RESUMO
Objectives: The aim of this meta-analysis was to determine the effects of respiratory muscle training (RMT) on functional ability, pain-related outcomes, and respiratory function in individuals with sub-acute and chronic low back pain (LBP). Methods: The study selection was as follows: (participants) adult individuals with >4 weeks of LBP; (intervention) RMT; (comparison) any comparison RMT (inspiratory or expiratory or mixed) versus control; (outcomes) postural control, lumbar disability, pain-related outcomes, pain-related fear-avoidance beliefs, respiratory muscle function, and pulmonary function; and (study design) randomized controlled trials. Results: 11 studies were included in the meta-analysis showing that RMT produces a statistically significant increase in postural control (mean difference (MD) = 21.71 [12.22; 31.21]; decrease in lumbar disability (standardized mean difference (SMD) = 0.55 [0.001; 1.09]); decrease in lumbar pain intensity (SMD = 0.77 [0.15; 1.38]; increase in expiratory muscle strength (MD = 8.05 [5.34; 10.76]); and increase in forced vital capacity (FVC) (MD = 0.30 [0.03; 0.58]) compared with a control group. However, RMT does not produce an increase in inspiratory muscle strength (MD = 18.36 [-1.61; 38.34]) and in forced expiratory volume at the first second (FEV1) (MD = 0.36 [-0.02; 0.75]; and in the FEV1/FVC ratio (MD = 1.55 [-5.87; 8.96]) compared with the control group. Conclusions: RMT could improve expiratory muscle strength and FVC, with a moderate quality of evidence, whereas a low quality of evidence suggests that RMT could improve postural control, lumbar disability, and pain intensity in individuals with sub-acute and chronic LBP. However, more studies of high methodological quality are needed to strengthen the results of this meta-analysis.
RESUMO
BACKGROUND: The absence of virus expression during the chronic stage of bovine leukemia virus (BLV) infection and its reactivation upon ex vivo culture has become a long-lived Dogma. During the chronic stage of BLV infection the immune response limits viral replication and the mitotic division of latently infected cells, carrying BLV provirus, allows viral expansion and disease progression towards a lymphoproliferative disorder. Several stressor factors have been associated with animal production and handling. As natural mediator of stress, glucocorticoids are strong immunosuppressive agents; moreover, they can bind long-terminal repeat region of retroviruses and induce viral expression. In the present study, we present a case report describing the spontaneous reactivation of BLV infection in naturally infected cattle. CASE PRESENTATION: In order to investigate if virus reactivation occurred in vivo during the course of BLV infection, we followed up for 328 days one Holstein cow (> 3 years) chronically infected with BLV which presented high-proviral loads. This animal was neither lactating nor pregnant. Furthermore, we investigated if a stressor stimulus, in this case the administration of a synthetic glucocorticoid (dexamethasone), could impact the course of BLV infection in three additional cattle. For the first time, we observed a high level of BLV transcripts in a total of four cattle chronically infected with BLV. The detection of viral transcripts corresponding to pol gene strongly suggests virus reactivation in these animals. Interestingly, this simultaneous virus reactivation was unrelated to dexamethasone treatment. CONCLUSIONS: We reported for the first time spontaneous and high level of BLV transcriptional activation in cattle chronically infected with BLV. Although virus reactivation was unrelated to dexamethasone treatment, other stressor stimuli might have influenced this outcome. Future studies will be necessary to understand these observations, since the spontaneous virus reactivation presented here might have implications on BLV pathogenesis and transmission.
Assuntos
Leucose Enzoótica Bovina/virologia , Vírus da Leucemia Bovina/fisiologia , Ativação Viral/fisiologia , Animais , Bovinos , Dexametasona/farmacologia , Feminino , Provírus/isolamento & purificação , Estresse Fisiológico , Ativação Viral/efeitos dos fármacosRESUMO
Neospora caninum infection of cattle can be vertically transmitted, resulting in abortion or birth of infected calves. Vertical transmission occurs both in acutely or chronically infected cattle. There is little information on the immune response needed to prevent endogenous transplacental transmission, particularly from chronically infected cattle to their offspring in a natural environment. In this study, N. caninum seropositive pregnant cattle from three different farms with high avidity antibodies and low IgM titers were selected and their newborn colostrum-deprived calves were tested for anti-N. caninum antibodies. Based on these results, dams were grouped according to their congenital transmission status. The analysis of the immune profile of the chronically-infected pregnant cattle revealed that higher ratio between IgG1 and IgG2 anti-N. caninum serum titers and higher levels of systemic IFN-γ were associated with diminished vertical transmission rates, compared to dams with the opposite profile. Our results evidenced an association between the immune profile and vertical transmission in non-aborting chronically infected dams, and confirm that vertical transmission, even when not leading to abortion, is related to a defined immune profile. This is important information to accomplish successful vaccine development efforts.
Assuntos
Coccidiose/imunologia , Coccidiose/transmissão , Imunoglobulina G/sangue , Transmissão Vertical de Doenças Infecciosas/veterinária , Interferon gama/sangue , Aborto Animal/imunologia , Animais , Animais Recém-Nascidos , Anticorpos Antiprotozoários/sangue , Bovinos , Doenças dos Bovinos/imunologia , Doenças dos Bovinos/transmissão , Indústria de Laticínios , Ensaio de Imunoadsorção Enzimática , Feminino , Imunoglobulina M/sangue , Masculino , Neospora , Gravidez , Complicações Parasitárias na Gravidez/veterináriaRESUMO
OBJECTIVES: The utility of many molecules as tumor markers in melanoma has been investigated with different results. The aims of this study was to compare the value of tyrosinase mRNA by reverse transcription polymerase chain reaction (RT-PCR) in peripheral blood and of serum S-100 protein in patients with melanoma at different stages of disease. METHODS: We have studied 90 peripheral blood samples corresponding to 90 patients that had been diagnosed with melanoma. The clinical staging at the time of blood sampling was performed according to the American Join Committee on Cancer guidelines. S-100 protein in serum was measured by enzyme-linked immunosorbent assay (normal range: 0-0.150 microg) and the presence of tyrosinase mRNA was assessed by RT-PCR. RESULTS: Median progression-free survival was 281 days for tyrosinase positive patients and it has not been reached for tyrosinase negative patients (P = 0.03). Median progression free survival was 213 days for patients with elevated serum S-100 and it has not been reached for patients with normal level of serum S-100 (P < 0.001). Median overall survival (OS) was 396 days for tyrosinase positive patients and it has not been reached for negative patients (P = 0.0096). Median OS was 282 days for patients with elevated serum S-100 and it has not been reached for patients with normal level of serum S-100 (P < 0.001). In a multivariate analysis, both markers have significant prognostic value for time to progression and for survival (chi(2) test). CONCLUSIONS: RT-PCR for tyrosinase mRNA and S-100 are significant prognostic factors for progression-free survival and OS in melanoma. S-100 has higher sensitivity and specificity than tyrosinase.
Assuntos
Biomarcadores Tumorais/metabolismo , Melanoma/metabolismo , Monofenol Mono-Oxigenase/metabolismo , Proteínas S100/metabolismo , Neoplasias Cutâneas/metabolismo , Adolescente , Adulto , Idoso , Idoso de 80 Anos ou mais , Criança , Pré-Escolar , Ensaio de Imunoadsorção Enzimática , Feminino , Humanos , Masculino , Melanoma/sangue , Melanoma/genética , Pessoa de Meia-Idade , Monofenol Mono-Oxigenase/genética , Estadiamento de Neoplasias , Valor Preditivo dos Testes , Prognóstico , Estudos Prospectivos , RNA Mensageiro/genética , RNA Mensageiro/metabolismo , RNA Neoplásico/genética , RNA Neoplásico/metabolismo , Reação em Cadeia da Polimerase Via Transcriptase Reversa , Sensibilidade e Especificidade , Neoplasias Cutâneas/sangue , Neoplasias Cutâneas/genética , Taxa de SobrevidaRESUMO
A need for factors predictive of prognosis is present in patients who are diagnosed with malignant melanoma. The detection of circulating melanoma cells by reverse transcriptase-polymerase chain reaction for tyrosinase mRNA is a possible negative prognostic factor. The aim of this study was to assess the prognostic value of reverse transcriptase-PCR for tyrosinase mRNA in peripheral blood samples. From January 2000 to February 2003, duplicate blood samples were drawn from 114 melanoma patients following surgery and informed consent, and were tested with reverse transcriptase-PCR, for tyrosinase mRNA. Outer primers for the first PCR were R1 (sense): TTGGCAGATTGTCTGTAGCC and R2 (antisense): AGGCATTGTGCATGCTGCT. For the second round of PCR, nested primers were R3 (sense): GTCTTTATGCAATGGAACGC and R4 (antisense): GCTATCCCAGTAAGTGGACT. Threshold for detection of the technique was determined by adding serially diluted MelJuSo cells to healthy volunteer blood samples. Overall, 91 (79.1%) patients tested negative for tyrosinase mRNA and 24 (20.9%) tested positive. The number of patients who tested positive by stage was 3/38 (7.9%) for stage I, 3/22 (13.6%) for stage II, 5/30 (16.7%) for stage III and 13/24 (54.2%) for stage IV (P< 0.0001). 11/90 (12.2%) patients with no evidence of disease (stage I, II and III) tested positive and 13/24 (54.2%) patients with clinically confirmed distant metastases (stage IV) tested positive (P<0.00001). With median follow-up of 372 days or to death (range: 0-1303 days), median progression-free survival has not been reached for tyrosinase-negative patients and was 265 days for tyrosinase-positive patients (P<0.00001, log-rank test=21.07). Median overall survival was 344 days for tyrosinase-positive patients and has not been reached for tyrosinase-negative patients (P=0.0001, log-rank test=21.38). Stage, Breslow thickness and result of RT-PCR were significant prognostic factors for disease-free survival in a multivariate analysis, and stage was the only significant prognostic factor for overall survival. In conclusion, detection of circulating melanoma cells by reverse transcriptase-PCR for tyrosinase mRNA is a significant adverse prognostic factor for disease-free survival in patients with malignant melanoma.
Assuntos
Regulação Neoplásica da Expressão Gênica , Melanoma/sangue , Melanoma/diagnóstico , Melanoma/patologia , Monofenol Mono-Oxigenase/sangue , Células Neoplásicas Circulantes , Neoplasias Cutâneas/sangue , Adulto , Idoso , Idoso de 80 Anos ou mais , Estudos de Casos e Controles , Feminino , Humanos , Masculino , Pessoa de Meia-Idade , Monofenol Mono-Oxigenase/biossíntese , Prognóstico , Reação em Cadeia da Polimerase Via Transcriptase Reversa , Neoplasias Cutâneas/diagnósticoRESUMO
Programa desenvolvido para estimular sua reflexão sobre temas relacionados aos Registros e Informações em Saúde, como parte de um processo de capacitação de pessoal para essa área. A página apresenta conceitos, histórico, organização, aspectos éticos-legais, métodos e técnicas. Acesso a fotografias, glossário, bibliografia, fórum para troca de informações e links de interesse
Assuntos
Sistemas de Informação em Saúde , Prontuários Médicos , Sistemas de Identificação de PacientesRESUMO
Este estudo de caso analisa a trajetória de construção da Escola de Governo em Saúde (EGS), implantada na Escola Nacional de Saúde Pública (ENSP) em 1998, oferecendo subsídios formular estratégias visando à sua consolidação. O estudo faz uma retrospectiva das reformas administrativas no aparato estatal brasileiro, no sistema de saúde nacional e as influências da Nova Administração Pública (NPM). Com base nas experiências apresentadas por três escolas de governo, a Ecole Nationale DAdministration (ENA), da França, o Instituto Nacional de Administração Pública (INAP), da Argentina e a Escola Nacional de Administração Pública (ENAP), foi possível identificar as estratégias utilizadas por estas escolas.A ENSP recebe uma abordagem especial por ser a instituição mater da EGS. A experiência e o conhecimento acumulados na área de saúde, além de outras variáveis, foram os componentes que construíram o cenário que permitiu a implantação da EGS no final da década de 1990.