Identification of reference genes and their validation for gene expression analysis in phytopathogenic fungus Macrophomina phaseolina.

Macrophomina phaseolina is a soil-borne pathogenic fungus that infects a wide range of crop species and causes severe yield losses. Although the genome of the fungus has been sequenced, the molecular basis of its virulence has not been determined. Identification of up-regulated genes during fungal infection is important to understand the mechanism involved in its virulence. To ensure reliable quantification, expression of target genes needs to be normalized on the basis of certain reference genes. However, in the case of M. phaseolina, reference genes or their expression analysis have not been reported in the literature. Therefore, the objective of this study was to evaluate 12 candidate reference genes for the expression analysis of M. phaseolina genes by applying three different fungal growth conditions: a) during root and stem infection of soybean, b) in culture media with and without soybean leaf infusion and c) by inoculating a cut-stem. Based on BestKeeper, geNorm and NormFinder algorithms, CYP1 was identified as the best recommended reference gene followed by EF1ß for expression analysis of fungal gene during soybean root infection. Besides Mp08158, CYP1 gene was found suitable when M. phaseolina was grown in potato-dextrose broth with leaf infusion. In the case of cut-stem inoculation, Mp08158 and Mp11185 genes were found to be most stable. To validate the selected reference genes, expression analysis of two cutinase genes was performed. In general, the expression patterns were similar when the target genes were normalized against most or least stable gene. However, in some cases different expression pattern can be obtained when least stable gene is used for normalization. We believe that the reference genes identified and validated in this study will be useful for gene expression analysis during host infection with M. phaseolina.

First report of yellow rust (Puccinia striiformis f. sp. tritici) in wheat (Triticum aestivum) in Paraguay.

Wheat yellow (stripe) rust caused by Puccinia striiformis Westend. f. sp. tritici Eriks. (Pst) is an important disease worldwide (Chen 2005; Afzal et al., 2007; Hovmøller et al. 2011). In Latin America, the disease has been reported in Argentina, Bolivia, Chile, Colombia, Ecuador, Peru, Brazil, and Uruguay (van Beuningen and Kohli, 1986; German et al., 2007). The disease was observed for the first time in Paraguay at Capitán Miranda (Itapúa) (27°12'07.5888''S, 55°47'20.3640''W) in an environment with average minimum temperature below 10°C in July 2021 (coldest month). Symptoms were yellow rust pustules distributed linearly on the leaves of adult host plants (Fig. 1). Oval-shaped uredinia contained unicellular, yellow to orange, spherical urediniospores (28, 82 × 26, 83 µm), within the range reported by Rioux et al. (2015). Black telia produced yellow to orange teliospores (64, 12 × 15, 46 µm), which were within the range reported by Chen et al. (2014). All susceptible wheat cultivars had up to 100% disease severity. Ten- day-old seedlings of the susceptible cultivars were inoculated in a greenhouse using urediniospores collected from the field. Two weeks after inoculation, extensive sporulation was observed on the seedlings. For pathogen identification, DNA was extracted from wheat leaf segments containing urediniospores using the PureLink® Plant Total DNA Purification Kit (Invitrogen). PCR and sequencing were carried out by Macrogen (Korea), using the following species-specific primers: PSF (5`-GGATGTTGAGTGCTGCTGTAA-3`) / PSR (5`-TTGAGGTCTTAAGGTTAAAATTG-3`), which amplifies an internal transcribed spacer (ITS) region (Zhao et al. 2007); LidPs9 (TCGGTAAAACTGCACCAATACCT) / LidPs10 (TCCCAACAGTCCCCTTCTGT), which amplifies a fragment of the RNA polymerase II gene encoding the second largest subunit (rpb2); and LidPs11 (TTACGACATCTGCTTCCGCA) / LisPs12 (TGCGATGTCAACTCTGGGAC) and LidPs13 (TACGACATCTGCTTCCGCAC) / LidPs14 (GATTGCCCGGTATTGTTGGC), both pairs amplifying fragments of the ß-tubulin 1 gene (tub1) (Kuzdralinski et al. 2017). The sequences obtained were OM631935, OM638432, OM718000, and OM718001 and were aligned using the GenBank BLAST tool (https://blast.ncbi.nlm.nih.gov/Blast.cgi), obtaining a 100% match with the following sequences: KC677574.1, KY411522.1, KY411533.1, and KY411542.1, respectively. Yellow-rust-infected leaf samples were collected from a field trial and sent to the Global Rust Reference Center (GRRC), Denmark. Simple sequence repeat (SSR) genotyping of samples from two different cultivars exhibited the genetic lineage PstS13 (www.wheatrust.org), which had previously been detected in South America (Carmona et al., 2019), thereby confirming the first report of wheat yellow rust in Paraguay. Considering that the Paraguayan wheat germplasm is highly susceptible to yellow rust, further studies are required to monitor potential spread and establishment of yellow rust in Paraguay and to explore potential sources of resistance to prevent future epidemics.

Trichothecene Genotype Profiling of Wheat Fusarium graminearum Species Complex in Paraguay.

Paraguay is a non-traditional wheat-producing country in one of the warmest regions in South America. Fusarium Head Blight (FHB) is a critical disease affecting this crop, caused by the Fusarium graminearum species complex (FGSC). A variety of these species produce trichothecenes, including deoxynivalenol (DON) and its acetylated forms (3-ADON and 15-ADON) or nivalenol (NIV). This study characterized the phylogenetic relationships, and chemotype diversity of 28 strains within FGSC collected from wheat fields across different country regions. Phylogenetic analysis based on the sequence of elongation factor-1α gene (EF-1α) from 28 strains revealed the presence of four species in the FGSC: F. graminearum sensu stricto, F. asiaticum, F. meridionale and F. cortaderiae. Ten strains selected for further analysis revealed that all F. graminearum strains were 15-ADON chemotype, while the two strains of F. meridionale and one strain of F. asiaticum were NIV chemotype. Thus, the 15-ADON chemotype of F. graminearum sensu stricto was predominant within the Fusarium strains isolated in the country. This work is the first report of phylogenetic relationships and chemotype diversity among Fusarium strains which will help understand the population diversity of this pathogen in Paraguay.

First Report of a Leaf Blight Caused by Pyricularia pennisetigena on Cenchrus echinatus in Paraguay.

The genus Pyricularia contains several fungal species known to cause diseases on plants in the Poaceae family (Klaubauf et al. 2014; Wang et al. 2019). While sampling for P. oryzae during March-2015 and April-2018, common weed Cenchrus echinatus L. was observed with leaf lesions in and around experimental wheat fields in the departments of Canindeyú and Itapúa. C. echinatus samples from both locations displayed similar leaf lesions, varying from small light brown pinpoint to elliptical brown lesions with greyish center. Symptomatic leaves were surface disinfested and cultured on potato dextrose agar (PDA) amended with 1% gentamicin at 25°C. Two monosporic isolates were obtained, one from Itapúa (ITCeh117) and the other from Canindeyú (YCeh55). The isolates were subsequently grown on oatmeal agar (OA) and PDA under a 12-h photoperiod at 25°C and evaluated after ten days for colony diameter, sporulation, macroscopic and microscopic features. Colonies on OA reached up to 4.8 cm diameter and were light grey, whereas colonies on PDA reached up to 5.3 cm diameter and were brown with grey centers, with cottony mycelium and broad white rims. Mycelium consisted of smooth, hyaline, branched, septate hyphae 4-4.5 µm diameter. Conidiophores were erect, straight or curved, unbranched, medium brown and smooth. Conidia were solitary, pyriform, pale brown, smooth, granular, 2-septate, 32-33 × 9-10 µm; truncated with protruding hilum and varied in length from 1.0 to 1.5 µm and diameters from 2.0 to 2.2 µm. Both isolates were similar and identified as Pyricularia pennisetigena, according to morphological and morphometric characteristics (Klaubauf et al. 2014). Subsequently, genomic DNA was extracted from each isolate using the primers described in Klaubauf et al. (2014) to amplify and sequence the internal transcribed spacers (ITS), partial large subunit (LSU), partial RNA polymerase II large subunit gene (RPB1), partial actin gene (ACT), and partial calmodulin gene (CAL). Sequences from each isolate (YCeh55/ITCeh117) were deposited in GenBank with the following submission ID for ITS: MN947521/MN947526, RPB1: MN984710/MN984715, LSU: MN944829/MN944834, ACT: MN917177/MN917182, and CAL: MN984688/MN984693. Phylogenetic analysis was conducted using the software Beast v1.10.4. The results obtained from the concatenated matrix of the five loci placed these isolates in the P. pennisetigena clade. To confirm pathogenicity, each isolate was adjusted to 5×104 conidia/ml of sterile water and C. echinatus plants were sprayed with the conidial suspension for isolate YCeh55, ITCeh117 or sterile water using an oilless airbrush sprayer until runoff. The three treatments were kept in the greenhouse at 25-28°C and about 75% relative humidity under natural daylight. Each treatment included three to five inoculated plants and 10 leaves were evaluated per treatment. Symptoms were observed 8-15 days after inoculation and were similar to those originally observed in the field for both isolates, whereas the control plants remained asymptomatic. P. pennisetigena was re-isolated from the inoculated leaves fulfilling Koch's postulates. To our knowledge, this is the first report of leaf blight on C. echinatus caused by P. pennisetigena in Paraguay. The occurrence of P. pennisetigena in the region and its ability to infect economically important crops such as wheat and barley (Klaubauf et al. 2014; Reges et al., 2016, 2018) pose a potential threat to agriculture in Paraguay.

Occurrence of Deoxynivalenol and Ochratoxin A in Beers and Wines Commercialized in Paraguay.

Alcoholic beverages can be contaminated with mycotoxins. Ochratoxin A (OTA) is the most frequently detected mycotoxinin wine and is produced by several species of Aspergillus. This mycotoxin is nephrotoxic and carcinogenic. In beer, the most commonly identified mycotoxin is deoxynivalenol (DON). Ingestion of food contaminated with DON has been associated with adverse gastrointestinal effects. Despite the harmful effects of mycotoxins on health, there are no regulations regarding their limits in alcoholic beverages in Paraguay. Here we determine the presence of OTA and DON in wine and beer, respectively. Four commercial brands of wine and twenty-nine brands of craft and industrial beerwere tested by the Agra quant ELISA method. One brand of wine was positive for OTA and seven brands of beer (one of them craft) were positive for DON. The values found for both toxins are below the recommended maximum intake proposed by international standards. Giving the high consumption of these products in the country, regulations and monitoring systems mustbe established to check the maximum levels of mycotoxins allowed in alcoholic beverages.