RESUMO
OBJECTIVE: Pro-inflammatory polarization of adipose tissue macrophages (ATMs) plays a critical role in the pathogenesis of obesity-associated chronic inflammation. However, little is known about the role of lipids in the regulation of ATMs polarity and inflammation in response to metabolic stress. Deletion of α/ß-hydrolase domain-containing 6 (ABHD6), a monoacylglycerol (MAG) hydrolase, has been shown to protect against diet-induced obesity and insulin resistance. METHODS: Here we investigated the immunometabolic role of macrophage ABHD6 in response to nutrient excess using whole-body ABHD6-KO mice and human and murine macrophage cell-lines treated with KT203, a selective and potent pharmacological ABHD6 inhibitor. RESULTS: KO mice on high-fat diet showed lower susceptibility to systemic diet-induced inflammation. Moreover, in the setting of overnutrition, stromal vascular cells from gonadal fat of KO vs. control mice contained lower number of M1 macrophages and exhibited enhanced levels of metabolically activated macrophages (MMe) and M2 markers, oxygen consumption, and interleukin-6 (IL-6) release. Likewise, under in vitro nutri-stress condition, inhibition of ABHD6 in MMe-polarized macrophages attenuated the expression and release of pro-inflammatory cytokines and M1 markers and induced the upregulation of lipid metabolism genes. ABHD6-inhibited MMe macrophages showed elevated levels of peroxisome proliferator-activated receptors (PPARs) and 2-MAG species. Notably, among different MAG species, only 2-MAG treatment led to increased levels of PPAR target genes in MMe macrophages. CONCLUSIONS: Collectively, our findings identify ABHD6 as a key component of pro-inflammatory macrophage activation in response to excess nutrition and implicate an endogenous macrophage lipolysis/ABHD6/2-MAG/PPARs cascade, as a lipid signaling and immunometabolic pathway, which favors the anti-inflammatory polarization of ATMs in obesity.
Assuntos
Monoglicerídeos , Receptores Ativados por Proliferador de Peroxissomo , Humanos , Animais , Camundongos , Receptores Ativados por Proliferador de Peroxissomo/metabolismo , Monoglicerídeos/metabolismo , Camundongos Obesos , Hidrolases/genética , Hidrolases/metabolismo , Tecido Adiposo/metabolismo , Macrófagos/metabolismo , Obesidade/metabolismo , Inflamação/metabolismo , Anti-Inflamatórios , Dieta Hiperlipídica/efeitos adversos , Monoacilglicerol Lipases/genética , Monoacilglicerol Lipases/metabolismoRESUMO
Do you always get what you want? Although none of us do, improving your negotiation skills can help increase your chances. This article discusses the importance of negotiation skills, the need to create a win-win situation, and summarizes the negotiation process: planning negotiations, conducting negotiations, postponing negotiations, and reaching closure, which is followed by an example. This article was written to help you to further develop your negotiation skills so that you can get what you want.
Assuntos
Relações Interprofissionais , Negociação/métodos , Competência Profissional , Humanos , Pessoal de Laboratório Médico , Estados UnidosRESUMO
OBJECTIVE: To describe our initial experience with a computerized telecommunication system, termed the interactive voice-response system, to record resident performance of laparoscopic surgery. METHODS: After completing a laparoscopic procedure, the surgeon and resident telephone a toll-free number independently and respond to three prerecorded statements using a Likert scale of 1 to 5. The caller then is asked to describe the resident's response to critical incidents or elements of surprise that arose during the surgery. The ratings and verbal comments are compiled, transcribed, and forwarded to the respective resident. The resident (and program director) can hear the verbal comments by entering a four-digit code. RESULTS: Between May 1, 1995, and May 31, 1996, 430 cases were reported by 11 surgeons and 16 residents using the interactive voice-response system. One hundred ninety-five (45%) procedures were entered by both the resident and surgeon. A survey undertaken during the introductory phase of the project revealed that five of the seven residents exposed to the system found that it provided useful feedback and preferred the system to traditional in-service reporting methods. In addition, five residents thought that the system complemented the personal feedback they received in the operating room. CONCLUSION: The system has been accepted by both residents and surgeons and has addressed the important components of resident in-training evaluation, namely, evaluation on a case-by-case basis, timely feedback, and self-assessment of resident performance.
Assuntos
Instrução por Computador , Avaliação Educacional/métodos , Internato e Residência , Laparoscopia , Telecomunicações , Estudos de Viabilidade , HumanosRESUMO
To estimate the prevalence of dissociative disorders in a day hospital and examine their relation to traumatic experiences, trained clinicians evaluated 70 of 229 patients consecutively admitted to an acute care day hospital. They used the Mini-Structured Clinical Interview for DSM-III-R Dissociative Disorders and the Traumatic Experience Questionnaire. Six of the 70 patients (9 percent) received a definite diagnosis of a dissociative disorder. Five of the six patients reported a childhood history of sexual or physical abuse. The results show that dissociative disorders are not rare among general psychiatric patients in a day hospital setting and are associated with histories of childhood trauma.
Assuntos
Hospital Dia/estatística & dados numéricos , Transtornos Dissociativos/epidemiologia , Adulto , Idoso , Criança , Maus-Tratos Infantis/psicologia , Maus-Tratos Infantis/estatística & dados numéricos , Abuso Sexual na Infância/psicologia , Abuso Sexual na Infância/estatística & dados numéricos , Connecticut/epidemiologia , Estudos Transversais , Transtornos Dissociativos/diagnóstico , Transtornos Dissociativos/psicologia , Feminino , Humanos , Incidência , Masculino , Indigência Médica/estatística & dados numéricos , Pessoa de Meia-Idade , Escalas de Graduação Psiquiátrica , Transtornos de Estresse Pós-Traumáticos/diagnóstico , Transtornos de Estresse Pós-Traumáticos/epidemiologia , Transtornos de Estresse Pós-Traumáticos/psicologiaRESUMO
Some managers may not feel confident conducting job interviews. A major reason is that most have not been trained to interview, and managers in departments with few employees and/or low turnover rates usually do not interview frequently enough to develop the skill on their own. Hiring the wrong employee results in wasted time, effort, and money, and possibly a law suit. A list of what you can and cannot legally ask during the selection process is presented in Table 1. The best way to avoid problem employees is not to hire them in the first place.
Assuntos
Entrevistas como Assunto/métodos , Seleção de Pessoal/métodos , Entrevistas como Assunto/normas , Laboratórios/organização & administração , Seleção de Pessoal/legislação & jurisprudência , Seleção de Pessoal/normas , Estados Unidos , Recursos HumanosRESUMO
Do you always agree with your boss, peers, and employees? If not, then you have conflict. This article presents five conflict management styles and examples of situations in which each is appropriate for resolving a conflict. With the aid of step-by-step models, you will learn how to use the Collaborating conflict-management style to: 1) initiate a conflict resolution with others; 2) respond to a conflict resolution brought to you by someone; and 3) mediate a conflict resolution between your employees. This article should help you to improve your ability to resolve conflicts without negative effects on human relations.
Assuntos
Conflito Psicológico , Reivindicações Trabalhistas , Relações Interprofissionais , Modelos Psicológicos , Gestão de Recursos Humanos/normas , Humanos , Administração de Recursos Humanos em Hospitais/normas , Resolução de Problemas , Estados UnidosAssuntos
Síndrome da Imunodeficiência Adquirida/prevenção & controle , Transtornos Mentais/reabilitação , Educação de Pacientes como Assunto , Educação Sexual , Infecções Sexualmente Transmissíveis/prevenção & controle , Síndrome da Imunodeficiência Adquirida/transmissão , Adulto , Centros Comunitários de Saúde Mental , Connecticut , Hospital Dia , Feminino , Conhecimentos, Atitudes e Prática em Saúde , Humanos , Masculino , Indigência Médica , Pessoa de Meia-Idade , Fatores de Risco , Infecções Sexualmente Transmissíveis/transmissãoAssuntos
Síndrome da Imunodeficiência Adquirida/prevenção & controle , Hospital Dia/estatística & dados numéricos , Conhecimentos, Atitudes e Prática em Saúde , Hospitais Psiquiátricos/estatística & dados numéricos , Transtornos Mentais/reabilitação , Síndrome da Imunodeficiência Adquirida/psicologia , Síndrome da Imunodeficiência Adquirida/transmissão , Adulto , Connecticut , Feminino , Comportamentos Relacionados com a Saúde , Humanos , Masculino , Transtornos Mentais/psicologia , Educação de Pacientes como Assunto , Fatores de RiscoRESUMO
Responding to an increase in the number of acutely and severely ill patients being treated in partial hospital programs, this paper addresses the treatment of aggressive patients in acute partial hospital settings. The authors review the limited conceptual literature published in this area and then suggest concrete strategies of intervention that fit the day-to-day life of a day hospital. They take as a guiding principle for these interventions an extension of the tenet of deinstitutionalization that patients be treated in the least restrictive manner possible and offer a variety of possible interventions for managing aggressive acts, ranging from least to most restrictive. Six issues which arise in applying less restrictive controls in the partial hospital treatment of aggressive patients are then identified, and illustrations of the principles employed in each of these areas are provided through reflection on two representative clinical vignettes. Taken together, these principles and interventions suggest ways for staff to intervene with aggressive patients, with each other, and with the significant others in patients' lives, in a manner which respects and fosters patients' autonomy and individual responsibility for their own behavior while maintaining a safe environment.
Assuntos
Agressão , Hospital Dia/normas , Assistência Progressiva ao Paciente/normas , Segurança , Violência , Adulto , Connecticut , Intervenção em Crise , Hospital Dia/organização & administração , Desinstitucionalização/organização & administração , Estudos de Avaliação como Assunto , Feminino , Humanos , Masculino , Participação do Paciente , Relações Profissional-Paciente , Assistência Progressiva ao Paciente/métodosRESUMO
The clinical laboratory is a fast-paced environment where accuracy and efficiency are crucial. A major responsibility of the clinical manager is to assign tasks clearly to ensure that a quality job is done right the first time. Have you ever heard a manager say "This isn't what I asked for?" When this happens, it is usually the fault of the manager. Managers often make incorrect assumptions and do not take 100% of the responsibility for ensuring that assigned tasks are understood. To assign tasks effectively, managers must state exactly what they want, how they want it done, and when they want it. And, in addition to stating the desired end results, managers must verify that the directions were correctly understood; this is done by asking for feedback through questioning and paraphrasing. The five-step model described in this article will help you to assign tasks that get the job done right the first time.
Assuntos
Laboratórios/organização & administração , Gestão de Recursos Humanos/métodos , Comunicação , Retroalimentação , Humanos , Pessoal de Laboratório Médico , Gestão de Recursos Humanos/normas , Estados UnidosRESUMO
One characteristic of power is the ability to influence others; managers cannot be effective without it. Politics is the network of interactions by which power is acquired, transferred, and exercised; it is a fact of health-care life. Like the money in our economy, politics is the medium of exchange in an organization. Managers must be political beings to meet their objectives. This article helps you to assess your political behavior and describes specific methods to increase power and develop political skills. Using these techniques can result in getting what you want and having things done your way, resulting in better job performance and career advancement.
Assuntos
Pessoal Administrativo , Liderança , Política , Poder Psicológico , Laboratórios Hospitalares/organização & administração , Estados UnidosRESUMO
The nucleotide sequence of 6.2 kb (1 kb = 10(3) base-pairs) of DNA that encompasses the earliest replicating portion of the amplified dihydrofolate reductase domains of CHOC 400 cells has been determined. Origin region DNA contains two AluI family repeats, a novel repetitive element (termed ORR-1), a TGGGT-rich region, and several homopurine/homopyrimidine and alternating purine/pyrimidine tracts, including an unusual cluster of simple repeating sequences composed of (G-C)5, (A-C)18, (A-G)21, (G)9, (CAGA)4, GAGGGAGAGAGGCAGAGAGGG, (A-G)27. Recombinant plasmids containing origin region sequences were examined for DNA structural conformations previously implicated in origin activation. Mung bean nuclease sensitivity assays for DNA unwinding elements show the preferred order of nuclease cleavage at neutral pH in supercoiled origin plasmids to be: (A-T)23 much greater than the (A-G) cluster much greater than (A)38 much greater than vector = (AATT)n. At acid pH, the hierarchy of cleavage preferences changes to: the (A-G) cluster much greater than (A-T)23 much greater than (AATT)n greater than vector = (A)38. A region of stably bent DNA was identified and shown not to be reactive in the mung bean nuclease unwinding assay at either acid or neutral pH. Intermolecular hybridization studies show that, in the presence of torsional stress at pH 5.2, the (A-G) cluster forms triple-stranded DNA. These results show that the origin region of an amplified chromosomal replicon contains a novel repetitive element and multiple sequence elements that facilitate DNA bending, DNA unwinding and the formation of intramolecular triple-stranded DNA.
Assuntos
DNA/genética , Genes , Replicon , Tetra-Hidrofolato Desidrogenase/genética , Animais , Sequência de Bases , Linhagem Celular , Clonagem Molecular , Amplificação de Genes , Humanos , Substâncias Macromoleculares , Dados de Sequência Molecular , Conformação de Ácido Nucleico , Plasmídeos , Sequências Repetitivas de Ácido Nucleico , Mapeamento por Restrição , Homologia de Sequência do Ácido NucleicoRESUMO
A study of ambulatory care and education was conducted by sending questionnaires to U.S. Department of Veterans Affairs hospitals (75) and medical schools (65) prior to the Conference on Ambulatory Care and Education. Responses from 48% of medical schools indicated that there was little required clinical time in ambulatory care (15-20%), as well as faculty resistance and lack of medical school commitment to ambulatory care education. VA respondents (35% sample) also documented relatively little training in ambulatory care at the undergraduate and graduate levels. Numerous barriers to ambulatory care education are mentioned and strategies for overcoming the problems found are discussed.
Assuntos
Assistência Ambulatorial/estatística & dados numéricos , Educação Médica/estatística & dados numéricos , Hospitais de Veteranos , Faculdades de Medicina , Currículo , Educação de Graduação em Medicina/estatística & dados numéricos , Humanos , Internato e Residência , Especialização , Inquéritos e Questionários , Estados UnidosRESUMO
This research examined the relationship between hopelessness, defined as a system of negative expectancies about the future, and two theoretically relevant constructs: internal-external locus of control, and depression. Two samples of 67 and 44 undergraduates were administered the Beck, et al. Hopelessness Scale, the Rotter Internal-External Scale, and the Beck Depression Inventory. The data of both samples supported the predictions that hopelessness would be positively related to external locus of control and to depression.