Further degradation product of hyperforin from Hypericum perforatum (St John's Wort).

Repeated examination of the aerial parts of Hypericum perforatum yielded a new degradation product of hyperforin (1) namely deoxyfurohyperforin A (2), together with the previously identified furohyperforin (3), furoadhyperforin (4), furohyperforin A (5a and 5b), pyrano[7,28-b]hyperforin (6) and 3-methyl-4,6-di(3-methyl-2-butenyl)-2-(2-methyl-1-oxopropyl)-3-(4-methyl-3-pentenyl)-cyclohexanone (7). The antimicrobial activity of the compounds 3, 5a and 5b, 6 and 7 was tested against Staphylococcus aureus, Candida albicans, Bacillus subtilis and Escherichia coli.

Sesquiterpene lactones from the aerial parts of Inula oculus-christi.

Pulchellin E (1) and gaillardin (2) were isolated from the aerial parts of Inula oculus-christi, along with the flavone hispidulin. The 13C-NMR chemical shifts of 1 and 2 are reported.

Mixed cobalt(III) complexes with aromatic amino acids and diamine. Part IV. Influence of noncovalent intra-and interligand interactions on rotamer population of the S-phenylalaninato and S-tyrosinato side groups in (1,2-diaminoethane)bis-(S-aminocarboxylato)cobalt(III) complexes.

Rotamer population of S-tyrosinato and S-phenylalaninato ligands side groups in diastereomers of (1,2-diaminoethane)bis-(S-aminocarboxylato)cobalt(III) complexes is calculated by vicinal alpha and beta proton coupling constant analysis. The effect of noncovalent intra- and interligand interactions on the population of rotamers in D20 solution is discussed. It has been established that in all the complexes investigated the most abundant is rotamer t, in which aromatic voluminous moiety and carboxylic group are in an anti position. In almost all complexes the lowest content is of rotamer g, in which these two groups are in the nearest position. Relatively high population of rotamer h in complex 5 tyr, in spite of high steric hindrances, is due to intra- and interligand NH...pi interactions.

Cellular energetics in the preconditioned state: protective role for phosphotransfer reactions captured by 18O-assisted 31P NMR.

Cell survival is critically dependent on the preservation of cellular bioenergetics. However, the metabolic mechanisms that confer resistance to injury are poorly understood. Phosphotransfer reactions integrate ATP-consuming with ATP-producing processes and could thereby contribute to the generation of a protective phenotype. Here, we used ischemic preconditioning to induce a stress-tolerant state and (18)O-assisted (31)P nuclear magnetic resonance spectroscopy to capture intracellular phosphotransfer dynamics. Preconditioning of isolated perfused hearts triggered a redistribution in phosphotransfer flux with significant increase in creatine kinase and glycolytic rates. High energy phosphoryl fluxes through creatine kinase, adenylate kinase, and glycolysis in preconditioned hearts correlated tightly with post-ischemic functional recovery. This was associated with enhanced metabolite exchange between subcellular compartments, manifested by augmented transfer of inorganic phosphate from cellular ATPases to mitochondrial ATP synthase. Preconditioning-induced energetic remodeling protected cellular ATP synthesis and ATP consumption, improving contractile performance following ischemia-reperfusion insult. Thus, the plasticity of phosphotransfer networks contributes to the effective functioning of the cellular energetic system, providing a mechanism for increased tolerance toward injury.

Mixed cobalt(III) complexes with aromatic amino acids and diamine. Part II. Synthesis and configuration of (1,2-diaminoethane)bis(L-tyrosinato)cobalt(III)complex diastereomers. The crystal structure of the delta-C1-cis(O) diastereomer.

In the reaction of trans-[CoCl2(en)2]+ with L-tyrosine all six theoretically possible diastereomers of the (1,2-diaminoethane)bis(L-tyrosinato)cobalt(III) complex were formed. The following five were isolated: gamma-trans(O); and gamma- and delta-C2-cis(O) and gamma- and delta-C1-cis(O) diastereomers, while the delta-trans(O) diastereomer was only detected in the corresponding eluate. Separation of the obtained diastereomers was performed by chromatography on a Dowex 1 x 4 column. Characterization of the isolated diastereomers was carried out by means of elemental analysis, electronic absorption, circular dichroic, 1H and 13C NMR spectra, and by x-ray crystal structure analysis in the case of the delta-C1-cis(O) diastereomer. We established the general rule of preference of diasteromers formation in complexes of [Co(L-aa)2diamine]+ (L-aa = L-amino acid anion; diamine = 1,2-diaminoethane or 1,3-diaminopropane) type.

Compromised energetics in the adenylate kinase AK1 gene knockout heart under metabolic stress.

Rapid exchange of high energy carrying molecules between intracellular compartments is essential in sustaining cellular energetic homeostasis. Adenylate kinase (AK)-catalyzed transfer of adenine nucleotide beta- and gamma-phosphoryls has been implicated in intracellular energy communication and nucleotide metabolism. To demonstrate the significance of this reaction in cardiac energetics, phosphotransfer dynamics were determined by [(18)O]phosphoryl oxygen analysis using( 31)P NMR and mass spectrometry. In hearts with a null mutation of the AK1 gene, which encodes the major AK isoform, total AK activity and beta-phosphoryl transfer was reduced by 94% and 36%, respectively. This was associated with up-regulation of phosphoryl flux through remaining minor AK isoforms and the glycolytic phosphotransfer enzyme, 3-phosphoglycerate kinase. In the absence of metabolic stress, deletion of AK1 did not translate into gross abnormalities in nucleotide levels, gamma-ATP turnover rate or creatine kinase-catalyzed phosphotransfer. However, under hypoxia AK1-deficient hearts, compared with the wild type, had a blunted AK-catalyzed phosphotransfer response, lowered intracellular ATP levels, increased P(i)/ATP ratio, and suppressed generation of adenosine. Thus, although lack of AK1 phosphotransfer can be compensated in the absence of metabolic challenge, under hypoxia AK1-knockout hearts display compromised energetics and impaired cardioprotective signaling. This study, therefore, provides first direct evidence that AK1 is essential in maintaining myocardial energetic homeostasis, in particular under metabolic stress.

Further sesquiterpene lactones from Anthemis carpatica.

A new germacranolide, (E)-1alpha, 10beta-epoxy-3beta-acetoxy-6alpha-hydroxygermacra-4,11 (13)-dien-12,8alpha-olide, together with nine new highly oxygenated guaiadien-12,6alpha-olides of anthemolide, and cumambrin type were identified in the repeated examination of the aerial parts of the flowering Anthemis carpatica. In addition, six known guaianolides belonging to the same groups, also isolated previously from A. carpatica, along with two guaianolides, 2beta-hydroxyepiligustrin and cumambrin B, not found before in this species, were isolated this time.

Quantitative determination of magnetization exchange rate constants from a series of two-dimensional exchange NMR spectra

A method for quantitative determination of magnetization exchange rate constants (cross-relaxation and chemical exchange) from a series of two-dimensional exchange spectra is presented. The method, the least error matrix analysis (LEMA), combines a series of full matrix calculations at different mixing times in a least-squares manner. LEMA embodies the principal advantages of full-relaxation matrix analysis (FMA) and initial rate buildup (BU) analysis. Like FMA, it takes into account all the relations among the spectral matrix elements and in analogy to BU makes use of their time evolution. By means of calculations, simulations, and experiments, we have shown that LEMA provides the dynamic matrix from a given set of experimental data with errors that are smaller than in either FMA or BU calculations.

A "structural" water molecule in the family of fatty acid binding proteins.

A single water molecule (w135), buried within the structure of rat intestinal fatty acid binding protein (I-FABP), is investigated by NMR, molecular dynamics simulations, and analysis of known crystal structures. An ordered water molecule was found in structurally analogous position in 24 crystal structures of nine different members of the family of fatty acid binding proteins. There is a remarkable conservation of the local structure near the w135 binding site among different proteins from this family. NMR cross-relaxation measurements imply that w135 is present in the I-FABP:ANS (1-sulfonato-8-(1')anilinonaphthalene) complex in solution with the residence time of >300 ps. Mean-square positional fluctuations of w135 oxygen observed in MD simulations (0.18 and 0.13 A2) are comparable in magnitude to fluctuations exhibited by the backbone atoms and result from highly constrained binding pocket as revealed by Voronoi volumes (averages of 27.0 +/- 1.8 A3 and 24.7 +/- 2.2 A3 for the two simulations). Escape of w135 from its binding pocket was observed only in one MD simulation. The escape process was initiated by interactions with external water molecules and was accompanied by large deformations in beta-strands D and E. Immediately before the release, w135 assumed three distinct states that differ in hydrogen bonding topology and persisted for about 15 ps each. Computer simulations suggest that escape of w135 from the I-FABP matrix is primarily determined by conformational fluctuations of the protein backbone and interactions with external water molecules.

Structure-fluorescence correlations in a single tryptophan mutant of carp parvalbumin: solution structure, backbone and side-chain dynamics.

Heterogeneous fluorescence intensity decays of tryptophan in proteins are often rationalized using a model which proposes that different rotameric states of the indole alanyl side-chain are responsible for the observed fluorescence lifetime heterogeneity. We present here the study of a mutant of carp parvalbumin bearing a single tryptophan residue at position 102 (F102W) whose fluorescence intensity decay is heterogeneous and assess the applicability of a rotamer model to describe the fluorescence decay data. We have determined the solution structure of F102W in the calcium ligated state using multi-dimensional nuclear magnetic resonance (NMR) and have used the minimum perturbation mapping technique to explore the possible existence of multiple conformations of the indole moiety of Trp102 of F102W and, for comparison, Trp48 of holo-azurin. The maps for parvalbumin suggest two potential conformations of the indole side-chain. The high energy barrier for rotational isomerization between these conformers implies that interwell rotation would occur on time-scales of milliseconds or greater and suggests a rotamer basis for the heterogeneous fluorescence. However, the absence of alternate Trp102 conformers in the NMR data (to within 3 % of the dominant species) suggests that the heterogeneous fluorescence of Trp102 may arise from mechanisms independent of rotameric states of the Trp side-chain. The map for holo-azurin has only one conformation, and suggests a rotamer model may not be required to explain its heterogeneous fluorescence intensity decay. The backbone and Trp102 side-chain dynamics at 30 degrees C of F102W has been characterized based on an analysis of (15)N NMR relaxation data which we have interpreted using the Lipari-Szabo formalism. High order parameter (S(2)) values were obtained for both the helical and loop regions. Additionally, the S(2) values imply that the calcium binding CD and EF loops are not strictly equivalent. The S(2) value for the indole side-chain of Trp102 obtained from the fluorescence, NMR relaxation and minimum perturbation data are consistent with a Trp moiety whose motion is restricted.

Flavones and sesquiterpene lactones from Achillea atrata subsp. multifida: antimicrobial activity.

Four flavones (1-4) and nine sesquiterpene lactones (5-13), one of them (5) a new compound, were isolated from the aerial parts of Achillea atrata L. subsp. multifida. Although the crude extract demonstrated in vitro inhibitory activity against Candida albicans and Bacillus subtilis, all isolated flavones were active against B. subtilis. Flavones 1, 2, and 3 were also active against C. albicans, while 1 and 3 exhibited activity against E. coli, as well. None of the tested lactones (7, 9, 12, and 13) showed any antimicrobial activity.

Oxidation products of hyperforin from Hypericum perforatum.

The isolation of two oxidation products of hyperforin from the aerial parts of Hypericum perforatum and their structure determination by means of 2D NMR methods is reported. The products had the same 1-(2-methyl-1-oxopropyl)-2,12-dioxo-3,10 beta-bis(3-methyl-2-butenyl)-11 beta-methyl-11 alpha-(4-methyl-3-pentenyl)-5-oxatricyclo[6.3.1.0(4,8)]-3-dodec ene skeleton. In addition, one of them, with the same number of carbons as hyperforin (C35H52O5), contained a 1-methyl-l-hydroxyethyl group in the 6 beta-position, whereas the other compound (a hemiacetal, C32H46O5), presumably a degradation product of hyperforin, exhibited a 6-hydroxy function. The latter was an inseparable mixture of 6 alpha- and 6 beta-hydroxy epimers undergoing (according to phase sensitive NOESY) mutual interconversion.

Full matrix Analysis of Cross-relaxation Fails in Fractionally Deuterated Molecules.

We have analyzed cross-relaxation in fractionally deuterated molecules and showed that the full matrix analysis fails except when the dilution is extreme. This is because the isotopic dilution alters the matrix exponential relationship between the observed spectrum and the cross-relaxation rate constants sought. Consequently, an average of the spectra of various isotopomers differs from the matrix exponential of an average relaxation matrix. We have derived a series expansion that allows the determination of the cross-relaxation rate constants in arbitrarily deuterated molecules.

Zinc binding properties of the DNA binding domain of the 1,25-dihydroxyvitamin D3 receptor.

To assess the zinc binding stoichiometry and the structural changes induced upon the binding of zinc to the human vitamin D receptor (VDR), we expressed the DNA binding domain (DBD) of the human VDR in bacteria as a soluble glutathione-S-transferase fusion protein at 20 degrees C, and examined the apo-protein and metal-liganded protein by mass spectrometry, and circular dichroism and nuclear magnetic resonance spectroscopy. Following final preparation with a zinc-free buffer, the VDR DBD bound 2 mol of zinc/mol of protein as measured by inductively coupled plasma-mass spectrometry and electrospray ionization-mass spectrometry. When protein preparation was carried out in a zinc containing buffer and zinc content of the protein was assesed by the same methods, VDR DBD bound 4 mol of zinc/mol of protein. Analysis of the protein using circular dichroism spectroscopy demonstrated that the EDTA-treated protein increased in alpha-helical content from 16 to 27% on the addition of zinc. Equilibrium ultracentrifugal analyses of the VDR DBD indicated that the protein was present in solution as a monomer. Gel mobility shift analyses of the VDR DBD with several vitamin D response elements (VDREs) in the absence of accessory proteins such as retinoic acid receptor, showed that VDR DBD was able to form a protein/VDRE DNA structural complex. In the presence of zinc, proton NMR NOESY spectra showed that the protein possessed elements of secondary structure. The addition of VDRE DNA, but not random DNA, caused changes in the proton NMR spectra of VDRE DNA indicating specific interaction between protein and DNA groups. We conclude that the DBD of the VDR binds zinc and DNA and undergoes conformational changes on binding to the metal and DNA.

Identification of spin diffusion pathways in proteins by isotope-assisted NMR cross-relaxation network editing.

A new isotope-assisted cross-relaxation editing experiment, [1H-13C]DINE-NOESY[1H-15N]HSQC (DINE=Double INEPT Edited), is proposed. It is based on the selective inversion of CH/CH3 or CH2 protons in the middle of the mixing time. The experiment sorts out the spin diffusion paths according to the principal mediators, either the CH/CH3 or the CH2 protons. This is useful in the structure refinement process, as it enables proper alignment of the aliphatic protons in the vicinity of NH protons.

Simulated dipeptide recognition by vancomycin.

The antimicrobial activity of vancomycin and related glycopeptide antibiotics is due to stereospecific recognition of polypeptide components in bacterial cell walls. To better understand how these antibiotics recognize polypeptide determinants, we have developed dynamic models of the complexes formed by the vancomycin aglycon and two different dipeptide ligands, Ac-D-ala-D-ala and Ac-D-ala-gly. Molecular dynamics simulations of the two complexes, initially conditioned with distance constraints derived from two-dimensional nuclear magnetic resonance (NMR) studies, are conformationally stable and propagate in a manner consistent with the NMR-derived constraints after the constraints are removed. Free energy calculations accurately predict the relative binding affinity of these two complexes and help validate the simulation models for detailed structural analysis. Although the two ligands adopt similar conformations when bound to the antibiotic, there are clear differences in the configuration of intermolecular hydrogen bonds, the overall shape of the antibiotic, and other structural features of the two complexes. This analysis illustrates how complex structural and dynamic factors interrelate and contribute to differences in binding affinity.

Nitrogen-15 NMR chemical shifts in oligopeptides coordinated to cobalt(III).

Dipeptide, tripeptide, and tetrapeptide complexes with cobalt(III) ions were studied as model compounds for evaluation of 15N NMR chemical shifts induced in proteins upon binding transition metal ions. Coordination of oligopeptides to cobalt(III) resulted in large negative 15N NMR shifts for amine nitrogens (-76 to -32 ppm) and deprotonated amide nitrogens (-47 to -10). Coordination-induced shifts were affected by the nature of moiety at the trans position; the shifts were always larger with a carboxylato oxygen than with an amine nitrogen in the trans position. Thus, coordination-induced 15N NMR shifts provided direct and specific information on the stereochemistry of peptide coordination. Two new complexes, [Co(Gly-gly-gly-glyH(-3))(NH3)2] and Ba[Co(Gly-L-hisH(-2))(NO2)3], were synthesized and their structure was determined by NMR spectroscopy.

Trinucleotide repeats that expand in human disease form hairpin structures in vitro.

We show that repeating units from all reported disease genes are capable of forming hairpins of common structure and threshold stability. The threshold stability is roughly -50 kcal per hairpin and is influenced by the flanking sequence of the gene. Hairpin stability has two components, sequence and length; only DNA of select sequences and the correct length can form hairpins of threshold energy. There is a correlation among the ability to form hairpins of threshold stability, the sequence selectivity of expansion, and the length dependence of expansion. Additionally, hairpin formation provides a potential structural basis for the constancy of the CCG region of the Huntington's disease gene in individuals and explains the stabilizing effects of AGG interruptions in FMR1 alleles.

Hairpin formation within the human enkephalin enhancer region. 2. Structural studies.

Receptor-mediated induction of the human proenkephalin gene has been mapped to an imperfect palindrome located between -104 and -86, upstream of the transcriptional start site. Several lines of evidence suggest that receptor-mediated transcription of proenkephalin involves a reversible conformational change from duplex to a hairpin state of the enhancer [McMurray, C.T., Wilson, W.D., & Douglass, J.O. (1991) Proc. Natl. Acad. Sci. U.S.A. 88, 666]. To determine the structure that would form if such a conformational change took place, we have synthesized two 23-bp oligonucleotides, d(GCTGGCGTAGGGCCTGCGTCAGC) and d(GCTGACGCAGGCCCTACGCCAGC), whose sequences are identical to the top and the bottom strands of the native enhancer. We have found that each oligonucleotide strand exists primarily as a hairpin structure over a wide range of oligonucleotide concentrations and a wide range of temperatures (0-45 degrees C). The assignment of each imino proton was carried out using 1D and 2D nuclear Overhauser effects (NOE) and by comparison with the spectra of hairpins containing single base substitutions. The hairpin structure for each oligonucleotide contains a 3-member loop, a 10-bp stem, and two mismatched pairs. The hairpin that forms from the top strand of the enhancer and contains two GT mispaired bases creates an alternative binding site for the cyclic adenosine monophosphate element binding protein (CREB), a transcription factor that binds to and regulates the human proenkephalin gene. Circular dichroism and 31P NMR indicate that, despite the presence of mismatched pairs, each oligonucleotide hairpin adopts a B-form conformation with no unusual bending or kinking. The structure of the hairpin may explain the effect on expression of point mutations within the enhancer.