Molecular features of new Peach Latent Mosaic Viroid variants suggest that recombination may have contributed to the evolution of this infectious RNA.

Nucleotide sequences of a broad range of Peach Latent Mosaic Viroid (PLMVd) variants were determined. The variants were isolated from peach, pear, and almond tree samples collected in Tunisia. Sequence analysis confirmed the high variability of PLMVd, as no less than 119 new variants were identified. Variations included new polymorphic positions, insertions of 11 to 14 nucleotides, and new mutations within the hammerhead self-cleavage motifs. We provide the first covariation-based evidence for certain stems within the proposed secondary structure. Our covariation analysis also strengthens the view that a pseudoknot closes the replication domain. On the basis of phylogenetic tree studies and informative positions, PLMVd variants are proposed to cluster into groups and subgroups likely to have resulted from recombination events. PLMVd thus emerges as a suitable viroid for retracing the evolution of an RNA genome.

Genomic structure of new Tunisian peach latent mosaic viroid variants.

Peach latent mosaic viroid (PLMVd) is a single-stranded circular RNA that do not code for proteins and ranges in size from 335 to 351 nucleotides. It mainly infects peach. In this study, the sequence of 20 complete cDNA clones derived from seven PLMVd isolates detected in five Tunisian peach cultivars was analysed in 3 steps: primary structure, phylogeny and secondary structure. The analysis of the primary structure revealed that all the 20 cDNA clones sequences corresponded to different variants. They ranged in size from 336 to 341 nt. Sequence alignment of our variants with reference sequences revealed 81 polymorphic positions. Among them, 15 were never described in the literature so far. The variable positions are scattered all around the RNA molecules, but the majority of them were concentrated in the region corresponding to nucleotides 1 to 70 and 170 to 346 in the alignment. Sequence homologies between variants of the same isolate or variants of different isolates ranged from 96% to 100%. This confirms that a PLMVd isolate is composed by a complex mixture of closely related molecules. Moreover, some variants isolated from different cultivars were found to be similar, indicating that a sequence is not exclusive to a cultivar. Phylogenetic analysis of our sequences allowed their clustering into two groups: group I (16 variants) and group II (4 variants) that differed by 18 polymorphic positions. Further phylogenetic analysis and sequence alignment of our sequences and the reference sequences were done. It revealed that our sequences were similar to the reference sequence Hd8 in the regions delimited by nucleotides 1 to 69 (region 1) and 268 to 343 (region 5) and to the reference sequence Hd6 in the region between nucleotides 150 and 200 (region 3). The other regions corresponding to nucleotides 70 to 149 (region 2) and 201 to 267 (region 4) were similar for all the sequences. These observations revealed that our Tunisian PLMVd variants correspond to a new population never reported in the literature. Analysis of the secondary structure confirmed that all PLMVd Tunisian variants presented a branched secondary structure and revealed a new potential pseudoknot-like interaction between two loops.

Peach latent mosaic viroid Detected for the First Time on Almond Trees in Tunisia.

Almond (Prunus dulcis Mill) is an important crop in countries of the Mediterranean area. Until now, among viroids, only Hop stunt viroid (HSVd) is known to infect cultivated almond trees (2). In 2004, a survey of almond trees was carried out in orchards in different regions of Tunisia, a major producing and exporting country of almond. Symptoms such as mosaic and necrotic lesions, potentially caused by the Peach latent mosaic viroid (PLMVd), were observed on leaves of cultivated almond trees. Since PLMVd was recently detected in peach and pear trees in Tunisia (4), the presence of this viroid in almond trees was studied. The detection method on the basis of one-tube reverse transcription-polymerase chain reaction (RT-PCR) assays was previously described and validated for the detection of this viroid in fruit trees (4). Amplification products were obtained by using previously reported primer pairs of PLMVd (1). Positive controls included RNA preparations of twigs of PLMVd-infected GF 305 peach seedlings. These materials, provided by B. Pradier (Station de Quarantaine des Ligneux, Lempdes, France), were positive as revealed by chip budding on peach seedling indicator plants grown under greenhouse conditions. RT-PCR analysis of nucleic acid preparations from leaves of almond showed specific amplification products with the expected size of 337 bp for two almond trees among 17 trees tested. Nucleotide sequence analyses of cloned amplification products obtained with the PLMVd primers confirmed a size of 337 bp and revealed a sequence similar to sequences from other PLMVd isolates previously characterized. The sequences shared 94 to 98% identity with the reference isolates of PLMVd from peach (EMBL Accession No. M83545, AF170511, AF170514, and AY685181). The two infected almond trees are proximal to each other and peach trees infected with PLMVd. This suggests that one tree may have served as a source of inoculum for the other through agronomic practices such as pruning or the aphid Myzus percicae (3). Alternatively, PLMVd may have originated in an unknown host and was then transmitted to almond trees. Our investigation shows that almond is a new host for PLMVd. References: (1) N. Astruc. Eur. J. Plant Pathol. 102:837, 1996. (2) M. C. Cañizares et al. Eur. J. Plant Pathol. 105:553, 1999. (3) J. C. Desvignes et al. Phytoma 444:70, 1992. (4) I. Fekih Hassen et al. Plant Dis. 88:1164, 2004.

First Report of Cucurbit aphid-borne yellows virus in Tunisia Causing Yellows on Five Cucurbitacious Species.

Viruses, distributed worldwide on cucurbits, cause severe damage to crops. Virus surveys in 2003 and 2004 were made in all the major cucurbit-growing areas in Tunisia. Large populations of aphids (Aphis gossypii Glover) and severe yellowing symptoms of older leaves of cucurbits were observed in outdoor and under plastic-tunnel cultivation, suggesting the presence of Cucurbit aphid-borne yellows virus (CABYV, genus Polerovirus, family Luteoviridae). Leaf samples collected from symptomatic and asymptomatic plants of melon (Cucumis melo L.), cucumber (C. sativus L.), squash (Cucurbita pepo L.), watermelon (Citrullus lanatus L.), and ware cucurbit (Ecballium elaterium L. T. Richard) were screened for the presence of CABYV using enzyme-linked immunosorbent assay (ELISA) and reverse transcription-polymerase chain reaction (RT-PCR). Reference isolate, CABYV-N (GenBank Accession No. X76931) was provided by H. Lecoq (INRA-Monfavet Cedex, France). Sample extracts from fresh leaf tissues were tested using ELISA with an antiserum prepared against this isolate. In addition, total RNA was extracted from fresh leaf tissues according to the technique of Celix et al. (2) using the Titan RT-PCR kit from Roche Diagnostics (Penzberg, Germany). Forward primer (5'-GAGGCGAAGGCGAAGAAATC-3') and reverse primer (5'-TCTGGACCTGGCACTTGATG-3') were designed with the available sequence of the reference isolate. ELISA tests demonstrated that 91 plants were positive among 160 plants tested with severe yellowing symptoms. All asymptomatic plants were negative. RT-PCR results yielded an expected 550-bp product that was amplified from the reference isolate. Of the 160 plants tested using ELISA, 106 plants were screened with RT-PCR including the 91 plants that were positive in ELISA. These 91 plants also were positive after RT-PCR amplification as were 12 more plants. This demonstrated that the RT-PCR test is more sensitive. No amplicons were produced from extracts of asymptomatic plants, RNA preparations of Cucurbit yellow stunting disorder virus (CYSDV), or Beet pseudo yellows virus (BPYV) positive controls provided by B. Falk (University of California, Davis). CYSDV and BPYV can induce similar yellowing symptoms in cucurbits. The results of the ELISA and RT-PCR tests showed that CABYV is widely distributed on five cucurbit species in the major growing areas of Tunisia including the northern, Sahel, central, and southern regions where it was detected, respectively, in 10 of 25, 11 of 21, 24 of 37, and 58 of 77 samples tested. CABYV was detected at the rates of 63 of 72 on melon, 10 of 21 on cucumber, 17 of 24 on squash, 10 of 25 on watermelon, and 3 of 18 on ware cucurbit. CABYV also seems to be widespread throughout the Mediterranean Basin (1,3,4), but to our knowledge, this is the first report of the occurrence of CABYV in Tunisia on different species of cucurbit and ware cucurbit. References: (1) Y. Abou-Jawdah et al. Crop Prot. 19:217, 2000. (2) A. Celix et al. Phytopathology 86:1370, 1996. (3) M. Juarez et al. Plant Dis. 88:907, 2004. (4) H. Lecoq et al. Plant Pathol. 41:749, 1992.

Detection and epidemiological characteristics of peach latent mosaic viroid in Tunisia.

A rapid and sensitive assay was developed for the detection and identification of Peach latent mosaic viroid (PLMVd) by reverse transcription-polymerase chain reaction (RT-PCR) in infected tissues from Tunisian orchards. The test was initially performed by using total RNA preparations from selected isolates and then applied on total RNA preparations from leaf or bark tissues of fruit trees collected in 2003 in 20 orchards in the North of Tunisia and the Sahel. PLMVd occurred in peach and pear trees. The identity of the detected viroid was confirmed by comparison of its sequence with other isolates previously characterized. The test was then simplified by direct use of diluted crude plant extracts. The results obtained from crude sap extracts of leaves or bark tissues are identical to those obtained from total RNA preparations. Epidemiological characteristics of PLMVd on peach trees have been investigated. A survey of peach trees was carried out in 32 orchards in May 2004. The obtained results showed that (1) PLMVd is highly and equally present in several regions of the north of Tunisia rather than the central, the Sahel and the southern regions, (2) infection percentage increases with the age of the tree and (3) the studied cultivars are classified into three groups of sensitivity.

Development of molecular tests for the detection of ILAR and latent viruses in fruit trees.

The detection throughout the year of latent and ILAR viruses in fruit tress by classical serological tests appear to be unreliable. We have developed RT-PCR tests for a reliable detection of latent and ILAR viruses in fruit trees. These assays were then simplified to allow the direct use of crude plant extracts instead of total RNA preparations, and the analyses of pooled samples. In this way, such RT-PCR protocols are suitable for a routine diagnosis of latent and ILAR viruses in fruit tree certification.

First Report of Pear blister canker viroid, Peach latent mosaic viroid, and Hop stunt viroid Infecting Fruit Trees in Tunisia.

Viroids of fruit trees are plant pathogens distributed worldwide and can cause severe losses and economic damage to crops. A survey of fruit trees was carried out in 17 orchards in the northern and Sahel regions of Tunisia. Samples were collected in field trees of peach (Prunus persica L), pear (Pyrus communis L), and almond (Prunus dulcis Mill.) that showed symptoms potentially caused by viroids (leaf mosaic in peach, blister canker in pear, and necrotic leaves in almond). The investigation was conducted during May, September, and December 2003 to screen for the presence of Pear blister canker viroid (PBCVd) on pear, Peach latent mosaic viroid (PLMVd) on peach, and Hop stunt viroid (HSVd) on the three plant species in naturally infected field trees. The detection method was based on one-tube reverse transcription-polymerase chain reaction (RT-PCR) assays using a Titan kit (Roche Diagnostics, Penzberg, Germany). DNA amplification was obtained by using previously reported primer pairs for PLMVd and HSVd (1,4). For PBCVd, forward primer 5' GTCTGAAGCCTGGGCGCTGG 3' and reverse primer 5' CCTTCGT CGACGACGAGCCGAG 3' were designed using an available sequence (3). Positive controls included isolate D168 of PLMVd (obtained from Dr. B. Pradier, Station de Quarantaine des Ligneux, Lempdes, France) and propagated in GF 305 rootstock and HSVd (provided by Dr. R. Flores, Instituto de Biologia Molecular y cellular de Plantas, Valencia, Spain) propagated in cucumber. The method described by Grasseau et al. (2), with some modifications, was used to prepare the samples for RT-PCR. RT-PCR analysis of nucleic acid preparations from leaves and bark of peach, pear, and almond showed that PLMVd occurred in the northern and Sahel regions of Tunisia. Of 37 peach trees tested, 12 were found infected with PLMVd. Two pear trees among 73 tested were infected with PBCVd. HSVd was detected in 2 of 11 almond, 1 of 37 peach, and 7 of 72 pear trees tested. One pear tree infected with HSVd was also infected with PBCVd. Symptoms observed in fruit trees were not consistently associated with the presence of viroids. Nucleotide sequence analyses of cloned amplification products obtained using the PBCVd, PLMVd, and HSVd primers confirmed a size of 315, 330, and 300 nt, respectively, and revealed a sequence similar to sequence variants from other isolates previously characterized for each viroid. PBCVd was 99% identical with the P47A isolate variant 9 (GenBank Accession No. Y18043); PLMVd shared 85 to 96% identity with the PC-C32 Italian isolate of PLMVd from peach (GenBank Accession No. AJ550905), and HSVd shared 99 to 100% identity with the HSVd from dapple plum fruit (GenBank Accession No. AY460202). To our knowledge, our investigation reports for the first time, the occurrence of PLMVd, PBCVd, and HSVd infecting fruit trees in Tunisia, stressing the need for a certification program to aid in prevention and spread of fruit tree viroids in this country. References: (1) N. Astruc. Eur. J. Plant Pathol. 102:837, 1996. (2) N. Grasseau et al. Infos-Ctifl (Centre Technique Interprofessionel des Fruits et Légumes). 143:26,1998. (3) C. Hernandez et al. J. Gen. Virol 73:2503, 1992. (4) S. Loreti et al. EPPO Bull. 29:433, 1999.

Development of Real-Time RT-PCR Assay for Detection of Prunus necrotic ringspot virus in Fruit Trees.

A real-time fluorescent reverse-transcriptase polymerase chain reaction (RT-PCR) assay using a short fluorogenic 3' minor groove binder (MGB) DNA hydrolysis probe was developed for the detection of Prunus necrotic ringspot virus (PNRSV) in stone fruit trees. The covalent attachment of the minor groove binder moiety at the 3' end of the probe increased the probe target duplex stability and raised the melting temperature to a range suitable for real-time analysis. The real-time RT-PCR assay correlated well with conventional RT-PCR results for the detection of PNRSV. This assay reliably detects PNRSV in bark tissues of dormant cherry and plum trees. Furthermore, it is well adapted for the routine detection of PNRSV because it eliminates one risk of contamination by performing the whole test in a single closed tube. This system may replace the commonly used diagnostic techniques (e.g., woody indicators and immunological tests) to detect this virus.

Development of Real-Time PCR for the Rapid Detection of Episomal Banana streak virus (BSV).

A real-time assay for the detection of episomal Banana streak virus (BSV; strain OL) in banana and plantains that carry integrated BSV sequences is described. Primers specific to the viral DNA were designed using the viral sequence integrated into the cv. Obino l'Ewai genome and the sequence of the genomic DNA of the infecting virus strain OL. They amplify a sequence of 1,336 bp that is detected in real-time by a short fluorogenic 3' minor groove binder DNA probe. This method enables reproducible and specific detection of episomal BSV from purified DNA as well as from crude extracts from infected plants. The assay is rapid, adaptable for large-scale experiments, and circumvents carryover problems.

First Report of Banana mild mosaic virus Isolated from Plantains (Musa AAB) in Colombia.

Plantains (Musa AAB) are important sources of food and income for millions of people in Colombia and other developing countries. Colombia is the largest producer of plantains (2) and the third largest exporter of bananas in the world. In 2001, plants of 'Dominico-Hartón' plantain showing mild chlorotic streak symptoms were observed in northwestern Colombia. Electron microscopy of symptomatic tissue extracts revealed the presence of filamentous virus-like particles approximately 800 nm long. Immunocapture reverse-transcription polymerase chain reaction was performed to test for the presence of Banana mild mosaic virus (BanMMV) as described by J. E. Thomas (unpublished, Queensland Department of Primary Industries, Australia) and Sharman et al. (3). For polymerase chain reaction (PCR), the upstream primer No. 193 (5'-CAC TTA GGT TTG TGT GAT GT-3') (designed in this study by using the computer Program DNAMAN Version 4.13) and the downstream primer Poty1 (5'-GGA TCC CGG GTT TTT TTT TTT TTT TTT V-3') (1,3; J. E. Thomas, unpublished, Queensland Department of Primary Industries, Australia) were used. Amplification products of the expected size (approximately 900 bp) were obtained and sequenced after cloning in a pCR2.1 plasmid vector. Analyses of nucleic acid sequences using the international sequence databases and the BLAST program yielded nucleotide and amino acid sequence similarities of 80 to 83% and 90 to 92%, respectively, with an Australian isolate of BanMMV (GenBank Accession No. AF314662). The coat protein (CP) gene of the Colombian BanMMV isolate consists of 717 nucleotides. When the CP of the Colombian BanMMV isolates (GenBank Accession Nos. AY319331, AY319332, and AY319333) was compared with the CP of the Australian isolate, a highly variable region was observed in the N-terminus region. To our knowledge, this is the first report of BanMMV isolated from plantains in Colombia and the presence of molecular variability in the CP of BanMMV isolates. BanMMV has been found in Colombia associated with Banana streak virus and Cucumber mosaic virus in plantain. References: (1) A. Gibbs and A. Mackenzie. J. Virol.Methods 63:9, 1997 (2) N. S. Price. Infomusa 8(2):26, 1999. (3) M. Sharman et al. J. Virol. Methods 89:75, 2000.

[Neonatal type 1 pneumococcal meningitis and maternal septicemia]. / Méningite néonatale à pneumocoque de type 1 et septicémie maternelle.

The most common organisms in neonatal meningitis are group B streptococcus and Gram negative enteric bacteriae. Although Neisseria meningitidis, Haemophilus influenzae and Streptococcus pneumoniae are the most frequent causes of meningitis in infancy and childhood, they are uncommon in newborns. We report one case of neonatal meningitis and maternal septicemia.

The nucleotide sequence and genome organization of the whitefly transmitted sweetpotato mild mottle virus: a close relationship with members of the family Potyviridae.

Primers corresponding to conserved regions in the RNA-dependent RNA polymerase and the RACE procedure led to the cloning of the complete sweetpotato mild mottle virus (SPMMV) RNA genome. The assembled SPMMV genomic sequence was 10,818 nucleotides in length with a polyadenylated tract at the 3' terminus. The structure and organization of the SPMMV genome appear to be similar to those of potyviruses and rymoviruses. A 5' untranslated region, rich in A and U residues, is present between nucleotides 1 and 139. A putative initiation codon, at nucleotides 140-142, marks the beginning of a large open reading frame (ORF) which ends in UAA at positions 10,508-10,510. A 308-nucleotide untranslated region is present between the termination codon of the ORF and the beginning of the 3' polyadenylated region. Almost all known potyvirus motifs are present in the polyprotein of SPMMV. However, motifs in the putative helper-component and coat protein of SPMMV are incomplete or missing, which may account for its vector relations. Despite similarities with rymoviruses, potyviruses and, to a lesser extent, bymoviruses, comparative sequence analyses demonstrated that SPMMV belongs to a distinct genus of the family Potyviridae.

Differentiation Among Potyviruses Infecting Sweet Potato Based on Genus-and Virus-Specific Reverse Transcription Polymerase Chain Reaction.

Knowledge of virus diseases affecting sweet potato has been complicated due to the frequent occurrence of mixed infections and difficulties in isolating and purifying sweet potato viruses. A combined assay of reverse transcription and polymerase chain reaction (PCR) utilizing degenerate genus-specific primers POT1 and POT2 was applied to 18 sweet potato clones from China. The primers were designed to amplify the variable 5' terminal region of the potyvirus coat protein gene. Molecular analysis of the amplified fragments identified the Chinese strains of sweet potato feathery mottle virus (SPFMV-CH), sweet potato latent virus (SPLV-CH), and sweet potato virus G (SPVG-CH). Among the detected potyviruses, a distantly related strain of SPFMV-CH, tentatively named SPFMV-CH2, was identified in sweet potatoes from China. On the basis of sequence identity, SPFMV-CH2 was closely related to the common (-C) strain of that virus. Identification of a closely related strain of SPVG-CH in one sweet potato clone from China further illustrated the usefulness of broad-spectrum PCR for detecting uncharacterized viruses. The acquisition of sequence information permitted the design of virus-specific primers for detecting and differentiating SPFMV, SPLV, and SPVG.

Detection of Apple Stem Grooving Virus in Dormant Apple Trees with Crude Extracts as Templates for One-Step RT-PCR.

Partial nucleotide sequences of amplification products obtained from four European apple stem grooving virus (ASGV) isolates using degenerate primers showed 80 to 85% similarity with the published ASGV sequence of a Japanese strain but 98 to 100% identities among themselves. Based on these sequences, two ASGV-specific primers (ASGV4F-ASGV4R) were designed to amplify a 574-bp fragment located in the putative viral RNA polymerase. With these primers, six European and five American ASGV isolates, maintained in herbaceous hosts (Chenopodium quinoa, Nicotiana glutinosa, and N. occidentalis) or in apple trees, were readily detected by reverse transcription-polymerase chain reaction (RT-PCR). Using these specific ASGV primers, dsRNA preparations have been shown to constitute good templates for reliable amplification of ASGV sequences from leaves and bark tissues of apple trees, both in a two-step RT-PCR protocol and in the one-step Titan One-Tube RT-PCR. System. Furthermore, the one-step RT-PCR system allowed a specific amplification of ASGV sequences directly from clarified crude extracts of leaves and bark tissues of apple trees during both active growth and the dormant season.

Evidence for the assignment of two strains of SPLV to the genus Potyvirus based on coat protein and 3' non-coding region sequence data.

The use of potyvirus-specific primers and subsequent application of the RACE procedure allowed the cloning of the 3' terminal 1088 nucleotides of the genomic RNA of the Taiwan isolate of sweetpotato latent virus (SPLV-T) and the 3' genomic 1085 nucleotides of a SPLV-like virus from China (SPLV-CH). The sequence of an internal part of the presumptive nuclear inclusion b gene was also determined for both isolates. Detailed sequence analyses revealed the presence of consensus motifs which indicated that SPLV-CH and SPLV-T should be regarded as members of the genus Potyvirus. Multiple sequence alignments and phylogenetic analyses were also performed and unambiguously assessed these isolates as strains of a distinct Potyvirus. SPLV was not related to other potyviruses infecting sweetpotato nor to any other sequenced virus. From the presence of the DAG box, SPLV-CH is expected to be a typical aphid transmitted Potyvirus whereas a conceivable explanation is proposed for the non-aphid transmission of SPLV-T.

Determination of the taxonomic position and characterization of yam mosaic virus isolates based on sequence data of the 5'-terminal part of the coat protein cistron.

The sequences of the N-terminal part of the coat protein cistron from six isolates of yam mosaic virus (YMV-TOG, YMV-COT, YMV-12, YMV-CAR, YMV-BU1 and YMV-BU2) were determined. The analysis of the deduced amino acid sequences revealed the presence of consensus motifs characteristic of the potyvirus genus supporting the classification of YMV as a potyvirus member. The alignment of the N-terminal part of the coat protein of YMV-TOG, YMV-COT, YMV-12 and YMV-CAR showed that they were identical in size (152 aa) while YMV-BU1 and YMV-BU2 were shorter (140 aa) due to a deletion of 12 aa. These amino acid sequences exhibit an overall sequence identity ranging from 70.4% to 97.4% while the identity level with the other potyviruses sequenced in the considered region is below 50%, confirming that YMV is a distinct member of the potyvirus genus. The detailed analysis of the amino acid sequence alignment and of the identity levels observed between the N-terminal part of the coat protein of the six YMV isolates lead us to suggest that they have to be considered as distantly related strains of YMV rather than closely related but distinct viruses.

Molecular evidence that the whitefly-transmitted sweetpotato mild mottle virus belongs to a distinct genus of the Potyviridae.

Complementary DNA representing 2 108 nucleotides at the 3' end of the genomic RNA of the whitefly-transmitted sweetpotato mild mottle virus (SPMMV) was cloned after PCR. Sequence analysis revealed an open reading frame of 1 797 nucleotides which codes for a protein of 599 amino acids, followed by a 3' non-coding region of 311 nucleotides. Alignment of the deduced amino acid sequence with corresponding sequences of other members of the Potyviridae demonstrated that part of the presumptive RNA-dependent RNA polymerase and the coat protein coding regions of SPMMV are found at the 3' end of its genome, in that order. Alignment of the amino acid sequence of the core of SPMMV coat protein with those of selected members of the Potyviridae showed limited identity, thus demonstrating--with phylogenetic analysis--that SPMMV belongs to a distinct genus of the family Potyviridae.

The complete nucleotide sequences of the coat protein cistron and the 3' non-coding region of a newly-identified potyvirus infecting sweetpotato, as compared to those of sweetpotato feathery mottle virus.

Complementary DNA representing 728 nucleotides of the 3' end of the genomic RNA of sweetpotato virus G (SPV-G) a newly-identified potyvirus infecting sweetpotato, was cloned and sequenced. This sequence was combined with that previously determined for the 5' terminal part of the coat protein cistron of the virus. The whole sequence contained a single open reading frame (ORF) of 1065 nucleotide, with the capacity to encode a coat protein of 355 amino acids, significantly larger than that of other potyviruses. The ORF was followed by an untranslated region of 222 nucleotides and a poly (A) tail. The coat protein of SPV-G was only distantly related to that of known potyviruses, with the exception of sweetpotato feathery mottle virus (SPFMV). Indeed, sequence identity in the C-terminal three quarters of the coat protein (more than 80%) and in the 3' untranslated region (more than 70%) indicate that SPV-G should be considered as closely related to, though distinct from SPFMV. This subset relationship is similar to that previously reported for members of the bean yellow mosaic virus subgroup or the bean common mosaic virus subgroup.

Identification of a sweet potato feathery mottle virus isolate from China (SPFMV-CH) by the polymerase chain reaction with degenerate primers.

Four degenerate oligonucleotide primers derived from conserved regions of the genome of potyviruses have been designed. A combined assay of reverse transcription and the polymerase chain reaction utilizing these primers on total RNA extracted from Ipomoea purpurea infected with a sweet potato feathery mottle virus isolate from China (SPFMV-CH), amplified a 1.35 kb and a 830 bp fragment. These amplified fragments were cloned into the Bluescript plasmid and sequenced. The comparison of the sequence of the N-terminal part of the coat protein of SPFMV-CH with those published for two other strains of SPFMV, showed a strong relationship between SPMV-CH and -RC.