recent publications. It is necessary to establish which miRNAs affect the expression of candidate genes. We used known candidate atherosclerosis genes to predict associations. The quantitative characteristics of interactions of miRNAs with mRNA candidate genes were determined using the program, which identifies the localization of miRNA binding sites in mRNA, the free energy interaction of miRNA with mRNA. In mRNAs of GAS6 and NFE2L2 candidate genes, binding sites of 21 miRNAs and of 15 miRNAs, respectively, were identified. In IRS2 mRNA binding sites of 25 miRNAs were located in a cluster of 41 nt. In ADRB3, CD36, FASLG, FLT1, PLA2G7, and PPARGC1A mRNAs, clusters of miR-466, ID00436.3p-miR, and ID01030.3p-miR BS were identified. The organization of overlapping miRNA binding sites in clusters led to their compaction and caused competition among the miRNAs. The binding of 53 miRNAs to the mRNAs of 14 candidate genes with free energy interactions greater than -130 kJ/mole was determined. The miR-619-5p was fully complementary to ADAM17 and CD36 mRNAs, ID01593.5p-miR to ANGPTL4 mRNA, ID01935.5p-miR to NFE2L2, and miR-5096 to IL18 mRNA. Associations of miRNAs and candidate atherosclerosis genes are proposed for the early diagnosis of this disease.

In silico prediction of human genes as potential targets for rice miRNAs.

BACKGROUND: Exogenous microRNAs (miRNAs) enter the human body through food, and their effects on metabolic processes can be considerable. It is important to determine which miRNAs from plants affect the expression of human genes and the extent of their influence. METHOD: The binding sites of 738Oryza sativa miRNAs (osa-miRNAs) that interact with 17 508 mRNAs of human genes were determined using the MirTarget program. RESULT: The characteristics of the binding of 46 single osa-miRNAs to 86 mRNAs of human genes with a value of free energy (ΔG) interaction equal 94%-100% from maximum ΔG were established. The findings showed that osa-miR2102-5p, osa-miR5075-3p, osa-miR2097-5p, osa-miR2919 targeted the largest number of genes at 38, 36, 23, 19 sites, respectively. mRNAs of 86 human genes were identified as targets for 93 osa-miRNAs of all family osa-miRNAs with ΔG values equal 94%-98% from maximum ΔG. Each miRNA of the osa-miR156-5p, osa-miR164-5p, osa-miR168-5p, osa-miR395-3p, osa-miR396-3p, osa-miR396-5p, osa-miR444-3p, osa-miR529-3p, osa-miR1846-3p, osa-miR2907-3p families had binding sites in mRNAs of several human target genes. The binding sites of osa-miRNAs in mRNAs of the target genes for each family of osa-miRNAs were conserved when compared to flanking nucleotide sequences. CONCLUSION: Target mRNA human genes of osa-miRNAs are also candidate genes of cancer, cardiovascular and neurodegenerative diseases.

Prediction of clusters of miRNA binding sites in mRNA candidate genes of breast cancer subtypes.

The development of breast cancer (BC) subtypes is controlled by distinct sets of candidate genes, and the expression of these genes is regulated by the binding of their mRNAs with miRNAs. Predicting miRNA associations and target genes is thus essential when studying breast cancer. The MirTarget program identifies the initiation of miRNA binding to mRNA, the localization of miRNA binding sites in mRNA regions, and the free energy from the binding of all miRNA nucleotides with mRNA. Candidate gene mRNAs have clusters (miRNA binding sites with overlapping nucleotide sequences). mRNAs of EPOR, MAZ and NISCH candidate genes of the HER2 subtype have clusters, and there are four clusters in mRNAs of MAZ, BRCA2 and CDK6 genes. Candidate genes of the triple-negative subtype are targets for multiple miRNAs. There are 11 sites in CBL mRNA, five sites in MMP2 mRNA, and RAB5A mRNA contains two clusters in each of the three sites. In SFN mRNA, there are two clusters in three sites, and one cluster in 21 sites. Candidate genes of luminal A and B subtypes are targets for miRNAs: there are 21 sites in FOXA1 mRNA and 15 sites in HMGA2 mRNA. There are clusters of five sites in mRNAs of ITGB1 and SOX4 genes. Clusters of eight sites and 10 sites are identified in mRNAs of SMAD3 and TGFB1 genes, respectively. Organizing miRNA binding sites into clusters reduces the proportion of nucleotide binding sites in mRNAs. This overlapping of miRNA binding sites creates a competition among miRNAs for a binding site. From 6,272 miRNAs studied, only 29 miRNAs from miRBase and 88 novel miRNAs had binding sites in clusters of target gene mRNA in breast cancer. We propose using associations of miRNAs and their target genes as markers in breast cancer subtype diagnosis.

The Binding Sites of miR-619-5p in the mRNAs of Human and Orthologous Genes.

BACKGROUND: Normally, one miRNA interacts with the mRNA of one gene. However, there are miRNAs that can bind to many mRNAs, and one mRNA can be the target of many miRNAs. This significantly complicates the study of the properties of miRNAs and their diagnostic and medical applications. RESULTS: The search of 2,750 human microRNAs (miRNAs) binding sites in 12,175 mRNAs of human genes using the MirTarget program has been completed. For the binding sites of the miR-619-5p the hybridization free energy of the bonds was equal to 100% of the maximum potential free energy. The mRNAs of 201 human genes have complete complementary binding sites of miR-619-5p in the 3'UTR (214 sites), CDS (3 sites), and 5'UTR (4 sites). The mRNAs of CATAD1, ICA1L, GK5, POLH, and PRR11 genes have six miR-619-5p binding sites, and the mRNAs of OPA3 and CYP20A1 genes have eight and ten binding sites, respectively. All of these miR-619-5p binding sites are located in the 3'UTRs. The miR-619-5p binding site in the 5'UTR of mRNA of human USP29 gene is found in the mRNAs of orthologous genes of primates. Binding sites of miR-619-5p in the coding regions of mRNAs of C8H8orf44, C8orf44, and ISY1 genes encode the WLMPVIP oligopeptide, which is present in the orthologous proteins. Binding sites of miR-619-5p in the mRNAs of transcription factor genes ZNF429 and ZNF429 encode the AHACNP oligopeptide in another reading frame. Binding sites of miR-619-5p in the 3'UTRs of all human target genes are also present in the 3'UTRs of orthologous genes of mammals. The completely complementary binding sites for miR-619-5p are conservative in the orthologous mammalian genes. CONCLUSIONS: The majority of miR-619-5p binding sites are located in the 3'UTRs but some genes have miRNA binding sites in the 5'UTRs of mRNAs. Several genes have binding sites for miRNAs in the CDSs that are read in different open reading frames. Identical nucleotide sequences of binding sites encode different amino acids in different proteins. The binding sites of miR-619-5p in 3'UTRs, 5'UTRs and CDSs are conservative in the orthologous mammalian genes.

miR156- and miR171-binding sites in the protein-coding sequences of several plant genes.

We identified the interaction sites of several miRNAs with the mRNAs from paralogs and orthologs of the SPL and HAM genes in A. thaliana. miRNAs from the miR156 and miR157 families in A. thaliana are shown to have binding sites within the mRNAs of SPL genes. The ath-miR156a-j binding sites located in the mRNAs of the SPL paralogs contain the sequence GUGCUCUCUCUCUUCUGUCA. This sequence encodes the ALSLLS motif. miR157a-d bind to mRNAs of the SPL family at the same site. We suggest merging the miR156 and miR157 families into one family. Several SPL genes in eight plants contain conserved miR156 binding sites. GUGCUCUCUCUCUUCUGUCA polynucleotide is homologous in its binding sites. The ALSLLS hexapeptide is also conserved in the SPL proteins from these plants. Binding sites for ath-miR171a-c and ath-miR170 in HAM1, HAM2, and HAM3 paralog mRNAs are located in the CDSs. The conserved miRNA binding sequence GAUAUUGGCGCGGCUCAAUCA encodes the ILARLN hexapeptide. Nucleotides within the HAM1, HAM2, and HAM3 miRNA binding sites are conserved in the mRNAs of 37 orthologs from 13 plants. The miR171- and miR170-binding sites within the ortholog mRNAs were conserved and encode the ILARLN motif. We suggest that the ath-miR170 and ath-miR171a-c families should be in one family.

miR-1279, miR-548j, miR-548m, and miR-548d-5p binding sites in CDSs of paralogous and orthologous PTPN12, MSH6, and ZEB1 Genes.

Only PTPN12, MSH6, and ZEB1 have significant miR-1279 binding sites among paralogous genes of human tyrosine phosphatase family, DNA mismatch repair family, and zinc finger family, respectively. All miRNA binding sites are located within CDSs of studied mRNAs. Nucleotide sequences of hsa-miR-1279 binding sites with mRNAs of human PTPN12, MSH6, and ZEB1 genes encode TKEQYE, EGSSDE, and GEKPYE oligopeptides, respectively. The conservation of miRNA binding sites encoding oligopeptides has been revealed. MRNAs of many paralogs of zinc finger gene family have from 1 to 12 binding sites coding the same GEKPYE hexapeptide. MRNAs of PTPN12, MSH6, and ZEB1 orthologous genes from different animal species have binding sites for hsa-miR-1279 which consist of homologous oligonucleotides encoding similar human oligopeptides TKEQYE, EGSSDE, and GEKPYE. MiR-548j, miR-548m, and miR-548d-5p have homologous binding sites in the mRNA of PTPN12 orthologous genes which encode PRTRSC, TEATDI, and STASAT oligopeptides, respectively. All regions of miRNA are important for binding with the mRNA.