[Photoactivated analogues of the initiating substrates of RNA polymerase II based on arylazide derivatives of NTP gamma-amidophosphate: synthesis and chemical and photochemical reactions of functional groups].

Photoactivatable derivatives Ar-NH-(CH2)n-NHpppB (where Ar = p-azidophenyl (A1), 5-azido-2-nitrobenzoyl (A2), or 4-azido-2,3,5,6-tetrafluorobenzoyl (A3) group; B = Ado or Guo; n = 2, 3, or 4) were synthesized. The phosphoroamidate bond stability was found to depend on the structure of both the heterocyclic and the photoactivatable groups. The derivative with A3, Ado, and n=3 is hydrolyzed with regeneration of aryl azide and ATP, whereas the other derivatives are stable in aqueous solutions. The photoanalogues with A1 and A2, B = Ado, and n = 2 or 4 were found to behave as initiating substrates toward the RNA polymerase II from Saccharomyces cerevisiae under the conditions of specific transcription initiation and control of the adenovirus late promoter. The photolysis of N-(4-azidophenyl)-1,4-diaminobutane and N-(5-azido-2-nitrobenzoyl)-1,3-diaminopropane, two functional fragments of the photoaffinity reagents, in aqueous solutions was established to result in the formation of p-benzoquinone diimine and p-nitro-N-arylhydroxylamine derivatives, respectively. The arylhydroxylamine derivatives undergo a number of transformations in aqueous solution leading to nitroso derivatives. We concluded that it is these nitroso derivatives (products of nitrene transformation, rather than the nitrene itself) that may modify proteins with reagents containing p-nitrophenylazide fragment.

[Protein and peptide construction for delivery of oligonucleotides and DNA into the cell]. / Belkovye i peptidnye konstruktsii dlia dostavki v kletku oligonukleotidov i DNK.

The literary data on development and trial of new non-viral methods of antisense nucleotide, DNA and ribozyme delivery based on the application of protein and peptide constructions are summarised. For the creation of peptide constructions the proteins and functional fragments of proteins able to pass through a cellular membrane are used. The special attention is paid to the transport properties of recombinant fusion proteins containing translocation domain.

[Photoaffinity modification of amino acid derivatives of oligonucleotides in a complementary complex]. / Fotoaffinnaia modifikatsiia aminokislotnykh proizvodnykh oligonukleotidov v komplementarnom komplekse.

Intracomplex photochemical interaction of photoactive derivatives R-CONH(CH2)3NH-pGATACCAA, where R= p-azidotetrafluorophenyl (I) or 2-nitro-5-azidophenyl (II), and 5'-phospho-p-azidoanilide pGATACCAA (III) with a target - oligonucleotide *pGGTATCp (IV) and its derivatives *pGGTATCp-NH(CH2)3NHX, where X = H (V), Phe (VI), or Lys (VII), was studied. According to electrophoretic data, photoreagent (I) gives rise to a covalent photoadduct with compound (IV) as well as with derivatives (VI) and (VII). In the case of reagent (II), only targets (V) - (VII) including aliphatic amino groups participate in the photocoupling. Upon irradiation of the duplexes comprising photoreagent (III) and targets (V)-(VII), the process is accompanied by the cleavage of the reagent's oligonucleotide moiety off the photomodification product. A plausible mechanism of the cleavage is discussed.

[Quantitative characteristics of modifying nucleic acids by alkylating oligonucleotide derivatives in the presence of oligonucleotide effectors]. / Kolichestvennye kharakteristiki modifikatsii nukleinovykh kislot alkiliruiushchimi porizvodnymi oligonukleotidov v presutstvii oligonukleotidnykh éffektorov.

Modification of the 26-meric DNA fragment d(TTGCCTTGAATGGGAAGAGGGTCATT) with 4-(N-2-chloroethyl-N-methylamino)benzyl-5'-phosphamide derivative of hexadeoxyribonucleotide d(pTTCCCA) was investigated in the presence of two bis-3',5-N-(2-hydroxyethyl)phenazinium derivatives of octadeoxyribonucleotides (effectors E1 and E2) forming complementary complexes with the target next to 3'- and 5'-ends of the reagent's recognition site, respectively. In the absence of effectors, G17 is predominantly modified. Some minor modification of G12, G13 and G14 was also observed. The association constant of the target with the reagent was calculated using the dependence of the modification extent on the initial concentration of the reagent and was found to be Kx = (2.16 +/- 0.38) x 10(4) M-1 at 25 degrees C. At the reagent concentration 5 x 10(-6) M the target modification was nearly absent. In the presence of E1 the modification extent of the 26-mer increased with its concentration to a plateau value of approximately 0.5. Quantitative treatment of this concentration dependence permitted to estimate the value of the product Ke1 alpha = (3.95 +/- 0.43) x 10(8) M-1, where alpha 1 is the cooperativity coefficient and Ke1 is the association constant of the target with E1. To determine alpha 1, the Ke1 value was measured by the gel retardation method and found to be (5.06 +/- 0.23) x 10(7) M-1. Consequently, alpha 1 approximately 8. Effector E2 is less efficient and permits to reach the plateau value only as low as 0.24. This may be due to the competition of the reagent and E2 for the reagent recognition site, since the latter is partially complementary to this site. The increase of the E2 concentration results in a decrease of the modification extent of G17 accompanied with an increase of the modification extent of G12-G14. Thus, in the conditions used the oligonucleotide effectors although increasing the duplex stability do not permit to achieve quantitative yields as it should be for reactions proceeding in quasi-equilibrium conditions.

[Cell membranes as a barrier during biological uses of antisense oligonucleotides, their derivatives, and analogs]. / Kletochnye membrany kak bar'er pri biologicheskikh primeneniiakh antismyslovykh oligonucleotidov, ikh proizvodnykh i analogov.

Use of oligonucleotides and their derivatives as gene targeted drugs encounter a problem of crossing of lipophilic cell membranes by these hydrophilic compounds. This paper considers the approaches to overcome the arising barrier: 1) penetration by endocytosis in the presence of bivalent cations; 2) use of non-ionic oligonucleotide analogs; 3) attachment of bulky hydrophobic radicals; 4) use of membrane carriers; 5) interaction of oligonucleotides and their derivatives with specific receptors.

[Oligo- and polynucleotide probes. A molecular hybridization method]. / Oligo- i polinukleotidnye zondy. Metod molekuliarnoi gibridizatsii.

In this review the main principles and possibilities of a hybridization analyses as a highly specific methods for diagnostics of infections and genetic diseases are discussed. Special attention is paid to the chemical approaches to the preparation of non-radioactive probes based on synthetic oligonucleotides and polynucleotides containing biotin, Eu3+ and enzyme labels. Some versions of the hybridization analysis technique are discussed.