Impacts of covid-19 on college students' sports / Impactos da covid-19 sobre o esporte dos estudantes universitários / Repercusiones del covid-19 en el deporte de los estudiantes universitarios

ABSTRACT Introduction: Students have realized the importance of physical education after the epidemic of COVID-19 and have increased the demand of seeking a healthy lifestyle even during home isolation. In contrast, the current physical education system in colleges and universities does not meet the real demands of its students, demonstrating a barrier between teaching and learning. Objective: Study students' lifestyle and sports habits during the epidemic of COVID-19. Methods: An online questionnaire was conducted to investigate and analyze students' home exercise environment, lifestyle and exercise practices, and exercise psychology during COVID-19. A total of 1274 valid questionnaires were obtained. The data from the questionnaires were entered, sorted, and analyzed, and relevant figures were drawn and discussed. Results: It was noted that students mostly preferred outdoor exercise equipment and hands-free activities outside the home. This picture reversed during the COVID-19 epidemic when students preferred indoor equipment. In terms of exercise programs, an effective exercise program is needed to allow people to exercise effectively during home isolation. Conclusion: Physical education teachers in colleges and universities should select the right means of physical fitness to combine sports and sports life that can be practiced at home, according to the actual situation of students and their psychological demands. Students should be given a better sports experience during the quarantine process, stimulating them to stay positive and with good physical quality, aiming at strengthening immunity and reducing the risk of infection by COVID-19. Level of evidence II; Therapeutic studies - investigation of treatment outcomes.

RESUMO Introdução: Os estudantes perceberam a importância da educação física após a epidemia da COVID-19 e tem aumentado a demanda da busca por um estilo de vida saudável mesmo durante o período de isolamento doméstico. Em contraste, o atual sistema de educação física nas faculdades e universidades não atende às demandas reais dos seus estudantes, demonstrando uma barreira entre o ensino e a aprendizagem. Objetivo: Estudar o estilo de vida e os hábitos esportivos dos estudantes durante a epidemia da COVID-19. Métodos: Foi realizado um questionário online para investigar e analisar o ambiente de exercícios em casa, o estilo de vida e práticas de exercício, além da psicologia do exercício sobre os estudantes durante a COVID-19. Um total de 1274 questionários válidos foram obtidos. Os dados dos questionários foram inseridos, classificados e analisados, sendo as figuras relevantes desenhadas e discutidas. Resultados: Notou-se que os estudantes majoritariamente preferiam equipamentos de exercício externos e atividades com as mãos livres fora de casa. Esse quadro inverteu-se durante a epidemia da COVID-19, onde os estudantes preferiram equipamentos para uso interno. Em termos de programa de exercícios, é necessário um programa de exercícios eficaz para permitir que as pessoas façam exercícios físicos eficazes durante o isolamento doméstico. Conclusão: Os professores de educação física nas faculdades e universidades devem selecionar o meio certo de aptidão física, de modo a combinar esportes e vida esportiva que possam ser praticados em domicílio, de acordo com a situação real dos alunos e suas demandas psicológicas. Deve-se dar aos alunos uma melhor experiência esportiva durante o processo de quarentena, estimulando para que se mantenham positivos e com boa qualidade física, visando um fortalecimento da imunidade e redução do risco de infecção pela COVID-19. Nível de evidência II; Estudos terapêuticos - investigação dos resultados do tratamento.

Resumen Introducción: Los estudiantes se han dado cuenta de la importancia de la educación física después de la epidemia de COVID-19 y ha aumentado la demanda de la búsqueda de un estilo de vida saludable, incluso durante el período de aislamiento en el hogar. Por el contrario, el actual sistema de educación física en institutos y universidades no responde a las demandas reales de sus estudiantes, lo que demuestra la existencia de una barrera entre la enseñanza y el aprendizaje. Objetivo: Estudiar el estilo de vida y los hábitos deportivos de los estudiantes durante la epidemia de COVID-19. Métodos: Se realizó un cuestionario en línea para investigar y analizar el entorno de ejercicio en el hogar, el estilo de vida y las prácticas de ejercicio, y la psicología del ejercicio en los estudiantes durante COVID-19. Se obtuvo un total de 1274 cuestionarios válidos. Los datos de los cuestionarios se introdujeron, clasificaron y analizaron, y se extrajeron y discutieron las cifras pertinentes. Resultados: Se observó que los estudiantes preferían sobre todo aparatos de ejercicio externos y actividades de manos libres fuera de casa. Este panorama se invirtió durante la epidemia COVID-19, en la que los alumnos prefirieron los equipos de interior. En cuanto al programa de ejercicios, se necesita un programa de ejercicios eficaz para que las personas puedan hacer ejercicio de forma efectiva durante el aislamiento domiciliario. Conclusión: Los profesores de educación física de los institutos y universidades deben seleccionar los medios adecuados para combinar el deporte y la vida deportiva que puedan practicarse en casa de acuerdo con la situación real de los alumnos y sus exigencias psicológicas. Se debe proporcionar a los estudiantes una mejor experiencia deportiva durante el proceso de cuarentena, estimulándolos a mantenerse positivos y con buena calidad física, con el objetivo de fortalecer la inmunidad y reducir el riesgo de infección por COVID-19. Nivel de evidencia II; Estudios terapéuticos - investigación de los resultados del tratamiento.

Intracranial aneurysm's association with genetic variants, transcription abnormality, and methylation changes in ADAMTS genes.

PURPOSE: The development of intracranial aneurysm (IA) has been linked to genetic factors. The current study examines the potential role of genes encoding disintegrin and metalloproteinase using thrombospondin motifs (ADAMTS) in IA development. MATERIAL AND METHODS: High-throughput whole-genome and whole-exome sequencing were used when screening for deleterious single-nucleotide variants (SNVs) in ADAMTS genes using samples from 20 Han Chinese patients: 19 with familial IA and one patient with sporadic IA. The variant frequencies in these subjects were compared to those in control individuals found in the Genome Aggregation Database. Transcriptome sequencing and methylation sequencing data were retrieved from the Gene Expression Omnibus (GEO) database to identify differentially expressed ADAMTS genes and their methylation sites. We predicted the network of interactions among proteins encoded by the overlapping set of ADAMTS genes showing deleterious variants and both differential expression and abnormal methylation in IA. Possible candidate proteins linked to IA were validated using Western blot analysis. The associations between IA and SNVs rs11750568 in ADAMTS2, as well as rs2301612 and rs2285489 in ADAMTS13, were verified using the Sequenom MassArray system on a separate sample set of 595 Han Chinese patients with sporadic IA and 600 control individuals. RESULTS: A total of 16 deleterious variants in 13 ADAMTS genes were identified in our patients, and seven of these genes overlapped with the genes found to be differentially expressed and differentially methylated in the GEO database. Protein-protein interaction analysis predicted that ADAMTSL1 was at the center of the seven genes. ADAMTSL1 protein was lower expressed in IA tissue than in the control cerebral artery. Frequencies of the IA-related SNVs rs11750568 in ADAMTS2 and rs2301612 and rs2285489 in ADAMTS13 were not significantly different between sporadic IA patients and controls. CONCLUSION: IA is associated with genetic variants, differential expression, and abnormal methylation in ADAMTS genes, ADAMTSL1 in particular.

Autoantibody-Mediated Erythrophagocytosis Increases Tuberculosis Susceptibility in HIV Patients.

Macrophage dysfunction is associated with increased tuberculosis (TB) susceptibility in patients with human immunodeficiency virus (HIV) infection. However, the mechanisms underlying how HIV infection impairs macrophage function are unclear. Here, we found that levels of autoantibodies against red blood cells (RBCs) were significantly elevated in patients with HIV as determined by direct antiglobulin test (DAT). DAT positivity was significantly associated with TB incidence in both univariate and multivariate analyses (odds ratio [OR] = 11.96 [confidence interval {CI}, 4.68 to 30.93] and 12.65 [3.33 to 52.75], respectively). Ex vivo analysis showed that autoantibodies against RBCs enhanced erythrophagocytosis and thus significantly impaired macrophage bactericidal function against intracellular Mycobacterium tuberculosis Mechanistically, autoantibody-mediated erythrophagocytosis increased heme oxygenase-1 (HO-1) expression, which inhibited M. tuberculosis-induced autophagy in macrophages. Silencing ATG5, a key component for autophagy, completely abrogated the effect of erythrophagocytosis on macrophage bactericidal activity against M. tuberculosis In conclusion, we have demonstrated that HIV infection increases autoantibody-mediated erythrophagocytosis. This process impairs macrophage bactericidal activity against M. tuberculosis by inhibiting HO-1-associated autophagy. These findings reveal a novel mechanism as to how HIV infection increases TB susceptibility.IMPORTANCE HIV infection significantly increases TB susceptibility due to CD4 T-cell loss and macrophage dysfunction. Although it is relatively clear that CD4 T-cell loss represents a direct effect of HIV infection, the mechanism underlying how HIV infection dampens macrophage function is unknown. Here, we show that HIV infection enhances autoantibody-mediated erythrophagocytosis, which dampens macrophage bactericidal activity against TB by inhibiting HO-1-associated autophagy. Our findings reveal a novel mechanism explaining how HIV infection increases susceptibility to TB. We propose that DAT could be a potential measure to identify HIV patients who are at high TB risk and who would be suitable for anti-TB chemotherapy preventive treatment.

Poly(dithiazolfluorene- alt-selenadiazolobenzotriazole)-Based Blue-Light Photodetector and Its Application in Visible-Light Communication.

Conjugated polymers have attracted broad interest from synthetic chemists and device developers in optoelectronic fields. In this study, we report a blue-light organic photodetector (OPD) based on our low-band and ambipolar PSeN polymer. Besides high stability, the device has excellent color-selective property in the visible-light region. At the bias of -3 V, the ratio of the external quantum efficiency (EQE) in blue to red is more than 10:1. Meanwhile, the device also shows very low dark current density of ∼21 nA/cm2 and high EQE more than 100% for blue light at the bias of -3 V. Then, the mechanism of the high EQE in single-sensitive layer structure devices is analyzed by considering the activation energy of traps and carrier injection. Furthermore, for portable purposes, a flexible blue-light OPD is designed. This OPD shows a great orthogonal light response to blue and orange contents in a white light source and will be a potential candidate in a two-channel visible-light communication system.

[Analysis of NF2 gene mutations in intraspinal Schwannomas].

OBJECTIVE: To explore the correlation between intraspinal Schwannomas and mutations of the NF2 gene. METHODS: Samples from 20 patients with sporadic intraspinal Schwannomas were collected and subjected NF2 gene mutation detection by PCR amplification and Sanger sequencing. RESULTS: Four de novo frameshifting mutations of the NF2 gene were discovered in the tumor tissues, which included c.1213_1231delTGAGCAGGAAATGCAGCGC, c.752delC, c.519_556delATAAATCTGTACAGATGACTCCGGAAATGTGGGAGGA and c.255delT. The same mutations were not found in the peripheral blood samples of the corresponding patients. The mutations have resulted in alteration of primary structure of the protein. No significant difference was found in the age [(60.25± 7.37) vs. (52.44 ± 10.16), P > 0.05] or diameters of tumor [(2.83 ± 0.31) cm vs. (2.31 ± 0.32) cm, P> 0.05] between patients with or without the mutations. CONCLUSION: The occurrance and evolvement of sporadic intraspinal Schwannomas have a close relationship with mutations of the NF2 gene. The latters may result in structural change and functional loss of the encoded protein and lead to the disease phenotype in the patients.