Microbial Community Succession Associated with Poplar Wood Discoloration.

Microbes are common inhabitants of wood, but little is known about the relationship between microbial community dynamics during wood discoloration. This study uses simulation experiments to examine the changes in the microbial communities in poplar wood at different succession stages. The composition and structure of the microbial communities changed significantly in different successional stages, with an overarching pattern of bacterial diversity decreasing and fungal diversity increasing from the early to the late successional stages. Nevertheless, succession did not affect the composition of the microbial communities at the phylum level: Proteobacteria and Acidobacteria dominated the bacterial communities, while Ascomycota and Basidiomycota dominated the fungal communities. However, at the genus level, bacterial populations of Sphingomonas and Methylobacterium, and fungal populations of Sphaeropsis were significantly more prevalent in later successional stages. Stochastic assembly processes were dominant in the early successional stages for bacteria and fungi. However, variable selection played a more critical role in the assembly processes as succession proceeded, with bacterial communities evolving towards more deterministic processes and fungal communities towards more stochastic processes. Altogether, our results suggest that bacteria and fungi exhibit different ecological strategies in poplar wood. Understanding those strategies, the resulting changes in community structures over time, and the relationship to the different stages of poplar discoloration, is vital to the biological control of that discoloration.

Xinfangfangia soli gen. nov., sp. nov., isolated from a diuron-polluted soil.

A novel Gram-staining-negative, non-motile and rod-shaped bacterial strain ZQBWT, which was isolated from a diuron-polluted soil collected near Nanjing, PR China, was investigated for its taxonomic position by a polyphasic approach. ZQBWT grew well at pH 6.0-12.0 (optimum, pH 7.0), 26-35 °C (optimum, 30 °C) and up to 0.5 % NaCl (optimally the absence of NaCl) in R2A broth. The major fatty acids of ZQBWT were C18 : 1ω7c (82.7 %) and C18 : 0 (5.3 %). The polar lipid profile included the major compounds phophatidylcholine, phosphatidylglycerol and phosphatidylmethylethanolamine. The only respiratory quinone was ubiquinone Q-10. The G+C content of genomic DNA was 67.0 mol%. Comparisons with 16S rRNA gene sequences revealed that ZQBWT has the highest sequence similarities with members of the genus Tabrizicola (≤95.97 %), followed by Rhodobacter(≤95.96 %) and Falsirhodobacter(95.95 %) which all belong to the family Rhodobacteraceaein the phylum Proteobacteria. Photosynthesis genes pufLM were not found and photosynthesis pigments were not formed in ZQBWT. On the basis of the results from chemotaxonomic, phenotypic and phylogenetic analysis, ZQBWT represents a novel species of a novel genus, for which the name Xinfangfangia soli gen. nov., sp. nov. is proposed. The type strain is ZQBWT (=KCTC 62102T=CCTCC AB 2017177T).

Bioaugmentation of chlorothalonil-contaminated soil with hydrolytically or reductively dehalogenating strain and its effect on soil microbial community.

Although bioaugmentation of pollutant-contaminated sites is a great concern, there are few reports on the relationships among indigenous microbial consortia, exogenous inocula, and pollutants in a bioaugmentation process. In this study, bioaugmentation with Pseudochrobactrum sp. BSQ1 and Massilia sp. BLM18, which can hydrolytically and reductively dehalogenate chlorothalonil (TPN), respectively, was studied for its ability to remove TPN from soil; the alteration of the soil microbial community during the bioaugmentation process was investigated. The results showed that TPN (50 mg/kg) was completely removed in both bioaugmentation treatments within 35 days with half-lives of 6.8 and 9.8 days for strains BSQ1 and BLM18 respectively. In high concentration of TPN-treated soils (100 mg/kg), the bioaugmentation with strains BSQ1 and BLM18 respectively reduced 76.7% and 62.0% of TPN within 35 days. The TPN treatment significantly decreased bacterial richness and diversity and improved the growth of bacteria related to the elimination of chlorinated organic pollutants. However, little influence on soil microbial community was observed for each inoculation treatment (without TPN treatment), showing that TPN treatment is the main force for the shift in indigenous consortia. This study provides insights into the effects of halogenated fungicide application and bioaugmentation on indigenous soil microbiomes.

Microbial catabolism of chemical herbicides: Microbial resources, metabolic pathways and catabolic genes.

Chemical herbicides are widely used to control weeds and are frequently detected as contaminants in the environment. Due to their toxicity, the environmental fate of herbicides is of great concern. Microbial catabolism is considered the major pathway for the dissipation of herbicides in the environment. In recent decades, there have been an increasing number of reports on the catabolism of various herbicides by microorganisms. This review presents an overview of the recent advances in the microbial catabolism of various herbicides, including phenoxyacetic acid, chlorinated benzoic acid, diphenyl ether, tetra-substituted benzene, sulfonamide, imidazolinone, aryloxyphenoxypropionate, phenylurea, dinitroaniline, s-triazine, chloroacetanilide, organophosphorus, thiocarbamate, trazinone, triketone, pyrimidinylthiobenzoate, benzonitrile, isoxazole and bipyridinium herbicides. This review highlights the microbial resources that are capable of catabolizing these herbicides and the mechanisms involved in the catabolism. Furthermore, the application of herbicide-degrading strains to clean up herbicide-contaminated sites and the construction of genetically modified herbicide-resistant crops are discussed.

Emticicia soli sp. nov., a novel member of the family 'Flexibacteraceae', isolated from tetrabromobisphenol A-contaminated soil.

Bacterial strain ZZ-4T, a Gram-stain-negative, aerobic, non-spore-forming, non-motile, non-flagellated, rod-shaped bacterium, was isolated from tetrabromobisphenol A-contaminated soil in PR China. The taxonomic position of this strain was investigated using a polyphasic approach. Phylogenetic analysis based on 16S rRNA gene sequences revealed that strain ZZ-4T was a member of the genus Emticicia and showed the highest sequence similarity to Emticicia fontis IMCC1731T (98.0 %) and Emticicia ginsengisoli Gsoil 085T (97.2 %), and lower (<97 %) sequence similarity to other known Emticicia species. Chemotaxonomic analysis revealed that strain ZZ-4T possessed menaquinone MK-7 as the major isoprenoid quinone; and iso-C15 : 0, summed feature 3 (C16 : 1ω6c and/or C16 : 1ω7), iso-C17 : 0 3-OH and C16 : 1ω5c were the predominant fatty acids. Strain ZZ-4T showed low DNA-DNA relatedness with E. fontis IMCC1731T (39.8±3.1 %) and E. ginsengisoli Gsoil 085T (44.51±1.5 %). The DNA G+C content was 38.3 mol%. Based on the phylogenetic and phenotypic characteristics, chemotaxonomic data and DNA-DNA hybridization results, strain ZZ-4T is considered to represent a novel species of the genus Emticicia, for which the name Emticicia soli sp. nov. is proposed. The type strain is ZZ-4T (=KCTC 52344T=CCTCC AB 2016137T).

Terrimonas suqianensis sp. nov., isolated from a tetrabromobisphenol A-contaminated soil.

Strain C3-5T, a Gram-negative, asporogenous, rod-shaped bacterium, was isolated from a tetrabromobisphenol A contaminated soil. Growth was observed at 10-37 °C (optimum 30 °C) and at pH 5.5-9.5 (optimum pH 7.0). Phylogenetic analysis based on 16S rRNA gene sequences revealed that strain C3-5T is a member of the genus Terrimonas and exhibits high sequence similarities with Terrimonas pekingensis QHT (99.0%) and Terrimonas rhizosphaerae CR94T (97.3%), and exhibits low (<97%) sequence similarities with other known Terrimonas species. Chemotaxonomic analysis revealed that strain C3-5T possesses menaquinone-7 (MK-7) as the major isoprenoid quinone and iso-C15:0, iso-C15:1 G, iso-C17:0 3-OH and summed feature 3 (C16:1 ω6c and/or C16:1 ω7c) as the major (>5% of total) fatty acids. The polar lipids were determined to be a lipid, glycolipid, phospholipid, phosphoaminolipid and phosphatidylethanolamine. The DNA G+C content was found to be 42.6 mol%. The DNA-DNA relatedness values with the closely related strains T. pekingensis QHT and T. rhizosphaerae CR94T were 25.2 and 48.5%, respectively. Based on phylogenetic analysis, phenotypic characteristics and chemotaxonomic data, strain C3-5T is considered to represent a novel species of the genus Terrimonas, for which the name Terrimonas suqianensis sp. nov. is proposed. The type strain is C3-5T (= CCTCC AB 2017042T = KCTC 52676T).

Identification and characterization of a novel carboxylesterase (FpbH) that hydrolyzes aryloxyphenoxypropionate herbicides.

OBJECTIVE: To identify and characterize a novel aryloxyphenoxypropionate (AOPP) herbicide-hydrolyzing carboxylesterase from Aquamicrobium sp. FPB-1. RESULTS: A carboxylesterase gene, fpbH, was cloned from Aquamicrobium sp. FPB-1. The gene is 798 bp long and encodes a protein of 265 amino acids. FpbH is smaller than previously reported AOPP herbicide-hydrolyzing carboxylesterases and shares only 21-35% sequence identity with them. FpbH was expressed in Escherichia coli BL21(DE3) and the product was purified by Ni-NTA affinity chromatography. The purified FpbH hydrolyzed a wide range of AOPP herbicides with catalytic efficiency in the order: haloxyfop-P-methyl > diclofop-methyl > fenoxaprop-P-ethyl > quizalofop-P-ethyl > fluazifop-P-butyl > cyhalofop-butyl. The optimal temperature and pH for FpbH activity were 37 °C and 7, respectively. CONCLUSIONS: FpbH is a novel AOPP herbicide-hydrolyzing carboxylesterase; it is a good candidate for mechanistic study of AOPP herbicide-hydrolyzing carboxylesterases and for bioremediation of AOPP herbicide-contaminated environments.

Biodegradation of the Herbicide 2,4-Dichlorophenoxyacetic Acid by a New Isolated Strain of Achromobacter sp. LZ35.

In this study, a bacterial strain of Achromobacter sp. LZ35, which was capable of utilizing 2,4-dichlorophenoxyacetic acid (2,4-D) and 2-methyl-4-chlorophenoxy acetic acid (MCPA) as the sole sources of carbon and energy for growth, was isolated from the soil in a disused pesticide factory in Suzhou, China. The optimal 2,4-D degradation by strain LZ35 occurred at 30 °C and pH 8.0 when the initial 2,4-D concentration was 200 mg L-1. Strain LZ35 harbored the conserved 2,4-D/alpha-ketoglutarate dioxygenase (96%) and 2,4-dichlorophenol hydroxylase (99%), and catabolized 2,4-D via the intermediate 2,4-dichlorophenol. The inoculation of 7.8 × 106 CFU g-1 soil of strain LZ35 cells to 2,4-D-contaminated soil could efficiently remove over 75 and 90% of 100 and 50 mg L-1 2,4-D in 12 days and significantly released the phytotoxicity of maize caused by the 2,4-D residue. This is the first report of an Achromobacter sp. strain that was capable of mineralizing both 2,4-D and MCPA. This study provides us a promising candidate for its application in the bioremediation of 2,4-D- or MCPA-contaminated sites.

Aquamicrobium soli sp. nov., a bacterium isolated from a chlorobenzoate-contaminated soil.

An aerobic, Gram-stain negative, short rod-shaped, asporogenous, non-motile bacterium designated strain NK8T was isolated from a chlorobenzoate contaminated soil in China. Strain NK8T was observed to grow optimally at pH 7.0, 30 °C and in the absence of NaCl in LB medium. The G + C content of the total DNA of strain NK8T was found to be 65.5 mol%. The 16S rRNA gene sequence of strain NK8T showed high similarity to that of Aquamicrobium aerolatum Sa14T (97.3%), followed by Aquamicrobium lusatiense S1T (96.7%) and Mesorhizobium sangali SCAU7T (96.6%). The DNA-DNA relatedness between strain NK8T and A. aerolatum Sa14T was 35.5 ± 0.9%. The major fatty acids of strain NK8T were determined to be C19:0 cyclo ω8c (45.6%), C18:1 ω7c (33.4%) and C16:0 (8.4%). The respiratory quinone was found to be ubiquinone Q-10. The major polyamine was found to be spermidine. The polar lipid profile include the major compounds phosphatidylcholine and diphosphatidylglycerol, and moderate amounts of phosphatidylethanolamine, phosphatidylmonomethylethanolamine, aminolipid and phospholipid. Based on the differential biochemical and physiological characteristics, the geno-, chemo- and phenotypic characteristics, strain NK8T is proposed to represent a novel species of the genus Aquamicrobium, Aquamicrobium soli sp. nov. The type strain is NK8T (=KCTC 52165T=CCTCC AB2016045T).

Haoranjiania flava gen. nov., sp. nov., a new member of the family Chitinophagaceae, isolated from activated sludge.

A novel Gram-stain-negative, non-spore-forming and short rod-shaped bacterium, strain LIP-5T, isolated from an activated sludge in a pesticide factory in Xinyi, China, was investigated for its taxonomic position by a polyphasic approach. Cell growth occurred at 16-42 °C (optimum, 30 °C), in the presence of 0-3.0 % (w/v) NaCl (optimum, without NaCl) and at pH 6.0-9.0 (optimum, pH 7.0). Phylogenetic analysis based on 16S rRNA gene sequence comparisons showed that the isolate was a member of the family Chitinophagaceae, with the closest relatives being Arachidicoccus rhizosphaerae Vu-144T (93.5 % similarity), followed by Heliimonas saccharivorans L2-4T (90.5 %) and Chitinophaga ginsengisoli Gsoil 052T (89.6 %). Menaquinone 7 (MK-7) was the predominant respiratory ubiquinone and phosphatidylethanolamine and unidentified lipids were the major polar lipids. The major cellular fatty acids of strain LIP-5T were anteiso-C15 : 0 and iso-C15 : 0, and there were also moderate amounts of iso-C17 : 0 3-OH and C17 : 0 2-OH. The DNA G+C content was 42.3 mol%. On the basis of phenotypic, chemotaxonomic and phylogenetic data, strain LIP-5T was classified as representing a novel species of a new genus, for which the name Haoranjiania flava gen. nov., sp. nov. is proposed. The type strain of Haoranjiania flava is LIP-5T (=CCTCC AB 2015365T=KCTC 42956T).

Huakuichenia soli gen. nov., sp. nov., a new member of the family Microbacteriaceae, isolated from contaminated soil.

A novel Gram-stain-positive, non-motile, rod-shaped bacterial strain designated LIP-1T was isolated from the contaminated soil of a pesticide factory in Xinyi, China, was investigated for its taxonomic allocation by a polyphasic approach. Cell growth occurred at 16-37 °C (optimum, 30 °C), in the presence of 0-2.0 % (w/v) NaCl (optimum, 0 %) and at pH 6.0-9.0 (optimum, pH 7.0). The major fatty acids of strain LIP-1T were anteiso-C15 : 0 (50.8 %), iso-C16 : 0 (17.6 %) and anteiso-C17 : 0 (17.4 %). The cell-wall peptidoglycan type was B2δ with 2,4-diaminobutyric acid as the diagnostic diamino acid. The major polar lipids were diphosphatidylglycerol and two unidentified glycolipids. The major menaquinones were MK-12 and MK-11. The genomic DNA G+C content was approximately 63.8 mol%. Phylogenetic analysis based on 16S rRNA gene sequences showed that strain LIP-1T formed a distinct clade within the radiation of the family Microbacteriaceae and had the highest sequence similarity with Microbacterium ginsengisoli Gsoil 259T (96.01 %) followed by Cryobacterium arcticum SK1T (94.94 %). On the basis of the phylogenetic analyses and distinct phenotypic characteristics, a new genus, namely Huakuichenia gen. nov., is proposed, harbouring the novel species Huakuichenia soli gen. nov., sp. nov. with the type strain LIP-1T (=CCTCC AB 2015422T=KCTC 39698T).

Comparative genomic analysis of isoproturon-mineralizing sphingomonads reveals the isoproturon catabolic mechanism.

The worldwide use of the phenylurea herbicide, isoproturon (IPU), has resulted in considerable concern about its environmental fate. Although many microbial metabolites of IPU are known and IPU-mineralizing bacteria have been isolated, the molecular mechanism of IPU catabolism has not been elucidated yet. In this study, complete genes that encode the conserved IPU catabolic pathway were revealed, based on comparative analysis of the genomes of three IPU-mineralizing sphingomonads and subsequent experimental validation. The complete genes included a novel hydrolase gene ddhA, which is responsible for the cleavage of the urea side chain of the IPU demethylated products; a distinct aniline dioxygenase gene cluster adoQTA1A2BR, which has a broad substrate range; and an inducible catechol meta-cleavage pathway gene cluster adoXEGKLIJC. Furthermore, the initial mono-N-demethylation genes pdmAB were further confirmed to be involved in the successive N-demethylation of the IPU mono-N-demethylated product. These IPU-catabolic genes were organized into four transcription units and distributed on three plasmids. They were flanked by multiple mobile genetic elements and highly conserved among IPU-mineralizing sphingomonads. The elucidation of the molecular mechanism of IPU catabolism will enhance our understanding of the microbial mineralization of IPU and provide insights into the evolutionary scenario of the conserved IPU-catabolic pathway.

Degradation of monocrotophos by Starkeya novella YW6 isolated from paddy soil.

A bacteria strain, YW6, capable of utilizing monocrotophos (MCP) as the sole carbon and nitrogen sources for growth was isolated from paddy soil and identified as Starkeya novella. Strain YW6 completely degraded 0.2 mM MCP within 36 h without any lag period. Addition of carbon source resulted in slowing down of the initial rate of degradation of MCP, while the presence of a more favorable source of nitrogen enhanced the degradation of MCP. In addition to the degradation of MCP, strain YW6 was also able to degrade a wide range of organophosphorus pesticides (OPs) containing P-O-C bond, but not dimethoate, which has P-S-C bond. A MCP degradation pathway was proposed on the basis of metabolite production patterns and identification of the metabolites. MCP is hydrolyzed at the P-O-C bond to form N-methylacetoacetamide and dimethyl phosphate; N-methylacetoacetamide is transformed to N-methyl-4-oxo-pentanamide, which was subsequently converted to 5-(methylamino)-5-oxo-pentanoic acid, and 5-(methylamino)-5-oxo-pentanoic acid is cleaved to glutaric acid and methylamine. These findings provide new insights into the microbial metabolism of MCP. To the best of our knowledge, this is the first report on the degradation of MCP by Starkeya bacteria.

Comparison of Four Comamonas Catabolic Plasmids Reveals the Evolution of pBHB To Catabolize Haloaromatics.

Comamonas plasmids play important roles in shaping the phenotypes of their hosts and the adaptation of these hosts to changing environments, and understanding the evolutionary strategy of these plasmids is thus of great concern. In this study, the sequence of the 119-kb 3,5-dibromo-4-hydroxybenzonitrile-catabolizing plasmid pBHB from Comamonas sp. strain 7D-2 was studied and compared with those of three other Comamonas haloaromatic catabolic plasmids. Incompatibility group determination based on a phylogenetic analysis of 24 backbone gene proteins, as well as TrfA, revealed that these four plasmids all belong to the IncP-1ß subgroup. Comparison of the four plasmids revealed a conserved backbone region and diverse genetic-load regions. The four plasmids share a core genome consisting of 40 genes (>50% similarities) and contain 12 to 50 unique genes each, most of which are xenobiotic-catabolic genes. Two functional reductive dehalogenase gene clusters are specifically located on pBHB, showing distinctive evolution of pBHB for haloaromatics. The higher catabolic ability of the bhbA2B2 cluster than the bhbAB cluster may be due to the transcription levels and the character of the dehalogenase gene itself rather than that of its extracytoplasmic binding receptor gene. The plasmid pBHB is riddled with transposons and insertion sequence (IS) elements, and ISs play important roles in the evolution of pBHB. The analysis of the origin of the bhb genes on pBHB suggested that these accessory genes evolved independently. Our work provides insights into the evolutionary strategies of Comamonas plasmids, especially into the adaptation mechanism employed by pBHB for haloaromatics.

Devosia honganensis sp. nov., isolated from the soil of a chemical factory.

A Gram-negative, strictly aerobic, yellow-pigmented and rod-shaped bacterium, designated strain NSL10(T), was isolated from the waste surface soil of a chemical factory in Hongan, China. Strain NSL10(T) was found to grow optimally at pH 7.0, 30 °C and in the absence of NaCl in modified LB medium. Cells were found to be positive for catalase and oxidase. The G+C content of the total DNA was determined to be 66.8 mol%. The 16S rRNA gene sequence of strain NSL10(T) showed the highest similarity to that of Devosia albogilva IPL15(T) (96.80 %), followed by Devosia geojensis BD-c194(T) (96.46 %) and Devosia chinhatensis IPL18(T) (96.27 %). The major cellular fatty acids of strain NSL10(T) were identified as C18:1 ω7c/C18:1 ω6c (48.2 %) and C16:0 (17.7 %). The major polar lipids were identified as diphosphatidylglycerol, phosphatidylglycerol, two unidentified glycolipids and an unidentified compound. Minor amounts of unidentified glycolipids and unidentified polar lipids were also detected. These chemotaxonomic data supported the affiliation of strain NSL10(T) to the genus Devosia. In conclusion, on the basis of biochemical, physiological characteristics and molecular properties, strain NSL10(T) represents a novel species within the genus Devosia, for which the name Devosia honganensis sp. nov., is proposed. The type strain is NSL10(T) (=KCTC 42281(T) = ACCC 19737(T)).

Qingshengfania soli gen. nov., sp. nov., a member of the order Rhizobiales isolated from the soil of a pesticide factory.

Two Gram-stain negative, coccoid to oval-shaped, non-spore-forming bacteria (LR4T and LR4-1), isolated from the soil of a pesticide factory in Nanjing, China, were investigated for their taxonomic allocation by using a polyphasic approach. Both strains grew optimally at pH 7.0, 30 °C and in the absence of NaCl. Both strains were positive for catalase and oxidase activities. Q-10 was the predominant respiratory ubiquinone. The major polar lipids were phosphatidylmonomethylethanolamine, diphosphatidylglycerol, phosphatidylglycerol, phosphatidylcholine and two unknown aminolipids. The major fatty acids (>10 % of the total fatty acids) were C18:1ω7c/C18:1ω6c (summed feature 8) and C17:1 iso I/C17:1 anteiso B (summed feature 4). Phylogenetic analysis based on 16S rRNA gene sequence comparisons showed that the two isolates formed a distinct line within a clade containing the genera Chelatococcus, Bosea, Camelimonas, Salinarimonas, Psychroglaciecola, Microvirga, Methylobacterium, Albibacter, Hansschlegelia and Methylopila in the order Rhizobiales, with the highest 16S rRNA gene sequence similarity to Chelatococcus asaccharovorans TE2T (94.12 %), followed by Bosea thiooxidans DSM 9653T (93.25 %). Strains LR4T and LR4-1 were closely related on the basis of DNA-DNA reassociation and therefore represent a single novel species. Based on phenotypic, chemotaxonomic and phylogenetic data, strains LR4T and LR4-1 represent a novel species of a new genus in the order Rhizobiales, for which the name Qingshengfania soli gen. nov., sp. nov. is proposed. The type strain of the type species is LR4T ( = CCTCC AB 2015036T = KCTC 42463T).

PbaR, an IclR family transcriptional activator for the regulation of the 3-phenoxybenzoate 1',2'-dioxygenase gene cluster in Sphingobium wenxiniae JZ-1T.

The 3-phenoxybenzoate (3-PBA) 1',2'-dioxygenase gene cluster (pbaA1A2B cluster), which is responsible for catalyzing 3-phenoxybenzoate to 3-hydroxybenzoate and catechol, is inducibly expressed in Sphingobium wenxiniae strain JZ-1(T) by its substrate 3-PBA. In this study, we identified a transcriptional activator of the pbaA1A2B cluster, PbaR, using a DNA affinity approach. PbaR is a 253-amino-acid protein with a molecular mass of 28,000 Da. PbaR belongs to the IclR family of transcriptional regulators and shows 99% identity to a putative transcriptional regulator that is located on the carbazole-degrading plasmid pCAR3 in Sphingomonas sp. strain KA1. Gene disruption and complementation showed that PbaR was essential for transcription of the pbaA1A2B cluster in response to 3-PBA in strain JZ-1(T). However, PbaR does not regulate the reductase component gene pbaC. An electrophoretic mobility shift assay and DNase I footprinting showed that PbaR binds specifically to the 29-bp motif AATAGAAAGTCTGCCGTACGGCTATTTTT in the pbaA1A2B promoter area and that the palindromic sequence (GCCGTACGGC) within the motif is essential for PbaR binding. The binding site was located between the -10 box and the ribosome-binding site (downstream of the transcriptional start site), which is distinct from the location of the binding site in previously reported IclR family transcriptional regulators. This study reveals the regulatory mechanism for 3-PBA degradation in strain JZ-1(T), and the identification of PbaR increases the variety of regulatory models in the IclR family of transcriptional regulators.

Reductive dehalogenation of 3,5-dibromo-4-hydroxybenzoate by an aerobic strain of Delftia sp. EOB-17.

OBJECTIVES: To confirm the reductive dehalogenation ability of the aerobic strain of Delftia sp. EOB-17, finding more evidences to support the hypothesis that reductive dehalogenation may occur extensively in aerobic bacteria. RESULTS: Delftia sp. EOB-17, isolated from terrestrial soil contaminated with halogenated aromatic compounds, completely degraded 0.2 mM DBHB in 28 h and released two equivalents of bromides under aerobic conditions in the presence of sodium succinate. LC-MS analysis revealed that DBHB was transformed to 4-hydroxybenzoate via 3-bromo-4-hydroxybenzoate by successive reductive dehalogenation. Highly conserved DBHB-degrading genes, including reductive dehalogenase gene (bhbA3) and the extra-cytoplasmic binding receptor gene (bhbB3), were also found in strain EOB-17 by genome sequencing. The optimal temperature and pH for DBHB reductive dehalogenation activity are 30 °C and 8, respectively, and 0.1 mM Cd(2+), Cu(2+), Hg(2+) and Zn(2+) strongly inhibited dehalogenation activity. CONCLUSIONS: The aerobic strain of Delftia sp. EOB-17 was confirmed to reductively dehalogenate DBHB under aerobic conditions, providing another evidence to support the hypothesis that reductive dehalogenation occurs extensively in aerobic bacteria.

Camelimonas fluminis sp. nov., a cyhalothrin-degrading bacterium isolated from river water.

An aerobic, Gram-stain-negative, short rod-shaped, non-spore-forming, cyhalothrin-degrading bacterial strain, XZ2(T), was isolated from the surface water of Hanjiang River in Wuhan, China. Strain XZ2(T) grew optimally at pH 6.0, 30 °C and in the absence of NaCl. The G+C content of the total DNA was 64.1 mol%. The 16S rRNA gene sequence of strain XZ2(T) showed the highest similarity to that of Camelimonas lactis M 2040(T) (99.1%), followed by Camelimonas abortus UK34/07-5(T) (95.9%) and Chelatococcus daeguensis K106(T) (95.3%). The major cellular fatty acids of strain XZ2(T) were C19 : 0 cyclo ω8c (63.1%), C16 : 0 (15.0%) and C18 : 1ω7c/C18 : 1ω6c (summed feature 8; 8.9%). C18 : 0 3-OH was also detected as the major hydroxylated fatty acid. The respiratory quinone was ubiquinone Q-10. The polar lipid profile included the major compounds phosphatidylcholine and diphosphatidylglycerol, and moderate amounts of phosphatidylethanolamine, phosphatidylglycerol and two unidentified aminolipids. The predominant compound in the polyamine pattern was spermidine. These chemotaxonomic data supported the affiliation of strain XZ2(T) to the genus Camelimonas. The DNA-DNA hybridization value between strain XZ2(T) and Camelimonas lactis M 2040(T) was 43.5 ± 0.6%. DNA-DNA hybridization data as well as biochemical and physiological characteristics strongly supported the genotypic and phenotypic differentiations between strain XZ2(T) and Camelimonas lactis M 2040(T). Therefore, strain XZ2(T) represents a novel species of the genus Camelimonas, for which the name Camelimonas fluminis sp. nov. is proposed. The type strain is XZ2(T) ( = KCTC 42282(T) = ACCC 19738(T)).

Sphingomonas chloroacetimidivorans sp. nov., a chloroacetamide herbicide-degrading bacterium isolated from activated sludge.

Strain Y1(T), a Gram-negative, non-spore-forming, rod-shaped bacterium, was isolated from activated sludge. This strain is able to degrade several commonly used chloroacetamide herbicides, such as butachlor, acetochlor and alachlor. Phylogenetic analysis based on 16S rRNA gene sequences revealed that strain Y1(T) is a member of the genus Sphingomonas and shows high sequence similarities with S. starnbergensis 382(T) (95.7 %), S. sanxanigenens NX02(T) (95.7 %) and S. haloaromaticamans A175(T) (95.3 %), and shows low (<95 %) sequence similarities to all other Sphingomonas species. Chemotaxonomic analysis revealed that strain Y1(T) possesses Q-10 as the predominant ubiquinone, C14:0 2-OH as the major 2-hydroxy fatty acid and sym-homospermidine as the major polyamine. The main cellular fatty acids of strain Y1(T) were found to be C18:1 ω7c (38.2 %), C16:1 ω6c/C16:1 ω7c (28.5 %), C16: 0 (10.7 %) and C14:0 2-OH (14.3 %). The main polar lipids were determined to be diphosphatidylglycerol, phosphatidylglycerol, phosphatidylethanolamine, sphingoglycolipids (SGL1-SGL3), phosphatidyl dimethylethanolamine and aminophospholipid. The DNA G+C content was found to be 66 ± 0.4 mol%. Based on phylogenetic analysis, phenotypic characteristics and chemotaxonomic data, strain Y1(T) is considered to represent a novel species of the genus Sphingomonas, for which the name Sphingomonas chloroacetimidivorans sp. nov. is proposed. The type strain is Y1(T) (=CCTCC AB 2011178(T) = KACC 16607(T)).