RESUMO
CD36 may defect on platelets and/or monocytes in healthy individuals, which was defined as CD36 deficiency. However, we did not know the correlation between the molecular and protein levels completely. Here, we aim to determine the polymorphisms of the CD36 gene, RNA level, and CD36 on platelets and in plasma. The individuals were sequenced by Sanger sequencing. Bioinformational analysis was used by the HotMuSiC, CUPSAT, SAAFEC-SEQ, and FoldX. RNA analysis and CD36 protein detection were performed by qPCR, flow cytometry, and ELISA. In this study, we found c.1228_1239delATTGTGCCTATT (allele frequency = 0.0072) with the highest frequency among our cohort, and one mutation (c.1329_1354dupGATAGAAATGATCTTACTCAGTGTTG) was not present in the dbSNP database. 5 mutations located in the extracellular domain sequencing region with confirmation in deficient individuals, of which c.284T>C, c.512A>G, c.572C>T, and c.869T>C were found to have a deleterious impact on CD36 protein stability. Furthermore, the MFI of CD36 expression on platelets in the mutation-carry, deleterious-effect, and deficiency group was significantly lower than the no-mutation group (P < 0.0500). In addition, sCD36 levels in type II individuals were significantly lower compared with positive controls (P = 0.0060). Nevertheless, we found the presence of sCD36 in a type I individual. RNA analysis showed CD36 RNA levels in platelets of type II individuals were significantly lower than the positive individuals (P = 0.0065). However, no significant difference was observed in monocytes (P = 0.7500). We identified the most prevalent mutation (c.1228_1239delATTGTGCCTATT) among Kunming donors. Besides, our results suggested RNA level alterations could potentially underlie type II deficiency. Furthermore, sCD36 may hold promise for assessing immune reaction risk in CD36-deficient individuals, but more studies should be conducted to validate this hypothesis.
Assuntos
Transtornos Plaquetários , Antígenos CD36 , Humanos , Antígenos CD36/genética , Plaquetas , Bases de Dados Factuais , RNARESUMO
Cancer is the main cause of death in the world. There are several therapies that are in practice for cancer cure including radiotherapy, chemotherapy, and surgery. Among the chemotherapies, natural products are considered comparable safe, easily available and cost effective. Approximately 60% of cancer approved FDA drugs are natural products including vinblastine, doxorubicin, and paclitaxel. These natural products have complex structures due to which they work against cancer through different molecular pathways, STAT3, NF-kB, PI3K/AKT/mTOR, cell cycle arrest, mitochondrial dependent pathway, extrinsic apoptosis pathway, autophagy, mitophagy and ferroptosis. AA is a natural abietane diterpenoid compound from Pinus palustris and Pimenta racemose var. grissea with different pharmacological activities including anti-inflammatory, anti-convulsant, anti-obesity and anti-allergic. Recently it has been reported with its anticancer activities through different molecular mechanisms including NF-kB, PI3K/AKT, call cycle arrest at G0/G1 phase, mitochondrial dependent pathway, extrinsic apoptosis pathway, AMPK pathway and ferroptosis pathways. The literature survey reveals that there is no review on AA anticancer molecular mechanisms, therefore in current review, we summarize the anticancer molecular mechanisms of AA.
RESUMO
OBJECTIVES: Synchronous adenomas of the major and minor duodenal papilla are seldom reported. The aim of this study was to describe the characteristics of synchronous major and minor papilla adenomas and to evaluate the safety and efficacy of endoscopic papillectomy (EP) for the management of the disease. METHODS: Consecutive patients who underwent endoscopy for synchronous major and minor papilla adenomas from January 1, 2013 to August 31, 2023 were analyzed retrospectively. Patients' characteristics, clinical manifestations, laboratory, imaging and endoscopic findings were collected. RESULTS: The nine patients with synchronous major and minor papilla adenomas had an average age of 50.78 ± 10.70 years. The diameter of major and minor papilla adenomas was 12.11 ± 3.41 mm and 6.11 ± 1.05 mm, respectively. Most major papilla adenomas had R0 horizontal margins (n = 8), while R0 vertical margins were achieved in all patients. While minor papilla adenomas were resected with both R0 horizontal and vertical margins in all patients. Post-EP bleeding was observed in one patient, which was classified as mild. Post-EP hyperamylasemia and pancreatitis was observed in two and four patients, respectively; the latter consisted of three with mild pancreatitis and one with severe pancreatitis. No perforation was observed. The mean follow-up duration was 9.22 ± 5.99 months. Histologically confirmed recurrence at the resection site was detected in one patient at 3 months after the procedure. CONCLUSIONS: Synchronous major and minor papilla adenomas may not be as rare as previously speculated. EP may be an effective and safe alternative modality for their management.
RESUMO
OBJECTIVE: To explore the clinical manifestations, pathological features, immunophenotype, as well as diagnosis, treatment and prognosis of patients with CD4-CD56+ blastic plasmacytoid dendritic cell neoplasm (BPDCN), in order to further understand the rare disease. METHODS: The clinical data, laboratory examinations and treatment regimens of two patients with CD4-CD56+ BPDCN in the First Affiliated Hospital of Wannan Medical College were retrospectively analyzed. RESULTS: The two patients were both elderly males with tumor involved in skin, bone marrow, lymph nodes, etc. Immunohistochemical results of skin lesions showed that both CD56 and CD123 were positive, while CD4, CD34, TdT, CD3, CD20, MPO and EBER were negative. Flow cytometry of bone marrow demonstrated that CD56, CD123, and CD304 were all positive, while specific immune markers of myeloid and lymphoid were negative. Two patients were initially very sensitive to acute lymphoblastic leukemia or lymphomatoid chemotherapy regimens, but prone to rapid relapse. The overall survival of both patients was 36 months and 4 months, respectively. CONCLUSION: CD4-CD56+ BPDCN is very rare and easily misdiagnosed as other hematological tumors with poor prognosis. Acute lymphoblastic leukemia or lymphomatoid therapy should be used first to improve the poor prognosis.
Assuntos
Antígeno CD56 , Células Dendríticas , Humanos , Antígeno CD56/metabolismo , Masculino , Estudos Retrospectivos , Prognóstico , Neoplasias Hematológicas , Antígenos CD4/metabolismo , Imunofenotipagem , IdosoRESUMO
This study assesses the status of outcome measures in the randomized controlled trial(RCT) involving the kidney-tonif-ying and blood-activating method for treating knee osteoarthritis(KOA), aiming to establish a theoretical foundation for the development of a core set of outcome measures in traditional Chinese medicine(TCM) treatment of KOA. The relevant articles were retrieved from CNKI, Wanfang, VIP, SinoMed, PubMed, EMbase, Cochrane Library, and Web of Science, in addition to ClinicalTrials.gov and the China Clinical Trial Registration Center, with the time interval from inception to August 2023. The RCT of treating KOA with the kidney-tonifying and blood-activating method was included. Two assessors independently conducted literature screening, data collection, and qualitative analysis to compile the outcome measure results. A total of 350 RCTs were included, involving 165 outcome measures with the total frequency of 1 462. These outcome measures were categorized into six domains: symptom and sign measures(23) with the frequency of 718(49.1%), TCM symptom and syndrome measures(3) with the frequency of 53(3.6%), physical examination measures(130) with the frequency of 506(34.6%), quality of life measures(4) with the frequency of 20(1.3%), long-term efficacy measures(2) with the frequency of 6(0.4%), and safety measures(3) with the frequency of 159(10.9%). Additionally, 53 studies used TCM syndrome and symptom scores as indicators of efficacy, employing eight distinct measurement tools. The RCTs involving the kidney-tonifying and blood-activating method for treating KOA had a variety of problems, such as unclear prio-ritization of outcome measures, diversity in measurement tools, absence of standardized assessment criteria for specific measures, and non-standardized usage. These problems affected the research quality and reliability. Hence, it is advisable to draw upon international expertise, improve research design, and merge TCM efficacy characteristics with clinical research to establish a core set of KOA outcome measures aligned with TCM principles.
Assuntos
Osteoartrite do Joelho , Humanos , Osteoartrite do Joelho/tratamento farmacológico , Qualidade de Vida , Reprodutibilidade dos Testes , Ensaios Clínicos Controlados Aleatórios como Assunto , Medicina Tradicional Chinesa , Avaliação de Resultados em Cuidados de Saúde , Rim , Resultado do TratamentoRESUMO
Acetaminophen (APAP), the most frequently used mild analgesic and antipyretic drug worldwide, is implicated in causing 46% of all acute liver failures in the USA and between 40% and 70% in Europe. The predominant pharmacological intervention approved for mitigating such overdose is the antioxidant N-acetylcysteine (NAC); however, its efficacy is limited in cases of advanced liver injury or when administered at a late stage. In the current study, we discovered that treatment with a moderate intensity static magnetic field (SMF) notably reduced the mortality rate in mice subjected to high-dose APAP from 40% to 0%, proving effective at both the initial liver injury stage and the subsequent recovery stage. During the early phase of liver injury, SMF markedly reduced APAP-induced oxidative stress, free radicals, and liver damage, resulting in a reduction in multiple oxidative stress markers and an increase in the antioxidant glutathione (GSH). During the later stage of liver recovery, application of vertically downward SMF increased DNA synthesis and hepatocyte proliferation. Moreover, the combination of NAC and SMF significantly mitigated liver damage induced by high-dose APAP and increased liver recovery, even 24 h post overdose, when the effectiveness of NAC alone substantially declines. Overall, this study provides a non-invasive non-pharmaceutical tool that offers dual benefits in the injury and repair stages following APAP overdose. Of note, this tool can work as an alternative to or in combination with NAC to prevent or minimize liver damage induced by APAP, and potentially other toxic overdoses.
Assuntos
Acetaminofen , Analgésicos não Narcóticos , Doença Hepática Induzida por Substâncias e Drogas , Overdose de Drogas , Acetaminofen/toxicidade , Animais , Camundongos , Analgésicos não Narcóticos/toxicidade , Estresse Oxidativo/efeitos dos fármacos , Masculino , Campos Magnéticos , Acetilcisteína/uso terapêutico , Acetilcisteína/farmacologiaRESUMO
Real-time tracking of intracellular carbohydrates remains challenging. While click chemistry allows bio-orthogonal tagging with fluorescent probes, the reaction permanently alters the target molecule and only allows a single snapshot. Here, we demonstrate click-free mid-infrared photothermal (MIP) imaging of azide-tagged carbohydrates in live cells. Leveraging the micromolar detection sensitivity for 6-azido-trehalose (TreAz) and the 300-nm spatial resolution of MIP imaging, the trehalose recycling pathway in single mycobacteria, from cytoplasmic uptake to membrane localization, is directly visualized. A peak shift of azide in MIP spectrum further uncovers interactions between TreAz and intracellular protein. MIP mapping of unreacted azide after click reaction reveals click chemistry heterogeneity within a bacterium. Broader applications of azido photothermal probes to visualize the initial steps of the Leloir pathway in yeasts and the newly synthesized glycans in mammalian cells are demonstrated.
RESUMO
We here reported a highly stereoselective method for the synthesis of polysubstituted conjugated dienes from α-aryl α-diazo alkynyl ketones and pyrazole-substituted unsymmetric aminals under mild conditions, which was promoted by photo-irridation and involved with 1,6-dipolar intermediate and quadruple sigmatropic rearrangements, was successfully developed. In this transformation, the cleavage of four bonds and the recombination of five bonds were implemented in one operational step. This protocol provided a modular tool for constructing dienes from amines, pyrazoles and α-alkynyl-α-diazoketones in one-pot manner. The results of mechanistic investigation indicated that the plausible reaction path underwent the 1,6-sigmatropic rearrangement instead of the 1,5-sigmatropic rearrangement.
RESUMO
Nb2O5 has been viewed as a promising anode material for lithium-ion batteries by virtue of its appropriate redox potential and high theoretical capacity. However, it suffers from poor electric conductivity and low ion diffusivity. Herein, we demonstrate the controllable fabrication of Cu-doped Nb2O5 with orthorhombic (T-Nb2O5) and monoclinic (H-Nb2O5) phases through annealing the solvothermally presynthesized Nb2O5 precursor under different temperatures in air, and the Cu doping amount can be readily controlled by the concentration of the precursor solution, whose effect on the lithium storage behaviors of the Cu-doped Nb2O5 is thoroughly investigated. H-Nb2O5 shows obvious redox peaks (Nb5+/Nb4+ and Nb4+/Nb3+) with much higher capacity and better cycling stability than those for the widely investigated T-Nb2O5. When introducing appropriate Cu doping, the optimized H-Cu0.1-Nb2O5 electrode shows greatly enhanced conductivity and lower diffusion barrier as revealed by the theoretical calculations and electrochemical characterizations, delivering a high reversible capacity of 203.6 mAh g-1 and a high capacity retention of 140.8 mAh g-1 after 5000 cycles at 1 A g-1, with a high initial Coulombic efficiency of 91% and a high rate capacity of 144.2 mAh g-1 at 4 A g-1. As a demonstration for full-cell application, the H-Cu0.1-Nb2O5||LiFePO4 cell displays good cycling performance, exhibiting a reversible capacity of 135 mAh g-1 after 200 cycles at 0.2 A g-1. More importantly, this work offers a new synthesis protocol of the monoclinic Nb2O5 phase with high capacity retention and improved reaction kinetics.
RESUMO
Recent studies have shown that cellular levels of polyamines (PAs) are significantly altered in neurodegenerative diseases. Evidence from in vivo animal and in vitro cell experiments suggests that the cellular levels of various PAs may play important roles in the central nervous system through the regulation of oxidative stress, mitochondrial metabolism, cellular immunity, and ion channel functions. Dysfunction of PA metabolism related enzymes also contributes to neuronal injury and cognitive impairment in many neurodegenerative diseases. Therefore, in the current work, evidence was collected to determine the possible associations between cellular levels of PAs, and related enzymes and the development of several neurodegenerative diseases, which could provide a new idea for the treatment of neurodegenerative diseases in the future.
Assuntos
Doenças Neurodegenerativas , Poliaminas , Animais , Poliaminas/metabolismo , Estresse Oxidativo , Mitocôndrias/metabolismo , Apoptose , Doenças Neurodegenerativas/metabolismoRESUMO
BACKGROUND: Embryonal carcinoma is a rare tissue type in germ cell tumors. According to our literature review, metastatic embryonal carcinoma misdiagnosed as lymphoma because of its high similarity to lymphoma is extremely rare and has not been reported yet. CASE PRESENTATION: A 46-year-old middle adulthood male presented with unexplained fever, night sweats, abdominal distension for 3 months, and weight loss of around 7kg during almost 6 months, which is extremely similar to lymphoma from the clinical features and imaging examinations. After a clear diagnosis, the case not only obtained the opportunity of surgery but was also exempted from radiotherapy. The treatment effect was good. We report a case of rare metastatic embryonal carcinoma, which can provide insight into the diagnosis and treatment of embryonal carcinoma. CONCLUSION: Metastatic embryonal carcinoma of abdominal lymph nodes can be highly similar to lymphoma; the diagnosis can only be based on clinical manifestations and imaging examination but also combined with patient history, tumor markers and biochemical examination. However, the final diagnosis depends on pathological biopsy.
RESUMO
Neuromodulation is a powerful tool for fundamental studies in neuroscience and potential treatments of neurological disorders. Both photoacoustic (PA) and photothermal (PT) effects have been harnessed for non-genetic high-precision neural stimulation. Using a fiber-based device excitable by a nanosecond pulsed laser and a continuous wave laser for PA and PT stimulation, respectively, we systematically investigated PA and PT neuromodulation at the single neuron level. Our results show that to achieve the same level of cell activation recorded by Ca2+ imaging the laser energy needed for PA neurostimulation is 1/40 of that needed for PT stimulation. The threshold energy for PA stimulation is found to be further reduced in neurons overexpressing mechano-sensitive channels, indicating direct involvement of mechano-sensitive channels in PA stimulation. Electrophysiology study of single neurons upon PA and PT stimulation was performed by patch clamp recordings. Electrophysiological features stimulated by PA are distinct from those induced by PT, confirming that PA and PT stimulations operate through distinct mechanisms. These insights offer a foundation for rational design of more efficient and safer non-genetic neural modulation approaches.
RESUMO
Objective To analyze the current situation of dietary diversity and caregiver self-efficacy for complementary feeding among infants and young children aged 6 to 23 months in rural Nanchong city,Sichuan province,and to explore the relationship between dietary diversity and caregiver self-efficacy. Methods Multi-stage randomized cluster sampling method was used to select infants and young children aged 6 to 23 months and their caregivers in rural areas of Nanchong city,Sichuan province as the subjects.A structured questionnaire was designed to collect the basic information of the subjects,dietary diversity,and caregiver self-efficacy for complementary feeding.Multivariate Logistic regression was adopted to analyze the relationship between the dietary diversity and caregiver self-efficacy for complementary feeding of infants and young children. Results A total of 770 pairs of infants and young children and their caregivers were included.The minimum pass rate of dietary diversity was 61.56%(474/770) for all the infants and young children and 45.00%(108/240),69.16%(287/415),and 68.70%(79/115) for the infants and young children aged 6 to 11,12 to 17,and 18 to 23 months,respectively.The results of regression analysis showed that the caregiver self-efficacy of complementary feeding was a contributing factor for qualified dietary diversity of infants and young children in the case of other confounders being controlled(OR=1.42,95%CI=1.17-1.73,P<0.001). Conclusion The dietary diversity for infants and young children in rural Nanchong city,Sichuan province needs to be improved,and caregivers with higher self-efficacy of complementary feeding are more likely to provide diversified complementary feeding for infants and young children.
Assuntos
Cuidadores , Autoeficácia , Criança , Lactente , Humanos , Pré-Escolar , Dieta , ChinaRESUMO
Understanding the metabolic activities of individual cells within complex communities is critical for unraveling their role in human disease. Here, we present a comprehensive protocol for simultaneous cell identification and metabolic analysis with the OPTIR-FISH platform by combining rRNA-tagged FISH probes and isotope-labeled substrates. Fluorescence imaging provides cell identification by the specific binding of rRNA-tagged FISH probes, while OPTIR imaging provides metabolic activities within single cells by isotope-induced red shift on OPTIR spectra. Using bacteria cultured with 13C-glucose as a test bed, the protocol outlines microbial culture with isotopic labeling, fluorescence in situ hybridization (FISH), sample preparation, optimization of the OPTIR-FISH imaging setup, and data acquisition. We also demonstrate how to perform image analysis and interpret spectral data at the single-cell level with high throughput. This protocol's standardized and detailed nature will greatly facilitate its adoption by researchers from diverse backgrounds and disciplines within the broad single-cell metabolism research community.
Assuntos
Bactérias , RNA Ribossômico , Humanos , Hibridização in Situ Fluorescente/métodos , Bactérias/genética , Sondas de Oligonucleotídeos , IsótoposRESUMO
For a long time, hydrogen sulfide (H2S) has been considered a toxic compound, but recent studies have found that H2S is the third gaseous signaling molecule which plays a vital role in physiological and pathological conditions. Currently, a large number of studies have shown that H2S mediates apoptosis through multiple signaling pathways to participate in cancer occurrence and development, for example, PI3K/Akt/mTOR and MAPK signaling pathways. Therefore, the regulation of the production and metabolism of H2S to mediate the apoptotic process of cancer cells may improve the effectiveness of cancer treatment. In this review, the role and mechanism of H2S in cancer cell apoptosis in mammals are summarized.
RESUMO
Type 2 diabetes mellitus (T2DM) is a chronic metabolic disorder characterized by high blood glucose levels resulting from insulin resistance and impaired insulin secretion. Immune dysregulation-mediated chronic low-grade inflammation is a critical factor that poses a significant risk to the metabolic disorders of T2DM and its related complications. Exosomes, as small extracellular vesicles secreted by various cells, have emerged as essential regulators of intercellular communication and immune regulation. In this review, we summarize the current understanding of the role of exosomes derived from immune and nonimmune cells in modulating immune responses in T2DM by regulating immune cell functions and cytokine production. More importantly, we suggest potential strategies for the clinical applications of exosomes in T2DM management, including biomarkers for disease diagnosis and monitoring, exosome-based therapies for drug delivery vehicles, and targeted therapy for exosomes.