Changes in Heart Rate after Pulmonary Vein Isolation in Patients with Paroxysmal Atrial Fibrillation and Sinus Bradycardia.

This study aimed to evaluate the effect of circumferential pulmonary vein isolation (CPVI) on autonomic nervous function and prognosis in patients with paroxysmal atrial fibrillation (AF) with or without sinus bradycardia.A total of 66 patients with paroxysmal AF accompanied by sinus bradycardia and who underwent CPVI were recruited as the sinus bradycardia group. A total of 91 patients with paroxysmal AF but without sinus bradycardia and who underwent catheter ablation were selected as the control group. After surgical contraindications were eliminated, CPVI was performed by three-dimensional mapping system. 24-hour dynamic electrocardiogram was used to observe the changes of heart rate before and 2 days after surgery.A total of 45 (68%) and 51 (56%) patients in the sinus bradycardia and control groups, respectively, maintained sinus rhythm. There was an increase in heart rate after CPVI in both groups. The standard deviation of normal-to-normal (NN) intervals (SDNN), standard deviation of the average NN intervals (SDANN), low frequency (LF), and LF/high frequency (HF) in the sinus bradycardia and control groups decreased after CPVI (P < 0.01). Moreover, SDANN was higher in patients with sinus bradycardia treated by successful ablation than in those with recurrence (P < 0.01), while SDNN, a standard statistical measure of heart rate variability (rMSSD), LF, and HF were significantly lower in patients with sinus bradycardia (P < 0.05).CPVI was able to produce a significant reduction effect on vagal nerve and sympathetic activity regardless of whether patients with paroxysmal AF had sinus bradycardia. Moreover, CPVI exerted a certain influence on the success rate of AF catheter ablation.

Occurrence of the Reniform Nematode Rotylenchulus reniformis on Sponge Gourd (Luffa cylindrica) in Yunnan Province, China.

Sponge gourd (Luffa cylindrica) is an important annual climbing herbaceous crop used as edible vegetable, industrial material and medicine crop. It is widely cultivated in China. In October 2019, six root and rhizosphere soil samples were collected from a field growing sponge gourd (cv. Zaoxiu 6) in Caoba Town, Mengzi City, Yunnan Province, China. Sponge gourd roots exhibited distinct brown lesions, while above-ground symptoms of plants were not observed in this field at sampling. Nematodes were extracted from soil using the modified tray method, and nematodes in root tissues were observed using the acid fuchsin method (Whitehead and Hemming 1965; Bybd et al. 1983). Reniform nematodes (Rotylenchulus) were found in all samples with population densities of 447 ± 120 nematodes/100 g of soil and 52 ± 21 nematodes/1.0 g of root. The immature females were vermiform and ventrally curved to spiral-shaped upon fixation, with a conoid and continuous lip region, slender and well-developed stylet with rounded basal knobs and oesophageal glands overlapping the intestine laterally and mostly ventrally. The tails was slightly tapering to a rounded tip with distinct hyaline tail terminus. Morphological measurements of immature females (n = 20) included body length (L) = 392.3 ± 20.4 µm (352.8 to 436.7 µm), stylet = 18.6 ± 0.5 µm (17.6 to 19.4 µm), tail length= 25.9 ± 2.2 µm (20.1 to 29.9 µm), a = 25.2 ± 1.1 (23.5 to 27.3), b = 3.2 ± 0.4 (2.6 to 4.0), c = 15.2 ± 1.2 (13.6 to 18.6), c' = 2.9 ± 0.3 (2.2 to 3.3), V = 70.3 ± 1.0 (68.5 to 72.6). The males were vermiform with poorly developed stylet and esophageal median bulb, ventrally arcuate spicule, and indistinct bursa. Measurements of males (n = 20) were L = 426.7 ± 31.0 µm (368.1 to 463.9 µm), stylet = 12.8 ± 0.8 µm (11.2 to 14.1 µm), tail length= 26.3 ± 1.8 µm (24.3 to 29.4 µm), spicule = 20.6 ± 0.9 µm (19.6 to 22.7 µm), a = 27.7 ± 2.2 (25.2 to 30.7), b = 4.5 ± 0.4 (3.9 to 4.8), c = 15.5 ±0.9 (14.7 to 16.8), c' = 2.8 ± 0.3 (2.5 to 3.2). These morphological characters were similar to those described for R. reniformis (Palomares-Rius et al. 2018). Genomic DNA was extracted from single immature females as described by Song et al. (2021). The rDNA-ITS region and D2-D3 region of the 28S rRNA gene were amplified using primers 18s/26s (TTGATTACGTCCCTGCCCTTT/TTTCACTCGCCGTTACTAAGG) and D2A/D3B (ACAAGTACCGTGAGGGAAAGTTG/TCGGAAGGAACCAGCTACTA), respectively (Vrain et al. 1992; Subbotin et al. 2006). The obtained rDNA-ITS sequence (1003 bp, GenBank accession No. MT332839) and D2-D3 region of the 28S rRNA gene sequence (787 bp, MT328542) showed more than 99% identity with several R. reniformis sequences deposited in the GenBank database (e.g., MT209977, KP018557, GU003947; KJ755184, MT225542, HM131858). In greenhouse pathogenicity tests, 12 two-leaf stage sponge gourd seedlings (cv. Zaoxiu 6) maintained in 14-cm-diameter and 12-cm-height pots with sterilized commercial soil (pH 5.5-7.0; organic matter 35%), were inoculated with 500 mixed vermiform stage nematodes of R. reniformis extracted from the infested field soil samples per plant. Eight non-inoculated seedlings were used as controls. After 60 days, all inoculated plants exhibited slight symptoms of root browning compared with the control. The nematode reproduction factor (final population/initial population) was 12.4. No nematodes and root browning were observed on control plants. R. reniformis has been reported on sponge gourd in Shanghai, Fujian, Guangdong, and Hainan provinces of China (Ding et al., 2015). To our knowledge, this is the first report of R. reniformis infecting sponge gourd in Yunnan Province, China. Yunnan Province is one of the biggest sponge gourd producing areas in China. Since R. reniformis is a highly pathogenic nematode and damages sponge gourd, control measures should be taken to avoid its spread to other regions or host crops in China.

Comparison of the levels of depression and anxiety in elderly aortic stenosis patients treated with surgical or transcatheter aortic valve replacement.

OBJECTIVE: Currently, only a few studies have been conducted on the mental status recovery in elderly aortic stenosis (AS) patients after treatment. How transcatheter aortic valve replacement (TAVR) and surgical aortic valve replacement (SAVR) differentially impinge on the mental status of elderly AS patients is completely unknown. The present prospective study aims to investigate this question by comparing the post-treatment levels of depression and anxiety, quality of life and frailty. METHODS: A total of 120 elderly patients (age above 70) with symptomatic AS were included, where 78 of them were treated with TAVR and 42 of them were treated with SAVR. Levels of depression and anxiety, quality of life and frailty were assessed by the Chinese version of Hospital Anxiety and Depression Scale (HADS), World Health Organization Quality of Life Instrument-Older Adults Module (WHOQOL-OLD) and clinical frailty scale, respectively. Scores were recorded and compared at admission, 1 month, 4 months and 8 months after treatment. RESULTS: Before treatment, both patient groups had similar baseline characteristics and all mental parameters. During the follow-up period, patients in the TAVR group demonstrated significant improvement in all assessed mental parameters to certain extent compared to the SAVR group. Specifically, frailty was significantly improved in the TAVR-treated patients at all three follow-up time points. Levels of depression and anxiety were significantly improved 8 months after treatment, although the remaining patient number is limited. Quality of life was only significantly improved 1 month after treatment. CONCLUSION: TAVR may provide a better mental recovery outcome in elderly AS patients.

First Report of Meloidogyne graminicola Naturally Infecting Cyperus difformis in China.

Cyperus difformis is a problematic annual weed in rice fields and is widely distributed throughout tropical to warm temperate regions of the world. In June 2019, many galls were observed on the roots of C. difformis growing in rice fields in Heshan District, Hengyang City, Hunan Province, China. The infected plants did not exhibit obvious aboveground symptoms. Females, males, eggs, and second-stage juveniles (J2s) of Meloidogyne spp. were found within galls after dissection. The perineal patterns of females were dorsoventrally oval shape with low and round dorsal archs, smooth striae, and lacking distinct lateral lines. Morphological measurements of females (n = 20) included body length (L) = 589.4 ± 64.7 (482.1 to 693.8) µm, body width (BW) = 362.2 ± 84.6 (267.6 to 505.9) µm, stylet = 11.7 ± 1.5 (9.7 to 14.4) µm, dorsal pharyngeal gland orifice to stylet base (DGO) = 3.8 ± 0.6 (3.3 to 5.0) µm, vulval slit length = 23.7 ± 4.4 (15.5 to 28.9) µm, vulval slit to anus distance = 16.8 ± 2.7 (13.1 to 19.4) µm. The J2s were vermiform and had a long and slender tail with tapering hyaline tail terminus. Measurements of J2s (n = 20) were L = 464.4 ± 31.7 (415.0 to 508.3) µm, BW = 16.9 ±1.7 (14.1 to 19.7) µm, stylet = 13.2 ± 0.6 (12.5 to 14.9) µm, DGO = 3.3 ± 0.5 (2.6 to 4.4) µm, tail = 71.6 ± 5.5 (65.1 to 82.0) µm, hyaline tail length = 19.4 ± 2.6 (15.3 to 23.9) µm. These morphological characteristics were similar to those previously described for M. graminicola (Golden and Birchfield 1965). Genomic DNA extracted from a single J2 was used for molecular identification. The ITS rRNA gene and the mtDNA COII-16S rRNA region were amplified using primers 18s/26s (TTGATTACGT CCCTGCCCTTT/TTTCACTCGCCGTTACTAAGG) and C2F3/1108 (GGTCAATGT TCAGAAATTTGTGG/TACCTTTGACCAATCACGCT), respectively (Powers and Harris 1993; Vrain et al. 1992). Both the ITS rRNA gene sequence (790 bp, GenBank accession no. MZ656127) and the mtDNA COII-16S rRNA region sequence (531 bp, OM161973) showed 100% identity with sequences of M. graminicola (e.g., MN647593, MG773553, MF320126; MG356945, MH332687, JN241939). Furthermore, species identification was also further validated using the M. graminicola-specific primers SCAR-MgFW/SCAR-MgRev (GGGGAAGACATTTAATTGATGATCAAC/GGTACCGAAACTTAGGGAAAG) (Bellafiore et al. 2015). The PCR products yielded the expected fragment size of 640 bp, which was identical to that previously reported for M. graminicola (Bellafiore et al. 2015). To verify the pathogenicity of this nematode, 15 30-day-old C. difformis seedlings planted in pots with sterilized soil were inoculated with 400 freshly hatched J2s from the original population of M. graminicola per plant, and five non-inoculated seedlings were used as controls. All plants were grown in a greenhouse at 26 to 28 °C with a 16 h light/8 h dark photoperiod. At 30 days after inoculation, all inoculated plants showed gall symptoms on the roots identical to those observed in the fields. The nematode reproduction factor (final population/initial population) was 12.6. No symptoms were observed on non-inoculated plants. These results confirmed the pathogenicity of M. graminicola on C. difformis. To our knowledge, this is the first report of M. graminicola naturally infecting C. difformis in China. C. difformis is an alternative host of M. graminicola and could serve as a potential reservoir for M. graminicola in field. Therefore, weed management could be an effective way to reduce the disease by eliminating source of infection of M. graminicola.

circ_0085296 inhibits the biological functions of trophoblast cells to promote the progression of preeclampsia via the miR-942-5p/THBS2 network.

Insufficient invasion of trophoblast cells is one of the important causes of preeclampsia (PE). Circular RNA (circRNA) has been proven to regulate the biological functions of trophoblast cells and mediate the progression of PE. The expression of circ_0085296, microRNA (miR)-942-5p, and thrombospondin 2 (THBS2) was detected by quantitative real-time PCR. In addition, the interaction between miR-942-5p and circ_0085296 or THBS2 was confirmed by dual-luciferase reporter assay and RIP assay. Our data showed that circ_0085296 was upregulated in the placental tissues of PE patients. Silenced circ_0085296 could enhance the proliferation, migration, invasion, and angiogenesis of HTR-8/SVneo cells. Besides, circ_0085296 was found to act as miR-942-5p sponge. Function analysis results suggested that miR-942-5p inhibitor reversed the positive regulation of circ_0085296 knockdown on the biological functions of HTR-8/SVneo cells. Moreover, THBS2 was a target of miR-942-5p, and its overexpression also reversed the promotion effect of miR-942-5p on the proliferation, migration, invasion, and angiogenesis of HTR-8/SVneo cells. Also, circ_0085296 was discovered to positively regulate THBS2 by sponging miR-942-5p. To sum up, our results revealed that circ_0085296 could inhibit trophoblast cells proliferation, migration, invasion, and angiogenesis by regulating miR-942-5p/THBS2, confirming that circ_0085296 might be a potential therapeutic target for PE.

Spinal-pelvic sagittal parameters in patients with gluteal muscle contracture: an imaging study.

Background: Gluteal muscle contracture (GMC) may cause abnormal spinal alignment as well as hip and pelvic deformities. The spine-pelvis alignment of GMC patients is unclear. This study aimed to describe the spine-pelvis sagittal alignment in patients with GMC and to explore the impact of GMC on the pathogenesis of low back pain (LBP). Methods: Radiological analysis was performed in 100 patients with GMC and 100 asymptomatic volunteers who acted as the control group. Sagittal parameters were measured by two independent raters and their averages were presented on lateral radiographs of the whole spine, including pelvic incidence (PI), sagittal vertical axis (SVA), pelvic tilt (PT), lumbar lordosis (LL), sacral slope (SS), thoracic kyphosis (TK), and the relationship between PI and LL (expressed as PI-LL). All cases were categorized into one of three classes based on the apex position of lumbar lordosis and were further divided into three groups by the PI value. The GMC and control parameters were compared and the correlations between the parameters in the GMC group were analysed. Results: The PI value of the GMC group was significantly less than that of the control group (42.38 ± 10.90° vs 45.68 ± 7.49°, P < 0.05). There was no difference found between the key parameters (SVA, PT, and PI-LL), which correlated with outcomes in adult deformity. No differences of SS were found between the two groups (P > 0.05). The GMC group showed lower average LL (42.77 ± 10.97° vs 46.41 ± 9.07°) and TK (17.34 ± 9.50° vs 20.45 ± 8.02°) compared with the control group (P < 0.05). LL was correlated with PI, SS, PT, TK (P < 0.01) and SVA (P < 0.05). TK and SVA were not correlated with any parameters except LL and pairwise correlations were found among PI, SS, and PT. There were no differences found between the distributions of the lumbar lordosis apex of GMC and the control but the range of SS in apex groups 3 and 4 did differ. GMC patients had the most small-PI value (44%) while approximately 64% of asymptomatic individuals had a normal PI. Interobserver variability was sufficient for all parameters calculated by the intraclass correlation coefficient (ICC). Conclusions: Gluteal muscle contracture causes a low PI which may contribute to low back pain. Patients with GMC present the same global sagittal spinal-pelvic balance as asymptomatic individuals due to a compensatory mechanism through excessive flat lumbar and thoracic curves. Future studies on the relationship between spinal-pelvic sagittal and coronal alignment and low back pain are needed to understand the mechanical forces involved in the onset of GMC.

Nesfatin-1 inhibits free fatty acid (FFA)-induced endothelial inflammation via Gfi1/NF-κB signaling.

Nesfatin-1 is a neuropeptide produced in the hypothalamus. It is known that Nesfatin-1 is involved in food uptake, fat storage, and other metabolic regulation. We hypothesized that Nesfatin-1 may play a role in cardiovascular tissue. Free fatty acids (FFAs) are known to be the risk factor for cardiovascular diseases. FFA-mediated endothelial dysfunction is the critical mechanism of many cardiovascular disorders. The present study explores the protective effects of Nesfatin-1 on FFA-induced endothelial inflammation and the underlying mechanism. We found that significantly increased lactate dehydrogenase release and production of inflammatory factors were observed in FFA-treated human aortic endothelial cells (HAECs), accompanied by the enhanced attachment of U937 monocytes to HAECs and upregulated cell adhesion molecule vascular cell adhesion molecule-1, which were dramatically reversed by the treatment with Nesfatin-1. In addition, the promoted level of nuclear regulator NF-κB p65 and transcriptional function of NF-κB in FFA-treated HAECs were greatly suppressed by HAECs. Growth Factor Independent 1 Transcriptional Repressor 1 (Gfi1), an important negative regulator of NF-κB activity, was significantly downregulated in HAECs by FFAs and was upregulated by Nesfatin-1. Lastly, the inhibitory effects of Nesfatin-1 against FFA-induced NF-κB activation and adhesion of U937 monocytes to HAECs were abolished by the knockdown of Gfi1. In conclusion, our data reveal that Nesfatin-1 inhibited FFA-induced endothelial inflammation mediated by the Gfi1/NF-κB signaling pathway.

Left Bundle Branch Area Pacing vs. Biventricular Pacing for Cardiac Resynchronization Therapy: A Meta-Analysis.

Background: Left bundle branch area pacing (LBBAP) is a recently proposed method for conduction system pacing. We performed a meta-analysis of controlled studies to compare the clinical outcome in patients who received LBBAP vs. biventricular pacing (BVP) for cardiac resynchronization therapy (CRT). Methods: PubMed, Embase, and Cochrane's Library databases were searched for relevant controlled studies. A random-effect model incorporating the potential heterogeneity was used to synthesize the results. Results: Four non-randomized controlled studies including 249 patients with heart failure (HF) for CRT were included, and the patients were followed for 6-12 months. Compared with BVP, LBBAP was associated with significantly shortened QRS duration [mean difference (MD): -29.18 ms, 95% confidence interval (CI): -33.55-24.80, I 2 = 0%, P < 0.001], improved left ventricular ejection fraction (MD: 6.93%, 95% CI: 4.69-9.17, I 2 = 0%, P < 0.001), reduced left ventricular end-diastolic dimension (MD: -2.96 mm, 95% CI: -5.48 to -0.44, I 2 = 0%, P = 0.02), and improved New York Heart Association class (MD: -0.54, 95% CI: -0.84 to -0.24, I 2 = 65%, P < 0.001). Moreover, patients who received LBBAP were more likely to achieve echocardiographic [odds ratio (OR): 5.04, 95% CI: 2.17-11.69, I 2 = 0%, P < 0.001] and clinical (OR: 7.33, 95% CI: 1.62-33.16, I 2 = 0%, P = 0.01) CRT responses. Conclusion: Current evidence from non-randomized studies suggests that LBBAP appears to be a promising method for CRT, which is associated with more remarkable improvements of symptoms and cardiac function in HF patients with indication for CRT.

The effect of running on knee joint cartilage: A systematic review and meta-analysis.

OBJECTIVE: Although running causes inevitable stress to the joints, data regarding its effect on the cartilage of the knee are conflicting. This systematic review and meta-analysis aimed to evaluate the effect of running on knee joint cartilage. METHODS: PubMed, EMBASE, SportDiscus, and Cochrane Library databases were searched to identify randomized controlled trials (RCTs) and cohort studies. The outcome indicators were cartilage oligomeric matrix protein (COMP), cartilage volume and thickness, and T2. RESULTS: A total of two RCTs and 13 cohort studies were included. There was no significant difference in cartilage volume between the running and control groups (MD, -115.88 U/I; 95% CI, -320.03 to 88.27; p = 0.27). However, running would decrease cartilage thickness (MD, -0.09 mm; 95%CI, -0.18 to -0.01; p = 0.03) and T2 (MD, -2.78 ms; 95% CI, -4.12 to -1.45; p < 0.001). Subgroup analysis demonstrated that COMP immediately or at 0.5 h after running was significantly increased, but there were no significant changes at 1 h or 2 h. CONCLUSIONS: Running has advantages in promoting nutrition penetrating into the cartilage as well as squeezing out the metabolic substance, such as water. Our study found that running had a short-term adverse effect on COMP and did not affect cartilage volume or thickness.