Dynamic changes in lysosome-related pathways in APP/PS1 mice with aging.

Senile plaque, composed of amyloid ß protein (Aß) aggregates, is a critical pathological feature in Alzheimer's disease (AD), leading to cognitive dysfunction. However, how Aß aggregates exert age-dependent toxicity and temporal cognitive dysfunction in APP/PS1 mice remains incompletely understood. In this study, we investigated AD pathogenesis and dynamic alterations in lysosomal pathways within the hippocampus of age-gradient male mice using transcriptome sequencing, molecular biology assays, and histopathological analyses. We observed high levels of ß-amyloid precursor protein (APP) protein expression in the hippocampus at an early stage and age-dependent Aß deposition. Transcriptome sequencing revealed the enrichment of differential genes related to the lysosome pathway. Furthermore, the protein expression of ATP6V0d2 and CTSD associated with lysosomal functions exhibited dynamic changes with age, increasing in the early stage and decreasing later. Similar age-dependent patterns were observed for the endosome function, autophagy pathway, and SGK1/FOXO3a pathway. Nissl and Golgi staining in the hippocampal region showed age-dependent neuronal loss and synaptic damage, respectively. These findings clearly define the age-gradient changes in the autophagy-lysosome system, the endosome/lysosome system, and the SGK1/FOXO3a pathway in the hippocampus of APP/PS1 mice, providing new perspectives and clues for understanding the possible mechanisms of AD, especially the transition from compensatory to decompensated state.

Abnormal protein post-translational modifications induces aggregation and abnormal deposition of protein, mediating neurodegenerative diseases.

Protein post-translational modifications (PPTMs) refer to a series of chemical modifications that occur after the synthesis of protein. Proteins undergo different modifications such as phosphorylation, acetylation, ubiquitination, and so on. These modifications can alter the protein's structure, function, and interaction, thereby regulating its biological activity. In neurodegenerative diseases, several proteins undergo abnormal post-translational modifications, which leads to aggregation and abnormal deposition of protein, thus resulting in neuronal death and related diseases. For example, the main pathological features of Alzheimer's disease are the aggregation of beta-amyloid protein and abnormal phosphorylation of tau protein. The abnormal ubiquitination and loss of α-synuclein are related to the onset of Parkinson's disease. Other neurodegenerative diseases such as Huntington's disease, amyotrophic lateral sclerosis, and so on are also connected with abnormal PPTMs. Therefore, studying the abnormal PPTMs in neurodegenerative diseases is critical for understanding the mechanism of these diseases and the development of significant therapeutic strategies. This work reviews the implications of PPTMs in neurodegenerative diseases and discusses the relevant therapeutic strategies.

Gypenoside IX restores Akt/GSK-3ß pathway and alleviates Alzheimer's disease-like neuropathology and cognitive deficits.

The main pathological changes of Alzheimer's disease (AD), a progressive neurodegenerative disorder, include senile plaque (deposited by amyloid beta), neurofibrillary tangle (formed by paired helical filaments composed of hyperphosphorylated tau), and massive loss of neurons. Currently there is a lack of ideal drugs to halt AD progression. Gypenosides (GPs), a kind of natural product, possesses potential therapeutic effects for neurodegenerative diseases, including AD. However, the specific role and mechanism of GPs for AD remain unclear. In the current study, we used staurosporine (STP), an inducer of apoptosis and causing tau hyperphosphorylation, to mimic AD models, and explored the role and mechanism of Gypenoside IX (one of the extracts of Gynostemma, GP for short name in our experiments) in STP treated primary hippocampal neurons and rats. We found STP not only increased apoptosis and tau hyperphosphorylation, but also significantly increased Aß production, resulting in synaptic dysfunction and cognitive decline in mimic AD models by STP. GP was found to rescue apoptosis and cognitive impairments caused by STP treatment. Moreover, GP recovered the decreased synaptic proteins PSD95, Synaptophysin and GluR2, and blocked dendritic spine loss. Interestingly, GP decreased the STP induced tau hyperphosphorylation at different sites including S-199, S-202, T-205, T-231, S-262, S-396, and S-404, and at the same time decreased Aß production through down-regulation of BACE1 and PS1. These effects in STP treated primary hippocampal neurons and rats were accompanied with a restoration of AKT/GSK-3ß signaling axis with GP treatment, supporting that dysregulation of AKT/GSK-3ß pathway might be involved in STP related AD pathogenesis. The results from our research proved that GP might be a potential candidate compound to reduce neuronal damage and prevent the cognitive decline in AD.

Complicated Role of Post-translational Modification and Protease-Cleaved Fragments of Tau in Alzheimer's Disease and Other Tauopathies.

Tau, a microtubule-associated protein predominantly localized in neuronal axons, plays a crucial role in promoting microtubule assembly, stabilizing their structure, and participating in axonal transport. Perturbations in tau's structure and function are implicated in the pathogenesis of neurodegenerative diseases collectively known as tauopathies, the most common disorder of which is Alzheimer's disease (AD). In tauopathies, it has been found that tau has a variety of post-translational modification (PTM) abnormalities and/or tau is cleaved into a variety of fragments by some specific proteolytic enzymes; however, the precise contributions of these abnormal modifications and fragments to disease onset and progression remain incompletely understood. Herein, we provide an overview about the involvement of distinctive abnormal tau PTMs and different tau fragments in the pathogenesis of AD and other tauopathies and discuss the involvement of proteolytic enzymes such as caspases, calpains, and asparagine endopeptidase in mediating tau cleavage while also addressing the intercellular transmission role played by tau. We anticipate that further exploration into PTMs and fragmented forms of tau will yield valuable insights for diagnostic approaches and therapeutic interventions targeting AD and other related disorders.

Ferulic Acid Improves Synaptic Plasticity and Cognitive Impairments by Alleviating the PP2B/DARPP-32/PP1 Axis-Mediated STEP Increase and Aß Burden in Alzheimer's Disease.

The burden of Alzheimer's disease, the most prevalent neurodegenerative disease, is increasing exponentially due to the increase in the elderly population worldwide. Synaptic plasticity is the basis of learning and memory, but it is impaired in AD. Uncovering the disease's underlying molecular pathogenic mechanisms involving synaptic plasticity could lead to the identification of targets for better disease management. Using primary neurons treated with Aß and APP/PS1 animal models, we evaluated the effect of the phenolic compound ferulic acid (FA) on synaptic dysregulations. Aß led to synaptic plasticity and cognitive impairments by increasing STEP activity and decreasing the phosphorylation of the GluN2B subunit of NMDA receptors, as well as decreasing other synaptic proteins, including PSD-95 and synapsin1. Interestingly, FA attenuated the Aß-upregulated intracellular calcium and thus resulted in a decrease in PP2B-induced activation of DARPP-32, inhibiting PP1. This cascade event maintained STEP in its inactive state, thereby preventing the loss of GluN2B phosphorylation. This was accompanied by an increase in PSD-95 and synapsin1, improved LTP, and a decreased Aß load, together leading to improved behavioral and cognitive functions in APP/PS1 mice treated with FA. This study provides insight into the potential use of FA as a therapeutic strategy in AD.

A cysteine-rich secretory protein involves in phytohormone melatonin mediated plant resistance to CGMMV.

BACKGROUND: Melatonin is considered to be a polyfunctional master regulator in animals and higher plants. Exogenous melatonin inhibits plant infection by multiple diseases; however, the role of melatonin in Cucumber green mottle mosaic virus (CGMMV) infection remains unknown. RESULTS: In this study, we demonstrated that exogenous melatonin treatment can effectively control CGMMV infection. The greatest control effect was achieved by 3 days of root irrigation at a melatonin concentration of 50 µM. Exogenous melatonin showed preventive and therapeutic effects against CGMMV infection at early stage in tobacco and cucumber. We utilized RNA sequencing technology to compare the expression profiles of mock-inoculated, CGMMV-infected, and melatonin+CGMMV-infected tobacco leaves. Defense-related gene CRISP1 was specifically upregulated in response to melatonin, but not to salicylic acid (SA). Silencing CRISP1 enhanced the preventive effects of melatonin on CGMMV infection, but had no effect on CGMMV infection. We also found exogenous melatonin has preventive effects against another Tobamovirus, Pepper mild mottle virus (PMMoV) infection. CONCLUSIONS: Together, these results indicate that exogenous melatonin controls two Tobamovirus infections and inhibition of CRISP1 enhanced melatonin control effects against CGMMV infection, which may lead to the development of a novel melatonin treatment for Tobamovirus control.

Inactivation of ERK1/2-CREB Pathway Is Implicated in MK801-induced Cognitive Impairment.

OBJECTIVE: Schizophrenia (SZ) is associated with cognitive impairment, and it is known that the activity of cAMP response element binding protein (CREB) decreases in the brain of SZ patients. The previous study conducted by the investigators revealed that the upregulation of CREB improves the MK801-related SZ cognitive deficit. The present study further investigates the mechanism on how CREB deficiency is associated with SZ-related cognitive impairment. METHODS: MK-801 was used to induce SZ in rats. Western blotting and immunofluorescence were performed to investigate CREB and the CREB-related pathway implicated in MK801 rats. The long-term potentiation and behavioral tests were performed to assess the synaptic plasticity and cognitive impairment, respectively. RESULTS: The phosphorylation of CREB at Ser133 decreased in the hippocampus of SZ rats. Interestingly, among the upstream kinases of CREB, merely ERK1/2 was downregulated, while CaMKII and PKA remained unchanged in the brain of MK801-related SZ rats. The inhibition of ERK1/2 by PD98059 reduced the phosphorylation of CREB-Ser133, and induced synaptic dysfunction in primary hippocampal neurons. Conversely, the activation of CREB attenuated the ERK1/2 inhibitor-induced synaptic and cognitive impairment. CONCLUSION: These present findings partially suggest that the deficiency of the ERK1/2-CREB pathway is involved in MK801-related SZ cognitive impairment. The activation of the ERK1/2-CREB pathway may be therapeutically useful for treating SZ cognitive deficits.

Pratylenchus zeae a causative agent of Corn Root Rot in Jiangsu Province of China.

Corn (Zea mays L.) plays an important role in China's cash crops, not only as food, but a vital raw material for animal husbandry and industry (Li et al. 2022). Pratylenchus zeae is one of the most damaging root-lesion nematodes (RLN) that can result in decreased yield and quality of crops (Liu et al. 2017). In September 2020, five root/soil samples were collected from the rhizosphere of corn (cv. Zhengdan 958), which had weak growth and root brown lesions in Chenzhou Village, Taolin Town, Donghai County, Lianyungang City, Jiangsu Province of China. Nematodes were extracted from the collected samples using the modified Baermann funnel method (Hooper et al. 2005). RLN were found in all samples, an average of 46 RLN per gram of root and 138 RLN per 100 cm3 of soil. The obtained RLN females were sterilized with 0.3% streptomycin sulfate and then inoculated on each carrot disks individually to obtain the purified population. RLN were examined by morphological and molecular characteristics to confirm the species indentification. The main morphological measurements of adult (n = 15) included body length = 524.7 µm (mean) ± 15.1 (standard deviation) (range = 490.7 to 543.6 µm), stylet = 15.2 µm ± 0.8 (14.2 to 16.8 µm), tail length = 30.3 µm ± 2.5 (26.3 to 35.3 µm), a = 25.6 ± 1.3 (24.4 to 29.3), b = 5.3 ± 0.3 (4.7 to 5.8), c = 17.4 ± 1.4 (14.9 to 19.3), two annules on the lip region. No males were found in the specimens. The morphological characters of this population are consistent with the description of P. zeae (Castillo and Vovlas, 2007). Furthermore, DNA was extracted from individual nematodes. The primers of TW81/AB28 and D2A/D3B (Subbotin et al. 2006) were used to amplified the rDNA-ITS region and rDNA 28S D2-D3 region, respectively. The purified PCR products were ligated into One step ZTOPO-Blunt/TA vector and transformed to Escherichia coli strain DH5α, and then sequenced by Sunya Biotechnology Co., Ltd (Henan, China). The obtained seqences were submitted to NCBI. The rDNA-ITS sequences (669 bp, GenBank Accession No: OP456372 and OP466367) exhibited 95.0% to 97.1% of identity with P. zeae sequences (KU198980 and KU198975). The obtained D2-D3 region of the 28S rDNA sequences (782 bp, OP441397 and OP448675) exhibited 99.7% to 100% identity with P. zeae sequences (EU130893 and KY424269). Consequently, both morphological and molecular data confirmed the identity of P. zeae. To further confirm reproduction on corn, single corn seeds (cv. Zhengdan 958) were sown in eight 2-liter pots filled with 1.8-liter of sterilized soil in greenhouse at 28°C. About 15 days after sowing, each pot with one corn plant with the same growth status was selected to inoculate with 1,000 mixed stage nematodes of P. zeae , Eight pots of uninoculated corn plants were used as controls. After 60 days, the inoculated plants were harvested and brown lesions were observed on roots. No symptoms and nematodes was detected in the control. An average number of RLN per pot was 3,752 in soil and 1,183 in roots were extracted, the reproduction factor (final population/initial population) was 4.94, indicating that P. zeae infects and reproduces well on this corn cultivar. P. zeae has only been reported on corn in Guangxi Province, southern in China(Fang et al. 1994). To our knowledge, this is the fist report of P. zeae infecting corn in Jiangsu Province, eastern in China. As P. zeae can cause great damage to corn, necessary measures should be taken to prevent the spread of P. zeae to other areas.

Interaction between cucumber green mottle mosaic virus MP and CP promotes virus systemic infection.

The movement protein (MP) and coat protein (CP) of tobamoviruses play critical roles in viral cell-to-cell and long-distance movement, respectively. Cucumber green mottle mosaic virus (CGMMV) is a member of the genus Tobamovirus. The functions of CGMMV MP and CP during viral infection remain largely unclear. Here, we show that CGMMV MP can interact with CP in vivo, and the amino acids at positions 79-128 in MP are vital for the MP-CP interaction. To confirm this finding, we mutated five conserved residues within the residue 79-128 region and six other conserved residues flanking this region, followed by in vivo interaction assays. The results showed that the conserved threonine residue at the position 107 in MP (MPT107 ) is important for the MP-CP interaction. Substitution of T107 with alanine (MPT107A ) delayed CGMMV systemic infection in Nicotiana benthamiana plants, but increased CGMMV local accumulation. Substitutions of another 10 conserved residues, not responsible for the MP-CP interaction, with alanine inhibited or abolished CGMMV systemic infection, suggesting that these 10 conserved residues are possibly required for the MP movement function through a CP-independent manner. Moreover, two movement function-associated point mutants (MPF17A and MPD97A ) failed to cause systemic infection in plants without impacting on the MP-CP interaction. Furthermore, we have found that co-expression of CGMMV MP and CP increased CP accumulation independent of the interaction. MP and CP interaction inhibits the salicylic acid-associated defence response at an early infection stage. Taken together, we propose that the suppression of host antiviral defence through the MP-CP interaction facilitates virus systemic infection.

HIF-1α Causes LCMT1/PP2A Deficiency and Mediates Tau Hyperphosphorylation and Cognitive Dysfunction during Chronic Hypoxia.

Chronic hypoxia is a risk factor for Alzheimer's disease (AD), and the neurofibrillary tangle (NFT) formed by hyperphosphorylated tau is one of the two major pathological changes in AD. However, the effect of chronic hypoxia on tau phosphorylation and its mechanism remains unclear. In this study, we investigated the role of HIF-1α (the functional subunit of hypoxia-inducible factor 1) in tau pathology. It was found that in Sprague-Dawley (SD) rats, global hypoxia (10% O2, 6 h per day) for one month induced cognitive impairments. Meanwhile it induced HIF-1α increase, tau hyperphosphorylation, and protein phosphatase 2A (PP2A) deficiency with leucine carboxyl methyltransferase 1(LCMT1, increasing PP2A activity) decrease in the rats' hippocampus. The results were replicated by hypoxic treatment in primary hippocampal neurons and C6/tau cells (rat C6 glioma cells stably expressing human full-length tau441). Conversely, HIF-1α silencing impeded the changes induced by hypoxia, both in primary neurons and SD rats. The result of dual luciferase assay proved that HIF-1α acted as a transcription factor of LCMT1. Unexpectedly, HIF-1α decreased the protein level of LCMT1. Further study uncovered that both overexpression of HIF-1α and hypoxia treatment resulted in a sizable degradation of LCMT1 via the autophagy--lysosomal pathway. Together, our data strongly indicated that chronic hypoxia upregulates HIF-1α, which obviously accelerated LCMT1 degradation, thus counteracting its transcriptional expression. The increase in HIF-1α decreases PP2A activity, finally resulting in tau hyperphosphorylation and cognitive dysfunction. Lowering HIF-1α in chronic hypoxia conditions may be useful in AD prevention.

The Therapeutic Effects of Seven Lycopodium Compounds on Cell Models of Alzheimer's Disease.

BACKGROUND: As an acetylcholinesterase inhibitor (AChEI), Huperzine-A (Hup-A) is marketed for treatment of mild to moderate Alzheimer's disease (AD) for decades in China. However, Hup-A causes some side effects. To search for new analogs or derivatives of Hup-A, we produced five Lycopodium alkaloids and two analogues by chemical synthesis: Lyconadins A-E, H-R-NOB, and 2JY-OBZ4. OBJECTIVE: To systematically evaluate the therapeutic effects of the seven compounds on AD cell models. METHODS: We assessed the effects of the seven compounds on cell viability via CCK-8 kit and used HEK293-hTau cells and N2a-hAPP cells as AD cell models to evaluate their potential therapeutic effects. We examined their effects on cholinesterase activity by employing the mice primary neuron. RESULTS: All compounds did not affect cell viability; in addition, Lyconadin A and 2JY-OBZ4 particularly increased cell viability. Lyconadin D and Lyconadin E restored tau phosphorylation at Thr231, and H-R-NOB and 2JY-OBZ4 restored tau phosphorylation at Thr231 and Ser396 in GSK-3ß-transfected HEK293-hTau cells. 2JY-OBZ4 decreased the level of PP2Ac-pY307 and increased the level of PP2Ac-mL309, supporting that 2JY-OBZ4 may activate PP2A. Lyconadin B, Lyconadin D, Lyconadin E, H-R-NOB, and 2JY-OBZ4 increased sAßPPα level in N2a-hAPP cells. 2JY-OBZ4 decreased the levels of BACE1 and sAßPPß, thereby reduced Aß production. Seven compounds exhibited weaker AChE activity inhibition efficiency than Hup-A. Among them, 2JY-OBZ4 showed the strongest AChE inhibition activity with an inhibition rate of 17% at 10µM. CONCLUSION: Among the seven Lycopodium compounds, 2JY-OBZ4 showed the most expected effects on promoting cell viability, downregulating tau hyperphosphorylation, and Aß production and inhibiting AChE in AD.

Novel small molecular compound 2JY-OBZ4 alleviates AD pathology in cell models via regulating multiple targets.

Alzheimer's disease (AD) is the most common form of neurodegenerative dementia, characterized by cognitive deficits and memory dysfunction, which is clinically incurable so far. Novel small molecular compound 2JY-OBZ4 is one of structural analogue of Huperzine A (Hup-A), an anti-AD drug in China. In our previous work, 2JY-OBZ4 exhibited potent effects on tau hyperphosphorylation, Aß production and acetylcholinesterase (AChE) activity. However, 2JY-OBZ4's anti-AD effects and the underlying molecular mechanisms remain unclear. We here reported that 2JY-OBZ4 resisted tau hyperphosphorylation at Thr181 and Ser396 sites in HEK293-hTau cells transfected with GSK-3ß, decreased tau phosphorylation via upregulating the activity of PP2A in HEK293-hTau cells and reduced Aß production through regulating protein levels of APP cleavage enzymes in N2a-hAPP cells. Meanwhile, we found that 2JY-OBZ4 had no adverse effects on cell viability of mice primary neuron even at high concentration, and ameliorated synaptic loss induced by human oligomeric Aß42. 2JY-OBZ4 had moderate AChE inhibitory activity with the half maximal inhibitory concentration (IC50) to be 39.48 µg/ml in vitro, which is more than two times higher than Hup-A. Together, 2JY-OBZ4 showed promising therapeutic effects in AD cell models through regulating multiple targets. The research provides a new candidate for the therapeutic development of AD.

USP10 deubiquitinates Tau, mediating its aggregation.

Normal Tau promotes the assembly and stabilization of microtubules, thus, maintaining axon transport. In Alzheimer's disease (AD), Tau aggregation causes it to lose these above-mentioned functions. However, the molecular mechanism leading to Tau aggregation in AD remains ambiguous. Here, we report that USP10, one of the important deubiquitinases (DUBs), is involved in Tau aggregation. We found that USP10 is upregulated in postmortem human AD and APP/PS1 mice brains, but not in P301S mice brains. Moreover, in primary neuronal cultures, Aß42 induces a dose-dependent USP10 upregulation, an increase in the levels of both total and phosphorylated Tau, as well as a markedly elevated Tau binding with USP10, that is accompanied by a significantly decreased Tau ubiquitination. In addition, overexpression of USP10 directly causes an increase in the levels of total and phosphorylated Tau, induces Tau aggregation, and delays in Tau degradation. Results from mass spectrometry, reciprocal immunoprecipitation, and immunofluorescence assays strongly prove Tau's interaction with USP10. This is further supported by the Tau307-326K and Tau341-378K peptides' competitive inhibition of Tau binding with USP10, attenuating Tau hyperphosphorylation and Tau deubiquitination. Together, our data strongly indicate that USP10 plays a critical role in mediating Tau aggregation via downregulating its ubiquitination and thus slowing down Tau turnover. Inhibition of USP10-Tau interaction might be therapeutically useful in the management of AD and related tauopathies.

Phosphorylation of Truncated Tau Promotes Abnormal Native Tau Pathology and Neurodegeneration.

Abnormal posttranslational modifications of tau play important roles in mediating neurodegeneration in tauopathies including Alzheimer's disease. Both phosphorylation and truncation are implicated in the pathogenesis of tauopathies. However, whether phosphorylation aggravates truncated tau-induced pathology and neurodegeneration remains elusive. Here, we construct different tau fragments cleaved by delta secretase, with either phosphorylation or non-phosphorylation mimic mutations, and evaluate the contributions of phosphorylation to truncated tau-induced pathological and behavioral alterations in vitro and in vivo through biochemical methods including detergent insoluble tau extraction, western blot, immunofluorescence, flow cytometry, and behavior tests. Our results show that the self-aggregation of phospho-truncated tau is significantly influenced by the domain it contains. N-terminal inhibits, proline-rich domain promotes, and C-terminus have no impact on phospho-truncated tau aggregation. Phosphorylation of truncated tau1-368, which contains the microtubule-binding repeat domain and the proline-rich domain, induces endogenous tau phosphorylation and aggregation. In vivo, phospho-tau1-368 but not non-phospho-tau1-368 leads to a decrease in body weight of C57BL/6 J mice. Intriguingly, although tau1-368-induced anxiety behavior in C57BL/6 J mice is phosphorylation-independent, the recognition memory of mice is impaired by phospho-tau1-368, but not by non-phospho-tau1-368. Immunofluorescence staining shows that overexpressing phospho-tau1-368 results in neuronal loss and gliosis in the hippocampus, while the transmission of tau1-368 is phosphorylation-independent as revealed by the flow cytometry results in vitro and immunofluorescence staining in vivo. Our findings indicate that phosphorylation of truncated tau significantly fosters endogenous tau pathology and neurodegeneration.

Occurrence of Root-Lesion Nematode Pratylenchus coffeae on Corn in Xinjiang Uygur Autonomous Region, China.

Pratylenchus coffeae Filipjev & Schuurmans Stekhoven, 1941, is one of the most important root-lesion nematodes (RLN) parasitizing many agronomic and industrial crops (Wang et al. 2021). Corn (Zea mays L.) is one economically important crop in China, with 35 million hectares cultivated annually (Li et al. 2019). In July 2019, a survey of RLN was carried out in corn field planting with cultivar Heyu 187 in Chuanba village in Qitai County, Xinjiang Uygur Autonomous Region, China. Five root/soil samples were collected from poor growing plants with distinct brown lesions. Nematodes were extracted from the collected root/soil samples with the modified Baermann funnel method (Hooper et al. 2005). The average of 157 RLN per 100 cm3 of soil and 43 RLN per gram of fresh root were extracted. The obtained RLN were sterilized with 0.3% streptomycin sulfate and cultured on carrot disks at 25°C. Twenty petri dishes with carrot disks, each inoculated with one female. The morphological and molecular characteristics of RLN cultured on carrot disks were examined for species identification. Morphological measurements of adult females (n=15) included body length (range = 529.0 to 658.0 µm, mean = 571.0 µm), head with two lip annuli, stylet (15.5 to 17.0 µm, 16.0 µm), tail length (27.5 to 32.5 µm, 30.5 µm), a (23.8 to 32.9, 28.5), b (5.8 to 7.1, 6.5), c (16.5 to 23.4, 18.9), and V (76.6 to 83.1%, 80.8%). Morphological measurements of adult males (n=15) were body length (range = 479.5 to 568.0 µm, mean = 516.0 µm), head with two lip annuli, stylet (14.5 to 15.5 µm, 15.0 µm), tail length (24.0 to 29.0 µm, 26.0 µm), spicule length (16.4 to 19.0 µm, 17.5 µm), gubernaculum length (4.4 to 5.3 µm, 4.9 µm), a (29.2 to 32.5, 31.0), b (5.7 to 6.9, 6.2), and c (18.2 to 22.6, 19.8). The morphological characters of this population are consistent with the description of P. coffeae (Castillo and Vovlas, 2007). Nematode DNA was extracted from an individual female. The primers of D2A/D3B (5'-ACAAGTACCGTGAGGGAAAGTTG-3'/5'-TCGGAAGGAACCAGCTACTA-3') (Subbotin et al. 2006) and 18S/26S (5'-TTGATTACGTCCCTGCCCTTT-3' / 5'-TTTCACTCGCCGTTACTAAGG-3') (Vrain et al. 1992) were used to amplify the D2/D3 expansion region of the 28S rRNA gene and the rDNA internal transcribed spacer (ITS) region, respectively. The PCR products were purified and transformed to E. coli strain DH5α, and then sequenced by Sangon Biotech Co. Ltd. (Shanghai, China). The obtained sequences of the D2/D3 region (793 bp) and the ITS region (1,242 bp) were submitted to GenBank, and the accession numbers for D2/D3 region were OK103614 and OK103619 which had 98.6% and 100% identity with the reported P. coffeae sequences (KC490925); the two obtained ITS sequences accession numbers OK103603 and OK103613) had more than 99% identity with published P. coffeae sequences from GenBank (e.g., LC030410, LC030395, MH134508 and LC030380). Hence, both morphological and molecular data demonstrated the presence of P. coffeae. To further confirm reproduction on corn, the obtained RLN population was used to inoculate corn plants in 2-liter pots containing 1.8-liter sterilized and mixed soil with 2 pastoral soil: 1 substrate in greenhouse at 27°C. About 15 days after sowing, each pot with one corn plant (cv. Heyu 187) with the same growth status was selected to inoculate P. coffeae. Five small holes near the roots were made using a glass rod. Approximately 1,000 mixed stage nematodes of P. coffeae were then pipetted into the holes of each plant. Eight replications were performed. Eight additional pots of uninoculated corn plants were used as control. After 2 months, corn roots were washed and brown lesions were observed on roots. The average number of RLN/pot was approximately 5,030 in soil and 2,870 in roots, and each pot had an average of 7.9 reproduction factors (final population/initial population), indicating that this nematode population infects and reproduces well on this corn cultivar. No nematodes and symptoms was detected in the control pot. The nematode of P. coffeae has only been reported on corn in Guangdong, Liaoning, Shangdong and Henan Provinces in China (Liu et al. 1996; Liu et al. 2001; Xia et al. 2021). To our knowledge, this is the first report of P. coffeae infecting corn in Xinjiang Uygur Autonomous Region of China. Since RLN can cause considerable damage to corn, one of the most important food crops produced in China, strategic measures should be taken to prevent the spread of P. coffeae to other regions.

First report of maize yellow mosaic virus causing maize reddening in Henan,China.

A novel polerovirus maize yellow mosaic virus (MaYMV) has been discovered in Asia (Chen et al. 2016; Lim et al. 2018; Sun et al. 2019; Wang et al. 2016), East Africa (Guadie et al. 2018; Massawe et al. 2018) and South America (Gonçalves et al. 2017). MaMYV was first reported to infect maize (Zea mays L.) showing yellow mosaic symptoms on the leaves in Yunnan, Guizhou, and yellowing and dwarfing symptoms on the leaves in Anhui provinces of China in 2016 (Chen et al. 2016; Wang et al. 2016). An East African isolate of MaYMV has recently been shown to induce leaf reddening in several maize genotypes (Stewart et al. 2020). To our knowledge the leaf reddening symptoms in maize was not reported in China and MaYMV was not reported in Henan province, China. A survey of viral diseases on maize was carried out during the autumn of 2021 in Zhengzhou (Henan province), China. During the survey, the leaves showing reddening symptoms were observed on maize plants in all four fields investigated. Symptomatic leaves of 12 plants from four fields of Xingyang county, Zhengzhou (n=12) were collected and mixed for metatranscriptomics sequencing, and total RNA was extracted and subjected to an rRNA removal procedure using a Ribo-zero Magnetic kit according to the manufacturer's instructions (Epicentre, an Illumina® company). cDNA libraries were constructed using a TruSeq™ RNA sample prep kit (Illumina). Barcoded libraries were paired-end sequenced on an Illumina HiSeq X ten platform at Shanghai Biotechnology Co., Ltd. (Shanghai, China) according to the manufacturer's instructions (www.illumina.com). In total 67607392 clean reads were de novo assembled using CLC Genomics Workbench (version:6.0.4). 105796 contigs were obtained. The assembled contigs were queried by homology search tools (BLASTn and BLASTx) against public database(GenBank). One 5,457 nucleotide (nt) long contig with the most reads of 558826 was obtained and blast analysis showed it shared 99.3% nt sequence identity (99% coverage) with MaYMV Yunnan4 isolate (KU291100).. According to the sequencing data no other plant viruses except MaYMV were present in the sequencing data. To confirm the presence of this virus, twelve leaf samples showing reddening symptoms were detected by RT-PCR using specific primer pairs for CP full length open reading frame (F: ATGAATACGGGAGGTAGAAA, R: CTATTTCGGGTTTTGAACAT). Amplicons with expected size of 594 bp were gained in seven samples and three of them were cloned into pMD18T vector and sequenced. The three isolates (OM417795, OM417796, and OM417797) shared 99.16% to 99.83% nt sequence identity with MaYMV-Yunnan3 isolate (KU291100). Further P0 sequence analysis of the three samples (OM417798, OM417799, and OM417800) with primer pairs F: ATGGGGGGAGTGCCTAAAGC/R: TCATAACTGATGGAATTCCC showed they shared 99.5% to 99.62% nt sequence identity with MaYMV-Yunnan3 isolate.To our knowledge, this is the first report of the occurrence of MaYMV infecting maize in Henan, China. Besides, our finding firstly discovered reddening symptoms caused by MaYMV on maize in China which is different from the previous symptoms observed in the other three provinces of China possibly due to the different maize varieties grown in different areas. According to our investigation, maize showing reddening symptoms was common in the fields. Henan province is the main corn production area in China. Corn leaf aphid (Rhopalosiphum maidis), the insect vector of MaYMV, is an important pest of corn in Henan province, thereby the occurrence of MaYMV might cause potential threat to maize production in China.

Identification and a culture method for a Helicotylenchus microlobus from tomato in China.

BACKGROUND: The nematodes of the genus Helicotylenchus are root parasites of a wide variety of plants, and certain species can cause serious damage to their hosts. During a survey of the plant-parasitic nematode associated with tomato, a population of Helicotylenchus was collected from tomato roots and soil samples. Thus, one of the objectives of the study was to confirm the specie of Helicotylenchus obtained from the tomato samples based on morphological and molecular characteristics. In addition, a mass pure culture of plant-parasitic nematodes is key to pathogenicity studies and many other biological studies. However, a successful mass rearing method for Helicotylenchus has not been reported. Thus, the other objective of the study was to establish a method of culturing Helicotylenchus. RESULTS: Based on both the morphological characteristics and molecular analysis of the internal transcribed spacer (ITS) and D2-D3 expansion region of 28S ribosomal RNA (rRNA) sequences the specimens were identified as Helicotylenchus microlobus. Phylogenetic analysis with the rRNA sequences of the ITS and 28S D2-D3 regions was consistent with molecular identification, suggesting this population formed a highly supported clade with other H. microlobus populations. Additionally, a method for culture of H. microlobus on carrot disks was established, and the effect of temperature on the reproduction rate (Rr) of H. microlobus was investigated. The optimum temperature for culturing H. microlobus on carrot disks was 27.5 °C and, after inoculation with 30 females of H. microlobus at 27.5 °C for 90 days, Rr reached 406. CONCLUSIONS: To our knowledge, this is the first detailed description of H. microlobus from tomato in China. This study also demonstrated that the carrot disk method is suitable for the culture of H. microlobus. This study lays a foundation for other related research on H. microlobus, and has significance for the study of Helicotylenchus.

Andrade-Oliveira Salvianolic Acid B Modulates Caspase-1-Mediated Pyroptosis in Renal Ischemia-Reperfusion Injury via Nrf2 Pathway.

Acute kidney injury (AKI) is a serious disease characterized by a rapid decline in kidney function. Oxidative stress is the primary pathogenesis of AKI. Salvianolic acid B (SalB), a water-soluble compound extracted from Salvia miltiorrhiza, possesses a potent antioxidant activity. Here, we investigated the protective effect of SalB against renal ischemia-reperfusion injury (I/R) in mice. Briefly, by analyzing renal function, oxidative stress markers and inflammatory biomarkers, we found that SalB could improve kidney damage, reduce oxidative stress and inflammatory factor levels. Interestingly, the expression of the NLR family pyrin domain-containing 3 (NLRP3), caspase-1, pyroptosis related proteins gasdermin D (GSDMD) and interleukin (IL)-1ß, which were significantly upregulated in the kidney tissues of I/R group, was effectively reversed by SalB. Meanwhile, renal tubular epithelial cells hypoxia and reoxygenation model was used to explore pyroptosis of caspase-1-dependent. Further mechanism study showed that the SalB pretreatment could promote the increase of nuclear factor erythroid-2 related factor 2 (Nrf2) nuclear accumulation, which significantly suppressed oxidative stress, proinflammatory cytokines, NLRP3 inflammasome activation and pyroptosis. These results indicate that SalB can inhibit caspase-1/GSDMD-mediated pyroptosis by activating Nrf2/NLRP3 signaling pathway, resulting in alleviating I/R injury in mice.

Occurrence of Pratylenchus coffeae Causing Root Rot of Soybean in Shandong Province of China.

Soybean (Glycine max L.) is a very important commercial crop in China (Li et al. 2019). Pratylenchus coffeae (Zimmermann, 1898) Filipjev & Schuurmans Stekhoven, 1941, is one of the most important root-lesion nematodes that invade the roots of many crops. In August 2018, five root and soil samples were collected in a soybean field, near Xipan village in Linshu county of Linyi City, Shandong Province, China (Fig. S1), to investigate the occurrence of root-lesion nematodes. The collected plants (cv. Lindou No.10) were growing poorly and the roots showed distinct brown lesions (Fig. S2). Pratylenchus spp. were extracted using the modified Baermann funnel method for 2 days (Hooper et al. 2005). On average, 395 root-lesion nematodes per kg of soil and 36 root-lesion nematodes per gram of fresh roots were extracted. The extracted root-lesion nematodes were disinfected with 0.3% streptomycin sulfate and cultured on carrot disks for propagation at 25°C. The species identification was based on morphological and molecular criteria. Key morphological features were determined for females and males. Measurements of females (n = 16) included body length = 561.0 µm ± 37.6 (standard deviation) (520.5 to 654.0 µm), tail length = 30.0 µm ± 1.9 (27.0 to 33.5 µm), stylet = 16.0 µm ± 0.6 (15.0 to 17.5 µm), a = 28.2 ± 2.3 (23.7 to 31.5), b = 6.4 ± 0.5 (5.7 to 7.3), c = 18.7 ± 1.8 (15.7 to 23.8), and V = 80.8% ± 2.1 (76.5 to 83.8%). Measurements of males (n = 16): body length = 511.0 µm ± 28.1 (range= 475.5 to 566.0 µm), tail length = 26.0 µm ± 1.3 (23.5 to 28.5 µm), stylet = 15.0 µm ± 0.5 (14.5 to 16.0 µm), spicule length = 17.0 µm ± 0.9 (16.0 to 18.5 µm), a = 30.8 ± 1.5 (28.0 to 33.2), b = 6.1 ±0.4 (5.6 to 6.9), and c = 19.8 ± 1.3 (18.1 to 22.2) (Fig. S3). All the morphological features of this population matched the description of P. coffeae (Castillo and Vovlas, 2007). DNA was extracted from an individual female as described previously (Wang et al. 2011). The rDNA-internal transcribed spacer (ITS) region and the D2/D3 region of the 28S rRNA gene were amplified by primers 18S/26S (Vrain et al. 1992) and D2A/D3B (De Ley et al. 1999), respectively. The PCR products were purified and sequenced. The obtained sequences of the ITS region (1,253 bp) and the D2/D3 region of 28S rRNA (781 bp) were deposited in GenBank. The ITS sequences of the root-lesion nematode obtained in this study (GenBank Accession no. MT879294) exhibited 99% identity with several P. coffeae sequences available in the GenBank (e.g., KR106219, MT586756, KY424205, and MN749379), and the obtained D2/D3 region sequence (MT879295) exhibited 100% identity with several P. coffeae sequences (e.g., MT586754, MN750755, MK829009, and MH730447). Both morphological and molecular data confirmed the presence of P. coffeae. To confirm reproduction on soybean, the obtained root-lesion nematode population was used in a greenhouse (25°C) assay to fulfill modified Koch's postulates. About 20 days after sowing, eight pots, each with one soybean plant (Lindou No.10) were inoculated with 1000 P. coffeae. The inoculated plants were kept in 1.5 L pots containing 1.2 L sterilized soil. Eight pots of uninoculated soybeans were used as the control. Ten weeks later, the inoculated roots were washed and brown lesions were observed. The number of nematodes/pot was approximately 7360 in soil and 796 in roots, and the reproduction factor was 8.16. Root-lesion nematodes and symptoms were not observed in control groups. P. coffeae has only been reported on soybean in Zhejiang (Wei et al. 2013) and Henan Province (Li et al. 2019) of China. To our knowledge, this is the first report of P. coffeae infecting soybean in Shandong Province, China. Since the root-lesion nematode can cause considerable damage to soybean, care should be taken to prevent the spread of P. coffeae to other regions in China.