RESUMO
The sequence for the Reverse primer used to amplify the human gene PLA2G2A presented in table 1 is incorrect. The following, is the correct sequence: Reverse 5' - GCTCCCTCTGCAGTGTTTATT -3.
RESUMO
P. gingivalis (Pg) is an oral pathogen with the ability to induce oral dysbiosis and periodontal disease. Nevertheless, the mechanisms by which mucosal responses to the oral microbiota in the presence of specific pathogens such as Pg could abrogate the host-microbe symbiotic relationship leading to periodontitis remain unclear. Herein, we identified the Notch-1/PLA2-IIA axis as a new molecular pathway through which Pg could be specifically modulating oral epithelial antimicrobial and inflammatory responses. Pg activated Notch-1, and inhibition or silencing of Notch-1 completely abrogated Pg-induced PLA2-IIA in oral epithelial cells (OECs). Activation of Notch-1 and PLA2-IIA production were associated with Pg-produced gingipains. Other oral Gram-positive and Gram-negative species failed to induce similar responses. Pg enhanced OEC antimicrobial activity through PLA2-IIA. Increased Notch-1 activation correlated with higher PLA2-IIA gingival expression and changes in the abundance of specific oral bacteria phyla during periodontal disease. Oral bacterial species exhibited differential antimicrobial susceptibility to PLA2-IIA. These findings support previous evidence suggesting an important role for epithelial Notch-1 activation and PLA2-IIA production during health and disease at mucosal surfaces, and provide new mechanistic information concerning the regulation of epithelial antimicrobial and pro-inflammatory responses modulated by oral pathogenic bacteria associated with periodontal disease.
