Abnormal hemoglobin anti-Lepore Hong Kong compound with ß0-thalassemia ameliorate thalassemia severity when co-inherited with α-thalassemia.

Abnormal hemoglobin anti-Lepore Hong Kong is a rare ßδ fusion variants resulting from non-homologous crossover during meiosis. Anti-Lepore Hong Kong is known to consistently exhibit significantly increased level of HbA2. In this study, we used multiplex ligation-dependent probe amplification (MLPA) and single molecular real-time (SMRT) sequencing, as well as Sanger sequencing, to identify variants in five unrelated families with abnormal elevated HbA2 level. All probands in these five families were found to be heterozygous for anti-Lepore Hong Kong. Among them, two families showed co-occurrence of ß0-thalassemia and α-thalassemia (-SEA/ or αCSα/). Heterozygotes for anti-Lepore Hong Kong displayed an average HbA2 level of 17.7% and behaved normal. However, when combined with ß0-thalassemia and α-thalassemia, the probands exhibited higher HbA2 level (30.2-40.8%) and behaved with ß-thalassemia trait. Furthermore, determination of the α/ß-mRNA ratio revealed a slight downregulation of ß-globin, similar to that of ß-thalassemia minor. Our study is the first to identify compound heterozygotes for anti-Lepore Hong Kong, ß0-thalassemia and α-thalassemia, provide valuable information for prenatal counseling.

Two novel deletion mutations in ß-globin gene cause ß-thalassemia trait in two Chinese families.

BACKGROUND: ß-Thalassemia is mainly caused by point mutations in the ß-globin gene cluster. With the rapid development of sequencing technic, more and more variants are being discovered. RESULTS: In this study, we found two novel deletion mutations in two unrelated families, HBB: c.180delG (termed ßCD59) and HBB: c.382_402delCAGGCTGCCTATCAGAAAGTG (termed ßCD128-134) in family A and B, respectively. Both the two novel mutations lead to ß-thalassemia trait. However, when compounded with other ß0-thalassemia, it may behave with ß-thalassemia intermedia or ß-thalassemia major. CONCLUSION: Our study broadens the variants spectral of ß-thalassemia in Chinese population and provides theoretical guidance for the prenatal diagnosis.

Identification of four novel large deletions and complex variants in the α-globin locus in Chinese population.

BACKGROUND: At present, the methods generally used to detect α-thalassemia mutations are confined to detecting common mutations, which may lead to misdiagnosis or missed diagnosis. The single-molecule real-time (SMRT) sequencing enables long-read single-molecule sequencing with high detection accuracy, and long-length DNA chain reads in high-fidelity read mode. This study aimed to identify novel large deletions and complex variants in the α-globin locus in Chinese population. METHODS: We used SMRT sequencing to detect rare and complex variants in the α-globin locus in four individuals whose hematological data indicated microcytic hypochromic anemia. However, the conventional thalassemia detection result was negative. Multiplex ligation-dependent probe amplification and droplet digital polymerase chain reaction were used to confirm SMRT sequencing results. RESULTS: Four novel large deletions were observed ranging from 23 to 81 kb in the α-globin locus. One patient also had a duplication of upstream of HBZ in the deletional region, while another, with a 27.31-kb deletion on chromosome 16 (hg 38), had abnormal hemoglobin Siriraj (Hb Siriraj). CONCLUSION: We first identified the four novel deletions in the α-globin locus using SMRT sequencing. Considering that the conventional methods might lead to misdiagnosis or missed diagnosis, SMRT sequencing proved to be an excellent method to discover rare and complex variants in thalassemia, especially in prenatal diagnosis.

The Size-Dependent Photonic Characteristics of Colloidal-Quantum-Dot-Enhanced Micro-LEDs.

Colloidal CdSe/ZnS quantum dots (QD) enhanced micro-LEDs with sizes varying from 10 to 100 µm were fabricated and measured. The direct photolithography of quantum-dot-contained photoresists can place this color conversion layer on the top of an InGaN-based micro-LED and have a high throughput and semiconductor-grade precision. Both the uncoated and coated devices were characterized, and we determined that much higher brightness of a QD-enhanced micro-LED under the same current level was observed when compared to its AlGaInP counterpart. The color stability across the device sizes and injection currents were also examined. QD LEDs show low redshift of emission wavelength, which was recorded within 1 nm in some devices, with increasing current density from 1 to 300 A/cm2. On the other hand, the light conversion efficiency (LCE) of QD-enhanced micro-LEDs was detected to decrease under the high current density or when the device is small. The angular intensities of QD-enhanced micro-LEDs were measured and compared with blue devices. With the help of the black matrix and omnidirectional light emission of colloidal QD, we observed that the angular intensities of the red and blue colors are close to Lambertian distribution, which can lead to a low color shift in all angles. From our study, the QD-enhanced micro-LEDs can effectively increase the brightness, the color stability, and the angular color match, and thus play a promising role in future micro-display technology.

The -α3.7III subtype of α+-thalassemia was identified in China.

OBJECTIVE: The 3.7 kb deletion (-α3.7) in the α-globin cluster, which characterizes α+-thalassemia, has been reported to have a carrier rate of 4.78% in southern China. Three -α3.7 subtypes have been identified worldwide. However, the -α3.7 III subtype has not previously been identified in China. Herein, we reported identification of the -α3.7 III subtype in a Chinese patient. METHODS: We used gap-PCR and a liquid chip system to detect α-thalassemia mutations. Multiple ligation-dependent probe amplification was performed to detect the large deletion. We finally used Sanger sequencing and single molecule real-time sequencing to characterize and confirm the genotype. RESULTS: The proband, characterized as -α3.7 III heterozygous, showed microcytosis and hypochromic red cells, with a mean corpuscular volume of 78 fL and mean corpuscular hemoglobin of 25.4 pg. The proband's mutation was inherited from her father, who had normal blood parameters. CONCLUSION: We first identified the -α3.7 III subtype in China. Consequently, all -α3.7 subtypes have now been identified in the Chinese population. Therefore, attention should be paid to -α3.7 III in clinical prenatal diagnosis, given that commonly used methods such as gap-PCR may lead to misdiagnosis or missed diagnosis.

RGB Arrays for Micro-Light-Emitting Diode Applications Using Nanoporous GaN Embedded with Quantum Dots.

The multiple light scattering of nanoporous (NP) GaN was systematically studied and applied to the color down-conversion for micro-light-emitting diode (LED) display applications. The transport mean free path (TMFP) in NP GaN is 660 nm at 450 nm (light wavelength), and it decreases with a decreasing wavelength. It was observed that the short TMFP of the NP GaN increased the light extinction coefficient at 370 nm by 11 times. Colloidal QDs were loaded into a half 4″ wafer scale NP GaN, and 96 and 100% of light conversion efficiencies for green and red were achieved, respectively. By loading green and red QDs selectively into NP GaN mesas, we demonstrated the RGB microarrays based on the blue-violet pumping light with green and red color converting regions.

Identification of copy number alterations by array comparative genomic hybridization in patients with late chronic or accelerated phase chronic myeloid leukemia treated with imatinib mesylate.

The outcome of treating chronic myeloid leukemia (CML) with imatinib mesylate (IM) is inferior when therapy is commenced in late chronic or accelerated phase as compared to early chronic phase. This may be attributed to additional genomic alterations that accumulate during disease progression. We sought to identify such lesions in patients showing suboptimal response to IM by performing array-CGH analysis on 39 sequential samples from 15 CML patients. Seventy-four cumulative copy number alterations (CNAs) consisting of 35 losses and 39 gains were identified. Alterations flanking the ABL1 and BCR genes on chromosomes 9 and 22, respectively, were the most common identified lesions with 5 patients losing variable portions of 9q34.11 proximal to ABL1. Losses involving 1p36, 5q31, 17q25, Y and gains of 3q21, 8q24, 22q11, Xp11 were among other recurrent lesions identified. Aberrations were also observed in individual patients, involving regions containing known leukemia-associated genes; CDKN2A/2B, IKZF1, RB1, TLX1, AFF4. CML patients in late stages of their disease, harbor pre-existing and evolving sub-microscopic CNAs that may influence disease progression and IM response.